moloney murine leukemia virus reverse transcriptase kit  (Thermo Fisher)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    M MLV Reverse Transcriptase 200 U µL
    Description:
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    Catalog Number:
    28025013
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher moloney murine leukemia virus reverse transcriptase kit
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase kit/product/Thermo Fisher
    Average 97 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus reverse transcriptase kit - by Bioz Stars, 2021-02
    97/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Posttranslational regulation of tissue inhibitor of metalloproteinase-1 by calcium-dependent vesicular exocytosis
    Article Snippet: .. Real-time RT-PCR Changes in TIMP-1 mRNA synthesis were determined by real-time reverse transcriptase (RT-PCR) according to manufacturer's instructions using an ABI PRISM 7500 Sequence Detection System thermal cycler (Applied Biosystems, Foster City, CA). .. Cultured LX-2 cells (6-well plates) were plated and treated with either control or BAPTA/AM (50 μmol/L) for 30 min or 12 h as described above (n = 6 for each condition).

    Article Title: Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) For RT-PCR, total RNA from cultured cells was isolated by Trizol reagent (Invitrogen). .. RT-PCRs were performed using Superscript One-Step RT-PCR (Invitrogen) with 0.5 μg of total RNA and two primer sets per reaction tube: one set for the actin as a control and another for the REST/NRSF.

    Article Title: Molecular Basis of Azithromycin-Resistant Pseudomonas aeruginosa Biofilms †
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) was performed on biofilm RNA samples to validate microarray analysis by using a One-Step RT-PCR kit (Invitrogen, Carlsbad, CA) in a Sprint thermal cycler (ThermoElectron, Waltham, MA). .. Reverse transcription parameters were 50°C for 40 min and 94°C for 4 min, followed by PCR parameters of 35 cycles of 94°C for 40 s, 60°C for 45 s, and 72°C for 60 s, with a final elongation of 72°C for 7 min. Transcript targets used for RT-PCR were as follows: mexA (sense primer, 5′-CAGCAGCTCTACCAGATCGAC-3′; antisense primer, 5′-GTATTGGCTACCGTCCTCCAG-3′), mexC (sense primer, 5′-CTGATTTGCGTGCAATAGGAAG-3′; antisense primer, 5′-ATCGATCTGGAACAGCAGGT-3′), nfxB (sense primer, 5′-GAGACCGTACTGAACCAGATCAT; antisense primer, 5′-GTGATGAACAGTTCGGTGAACA-3′), and exsA (sense primer, 5′-TTCCATTATCTGCCCAGTTTCTA-3′; antisense primer, 5′-TGAGGTAGTGCTTCTCCATGAAT-3′).

    Synthesized:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Isolation:

    Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
    Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) For RT-PCR, total RNA from cultured cells was isolated by Trizol reagent (Invitrogen). .. RT-PCRs were performed using Superscript One-Step RT-PCR (Invitrogen) with 0.5 μg of total RNA and two primer sets per reaction tube: one set for the actin as a control and another for the REST/NRSF.

    Quantitative RT-PCR:

    Article Title: Posttranslational regulation of tissue inhibitor of metalloproteinase-1 by calcium-dependent vesicular exocytosis
    Article Snippet: .. Real-time RT-PCR Changes in TIMP-1 mRNA synthesis were determined by real-time reverse transcriptase (RT-PCR) according to manufacturer's instructions using an ABI PRISM 7500 Sequence Detection System thermal cycler (Applied Biosystems, Foster City, CA). .. Cultured LX-2 cells (6-well plates) were plated and treated with either control or BAPTA/AM (50 μmol/L) for 30 min or 12 h as described above (n = 6 for each condition).

    Digital PCR:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Microarray:

