Structured Review

Mobitec mobispin s 400 spin columns
Mobispin S 400 Spin Columns, supplied by Mobitec, used in various techniques. Bioz Stars score: 86/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mobispin s 400 spin columns/product/Mobitec
Average 86 stars, based on 55 article reviews
Price from $9.99 to $1999.99
mobispin s 400 spin columns - by Bioz Stars, 2020-08
86/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Isolation and partial characterization of a highly divergent lineage of hantavirus from the European mole (Talpa europaea)
Article Snippet: .. PCR products were separated, using MobiSpin S-400 spin columns (MoBiTec, Goettingen, Germany), and amplicons were sequenced directly using an ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA) . ..

Article Title: Genetic variants of Cao Bang hantavirus in the Chinese mole shrew (Anourosorex squamipes) and Taiwanese mole shrew (Anourosorex yamashinai)
Article Snippet: .. PCR products were separated, using MobiSpin S-400 spin columns (MoBiTec, Goettingen, Germany), and amplicons were sequenced directly using an ABI Prism 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA). .. Phylogenetic trees were generated by maximum likelihood and Bayesian methods, implemented in PAUP* (Phylogenetic Analysis Using Parsimony, 4.0b10) , RAxML Blackbox webserver ( ) and MrBayes 3.1 , under the best-fit GTR+I+Γ model of evolution selected by hierarchical likelihood-ratio test in MrModeltest v2.3 ( ) and jModelTest version 0.1 ( ).

Article Title: Predicted Benign and Synonymous Variants in CYP11A1 Cause Primary Adrenal Insufficiency Through Missplicing
Article Snippet: .. PCR products were sequenced as above (section A-5), column purified using the QIAquick® PCR Purification Kit according to the manufacturer’s protocol, and cloned into the Exontrap cloning vector pET01 (MoBiTec GmbH). .. The cloned sequences were verified by Sanger sequencing to ensure the fragment was in the correct orientation using pET01 specific primers [ET PRIM 06 (forward) GCGAAGTGGAGGATCCACAAG and ET PRIM 07 (reverse) ACCCGGATCCAGTTGTGCCA].

Clone Assay:

Article Title: Predicted Benign and Synonymous Variants in CYP11A1 Cause Primary Adrenal Insufficiency Through Missplicing
Article Snippet: .. PCR products were sequenced as above (section A-5), column purified using the QIAquick® PCR Purification Kit according to the manufacturer’s protocol, and cloned into the Exontrap cloning vector pET01 (MoBiTec GmbH). .. The cloned sequences were verified by Sanger sequencing to ensure the fragment was in the correct orientation using pET01 specific primers [ET PRIM 06 (forward) GCGAAGTGGAGGATCCACAAG and ET PRIM 07 (reverse) ACCCGGATCCAGTTGTGCCA].

other:

Article Title: Overlapping Activities of Two Neuronal Splicing Factors Switch the GABA Effect from Excitatory to Inhibitory by Regulating REST
Article Snippet: Alternative exons and adjacent ~800 bp intronic sequences were PCR amplified (see primers in ) and subcloned into the exon trap pET-01 vector (Mobitec).

Article Title: Role of Maltogenic Amylase and Pullulanase in Maltodextrin and Glycogen Metabolism of Bacillus subtilis 168 ▿ 168 ▿ †
Article Snippet: The PCR product was cloned into pWH1520 (MoBiTec, Göttingen, Germany), a shuttle vector.

Article Title: A novel LRAT mutation affecting splicing in a family with early onset retinitis pigmentosa
Article Snippet: PCR products were cloned into a TA vector (pCR®II TOPO) and then subcloned into Exontrap cloning Vector pET01 (MoBiTec GmbH, Göttingen, Germany) via BamHI and NotI restriction sites to generate the wildtype WT-LRAT-pET01 and mutant Mut-LRAT-pET01 constructs.

Plasmid Preparation:

Article Title: Predicted Benign and Synonymous Variants in CYP11A1 Cause Primary Adrenal Insufficiency Through Missplicing
Article Snippet: .. PCR products were sequenced as above (section A-5), column purified using the QIAquick® PCR Purification Kit according to the manufacturer’s protocol, and cloned into the Exontrap cloning vector pET01 (MoBiTec GmbH). .. The cloned sequences were verified by Sanger sequencing to ensure the fragment was in the correct orientation using pET01 specific primers [ET PRIM 06 (forward) GCGAAGTGGAGGATCCACAAG and ET PRIM 07 (reverse) ACCCGGATCCAGTTGTGCCA].

Purification:

Article Title: Predicted Benign and Synonymous Variants in CYP11A1 Cause Primary Adrenal Insufficiency Through Missplicing
Article Snippet: .. PCR products were sequenced as above (section A-5), column purified using the QIAquick® PCR Purification Kit according to the manufacturer’s protocol, and cloned into the Exontrap cloning vector pET01 (MoBiTec GmbH). .. The cloned sequences were verified by Sanger sequencing to ensure the fragment was in the correct orientation using pET01 specific primers [ET PRIM 06 (forward) GCGAAGTGGAGGATCCACAAG and ET PRIM 07 (reverse) ACCCGGATCCAGTTGTGCCA].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Mobitec mobispin s 400 spin columns
    Mobispin S 400 Spin Columns, supplied by Mobitec, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mobispin s 400 spin columns/product/Mobitec
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    mobispin s 400 spin columns - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    Image Search Results