Structured Review

Roche mnase
Terminally unwrapped CENP-A <t>nucleosomes</t> and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and <t>MNase</t> cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.
Mnase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mnase/product/Roche
Average 95 stars, based on 3 article reviews
Price from $9.99 to $1999.99
mnase - by Bioz Stars, 2019-12
95/100 stars

Images

1) Product Images from "The octamer is the major form of CENP-A nucleosomes at human centromeres"

Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres

Journal: Nature structural & molecular biology

doi: 10.1038/nsmb.2562

Terminally unwrapped CENP-A nucleosomes and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and MNase cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.
Figure Legend Snippet: Terminally unwrapped CENP-A nucleosomes and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and MNase cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.

Techniques Used: Sequencing

CENP-A nucleosomes are less phased and gain symmetric MNase digestion on the Y chromosome centromere that lacks functional CENP-B boxes ( a–c ) Maps of chromosome X HOR-aligned CENP-A sequences. ( d–f ). Maps of chromosome Y HOR-aligned CENP-A sequences. Data and models are shown in the same manner as for the global analysis of CENP-A nucleosome-associated α-satellite sequences ( Fig. 5 ).
Figure Legend Snippet: CENP-A nucleosomes are less phased and gain symmetric MNase digestion on the Y chromosome centromere that lacks functional CENP-B boxes ( a–c ) Maps of chromosome X HOR-aligned CENP-A sequences. ( d–f ). Maps of chromosome Y HOR-aligned CENP-A sequences. Data and models are shown in the same manner as for the global analysis of CENP-A nucleosome-associated α-satellite sequences ( Fig. 5 ).

Techniques Used: Functional Assay

Nuclease digestion of native CENP-A-containing particles resembles that of octameric nucleosomes with loose termini ( a ) DNA length distributions of MNase-digested CENP-A native ChIP and bulk nucleosomes from the same preparation. ( b ) Fluorescence in situ hybridization using DNA from bulk nucleosomes or CENP-A native ChIP as probes. Bulk nucleosome DNA labels the entire chromosome whereas CENP-A probe labels solely centromeric regions, as expected. ( c ) Quantitative real-time PCR analysis comparing enrichment of CENP-A native ChIP DNA relative to bulk nucleosome DNA. CENP-A ChIP sequences are enriched for α-satellite regions (α-satellite1, α-satellite2), but not at pericentric or promoter (aldo) regions, as expected. Error bars represent s.e.m. from three independent replicates. ( d ) Standard digestion (red) or overdigestion (blue, threefold higher concentration of MNase used) of chromatin. ( e ) DNA length distributions of CENP-A native ChIP following standard digestion (red) or overdigestion (blue) of chromatin.
Figure Legend Snippet: Nuclease digestion of native CENP-A-containing particles resembles that of octameric nucleosomes with loose termini ( a ) DNA length distributions of MNase-digested CENP-A native ChIP and bulk nucleosomes from the same preparation. ( b ) Fluorescence in situ hybridization using DNA from bulk nucleosomes or CENP-A native ChIP as probes. Bulk nucleosome DNA labels the entire chromosome whereas CENP-A probe labels solely centromeric regions, as expected. ( c ) Quantitative real-time PCR analysis comparing enrichment of CENP-A native ChIP DNA relative to bulk nucleosome DNA. CENP-A ChIP sequences are enriched for α-satellite regions (α-satellite1, α-satellite2), but not at pericentric or promoter (aldo) regions, as expected. Error bars represent s.e.m. from three independent replicates. ( d ) Standard digestion (red) or overdigestion (blue, threefold higher concentration of MNase used) of chromatin. ( e ) DNA length distributions of CENP-A native ChIP following standard digestion (red) or overdigestion (blue) of chromatin.

Techniques Used: Chromatin Immunoprecipitation, Fluorescence, In Situ, Hybridization, Real-time Polymerase Chain Reaction, Concentration Assay

2) Product Images from "T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent"

