moloney murine leukemia virus reverse transcriptase momulvrt (Thermo Fisher)

Thermo Fisher is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Name:

M MLV Reverse Transcriptase 200 U µL

Description:

M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C

Catalog Number:

28025013

Price:

None

Applications:

PCR & Real-Time PCR|Reverse Transcription

Category:

Proteins Enzymes Peptides

Buy from Supplier

Structured Review

Thermo Fisher moloney murine leukemia virus reverse transcriptase momulvrt
M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase momulvrt/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99

moloney murine leukemia virus reverse transcriptase momulvrt - by Bioz Stars, 2021-01

99/100 stars

Related Products / Commonly Used Together

tris-hcl
kcl
dithiothreitol
deoxynucleoside triphosphates
cl2
rna

Images

Real-time Polymerase Chain Reaction:

Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

Synthesized:

Isolation:

Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

Digital PCR:

Incubation:

Article Title: Double strand RNA delivery system for plant-sap-feeding insects
Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

Polymerase Chain Reaction:

Article Title: Nucleocytosolic Depletion of the Energy Metabolite Acetyl-Coenzyme A Stimulates Autophagy and Prolongs Lifespan
Article Snippet: .. Quantitative Reverse-Transcriptase PCR Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method with 18S rRNA as an internal standard was performed on an ABI StepOnePlus using SYBR Select Master Mix (Life Tech, Invitrogen) ΔΔCt-method. .. Drosophila Lifespan Analyses and Brain Immunofluorescence UAS-RNAi lines for acetyl-CoA Synthetase (P{TRiP.HMS02314}attP2) and EGFP (P{VALIUM20-EGFP.shRNA.1}attP2) serving as a background-matched control were obtained from Bloomington Drosophila Stock Center.