    Article Title: Molecular Basis of Azithromycin-Resistant Pseudomonas aeruginosa Biofilms †
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) was performed on biofilm RNA samples to validate microarray analysis by using a One-Step RT-PCR kit (Invitrogen, Carlsbad, CA) in a Sprint thermal cycler (ThermoElectron, Waltham, MA). .. Reverse transcription parameters were 50°C for 40 min and 94°C for 4 min, followed by PCR parameters of 35 cycles of 94°C for 40 s, 60°C for 45 s, and 72°C for 60 s, with a final elongation of 72°C for 7 min. Transcript targets used for RT-PCR were as follows: mexA (sense primer, 5′-CAGCAGCTCTACCAGATCGAC-3′; antisense primer, 5′-GTATTGGCTACCGTCCTCCAG-3′), mexC (sense primer, 5′-CTGATTTGCGTGCAATAGGAAG-3′; antisense primer, 5′-ATCGATCTGGAACAGCAGGT-3′), nfxB (sense primer, 5′-GAGACCGTACTGAACCAGATCAT; antisense primer, 5′-GTGATGAACAGTTCGGTGAACA-3′), and exsA (sense primer, 5′-TTCCATTATCTGCCCAGTTTCTA-3′; antisense primer, 5′-TGAGGTAGTGCTTCTCCATGAAT-3′).

    Incubation:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Polymerase Chain Reaction:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) For RT-PCR, total RNA from cultured cells was isolated by Trizol reagent (Invitrogen). .. RT-PCRs were performed using Superscript One-Step RT-PCR (Invitrogen) with 0.5 μg of total RNA and two primer sets per reaction tube: one set for the actin as a control and another for the REST/NRSF.

    Article Title: Molecular Basis of Azithromycin-Resistant Pseudomonas aeruginosa Biofilms †
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) was performed on biofilm RNA samples to validate microarray analysis by using a One-Step RT-PCR kit (Invitrogen, Carlsbad, CA) in a Sprint thermal cycler (ThermoElectron, Waltham, MA). .. Reverse transcription parameters were 50°C for 40 min and 94°C for 4 min, followed by PCR parameters of 35 cycles of 94°C for 40 s, 60°C for 45 s, and 72°C for 60 s, with a final elongation of 72°C for 7 min. Transcript targets used for RT-PCR were as follows: mexA (sense primer, 5′-CAGCAGCTCTACCAGATCGAC-3′; antisense primer, 5′-GTATTGGCTACCGTCCTCCAG-3′), mexC (sense primer, 5′-CTGATTTGCGTGCAATAGGAAG-3′; antisense primer, 5′-ATCGATCTGGAACAGCAGGT-3′), nfxB (sense primer, 5′-GAGACCGTACTGAACCAGATCAT; antisense primer, 5′-GTGATGAACAGTTCGGTGAACA-3′), and exsA (sense primer, 5′-TTCCATTATCTGCCCAGTTTCTA-3′; antisense primer, 5′-TGAGGTAGTGCTTCTCCATGAAT-3′).

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Cell Culture:

    Article Title: Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification
    Article Snippet: .. Reverse transcriptase PCR (RT-PCR) For RT-PCR, total RNA from cultured cells was isolated by Trizol reagent (Invitrogen). .. RT-PCRs were performed using Superscript One-Step RT-PCR (Invitrogen) with 0.5 μg of total RNA and two primer sets per reaction tube: one set for the actin as a control and another for the REST/NRSF.

    Sequencing:

    Article Title: Posttranslational regulation of tissue inhibitor of metalloproteinase-1 by calcium-dependent vesicular exocytosis
    Article Snippet: .. Real-time RT-PCR Changes in TIMP-1 mRNA synthesis were determined by real-time reverse transcriptase (RT-PCR) according to manufacturer's instructions using an ABI PRISM 7500 Sequence Detection System thermal cycler (Applied Biosystems, Foster City, CA). .. Cultured LX-2 cells (6-well plates) were plated and treated with either control or BAPTA/AM (50 μmol/L) for 30 min or 12 h as described above (n = 6 for each condition).

    Software:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher cdna kit
    Cdna Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cdna kit/product/Thermo Fisher
    Average 97 stars, based on 270 article reviews
    Price from $9.99 to $1999.99
    cdna kit - by Bioz Stars, 2021-02
    97/100 stars
      Buy from Supplier

    99
    Thermo Fisher revertaid m mulv rt kit
    Revertaid M Mulv Rt Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid m mulv rt kit/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revertaid m mulv rt kit - by Bioz Stars, 2021-02
    99/100 stars
      Buy from Supplier

    97
    Thermo Fisher revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit
    Revertaid H Minus M Mulv Reverse Transcriptase First Strand Cdna Synthesis Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revertaid h minus m mulv reverse transcriptase first strand cdna synthesis kit - by Bioz Stars, 2021-02
    97/100 stars
      Buy from Supplier

    Image Search Results