Article Title: T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20060066

Nucleosomes positioned in IFN-γ promoter chromatin in CD4 T cells. (a and b) Naive CD4 T cells were cross-linked with formaldehyde, and their chromatin was treated with MNase ( 5 , 7 .5, and 10 enzyme units). DNAs were then purified, digested with the indicated RE (or left undigested; 0), and analyzed by Southern blots using a probe indicated in panel c (directly adjacent to the RE site for HincII-cut DNAs [a] or EcoRI digests [b]). (c) Diagram of RE sites and inferred nucleosome positions at the IFN-γ promoter. The fragment used as a probe in Southern blotting and primers used for LM-PCR are shown above the gene; the transcription start site (+1) is indicated by an arrow. (d) LM-PCR mapping of nucleosome boundaries in the IFN-γ promoter. DNA purified from MNase (2.5 and 1 enzyme unit)-cleaved chromatin of naive or Th1 (6-d culture) CD4 T cells was analyzed by LM-PCR using primer x (nucleosome 1) or y (nucleosome 2) and a linker primer and was analyzed by Southern blot probed with an internal oligonucleotide (1 and 2 for nucleosomes 1 and 2). As a control for MNase cleavage preferences in DNA, pure cellular DNA was analyzed using the same preparation of MNase, linker ligation, and PCR (naked DNA). Shown is an autoradiograph representative of five independent experiments.
Figure Legend Snippet: Nucleosomes positioned in IFN-γ promoter chromatin in CD4 T cells. (a and b) Naive CD4 T cells were cross-linked with formaldehyde, and their chromatin was treated with MNase ( 5 , 7 .5, and 10 enzyme units). DNAs were then purified, digested with the indicated RE (or left undigested; 0), and analyzed by Southern blots using a probe indicated in panel c (directly adjacent to the RE site for HincII-cut DNAs [a] or EcoRI digests [b]). (c) Diagram of RE sites and inferred nucleosome positions at the IFN-γ promoter. The fragment used as a probe in Southern blotting and primers used for LM-PCR are shown above the gene; the transcription start site (+1) is indicated by an arrow. (d) LM-PCR mapping of nucleosome boundaries in the IFN-γ promoter. DNA purified from MNase (2.5 and 1 enzyme unit)-cleaved chromatin of naive or Th1 (6-d culture) CD4 T cells was analyzed by LM-PCR using primer x (nucleosome 1) or y (nucleosome 2) and a linker primer and was analyzed by Southern blot probed with an internal oligonucleotide (1 and 2 for nucleosomes 1 and 2). As a control for MNase cleavage preferences in DNA, pure cellular DNA was analyzed using the same preparation of MNase, linker ligation, and PCR (naked DNA). Shown is an autoradiograph representative of five independent experiments.

Techniques Used: Purification, Southern Blot, Polymerase Chain Reaction, Ligation, Autoradiography

3) Product Images from "CENP-A, -B, and -C Chromatin Complex That Contains the I-Type ?-Satellite Array Constitutes the Prekinetochore in HeLa Cells"

Article Title: CENP-A, -B, and -C Chromatin Complex That Contains the I-Type ?-Satellite Array Constitutes the Prekinetochore in HeLa Cells

Journal:

doi: 10.1128/MCB.22.7.2229-2241.2002

Bulk chromatin and centromeric chromatin were solubilized by MNase digestion of HeLa nuclei in 0.3 M NaCl. (A) Centromeric proteins CENP-A, -B, and -C were solubilized by MNase digestion. Isolated HeLa nuclei (2 × 108 ) were suspended with 1 ml of WB containing 0.3 M NaCl (sample a in lane 1 and sample c in lanes 4 to 6) or 0.6 M NaCl (sample b in lanes 2 and 3). Sample c was digested with 60 U of MNase per ml for 10 min at 37°C. Soluble and insoluble materials from each sample were separated by centrifugation. ACA beads were added to the supernatant of sample c and incubated overnight at 4°C. Pellets were resuspended in 1 ml of SDS buffer by extensive sonication and 5 μl of each sample was separated by SDS-7.5% (for CENP-B and CENP-C) or 12.5% (for CENP-A) PAGE, and centromeric proteins were detected by immunostaining with ACA serum. Lane 1, supernatant fraction of a; lane 2, supernatant fraction of b; lane 3, pellet fraction of b; lane 4, supernatant fraction of c before addition of ACA beads; lane 5, supernatant fraction of c after addition of ACA beads; lane 6, pellet fraction of c. Lane M, marker centromeric proteins, CENP-A, CENP-B, and CENP-C. (B) Size distribution of DNA fragments from bulk chromatin after MNase digestion. HeLa nuclei were digested with MNase to various extents. The fragmented DNA in the soluble fractions was extracted with phenol and electrophoresed through 1% agarose gel. DNA was detected with ethidium bromide staining. Lane 1, 20 U/ml for 2 min (40 U/ml × min, sample 1); lane 2, 20 U/ml for 4 min (80 U/ml × min, sample 2); lane 3, 40 U/ml for 5 min (200 U/ml × min, sample 3); lane 4, 80 U/ml for 45 min (3,600 U/ml × min, sample 4). Positions of the DNA size markers are indicated at the left. (C) Detection of core histones and CENP-A in each fraction. Soluble (sup.) and insoluble (pellet) fractions were subjected to SDS-12.5% PAGE, and the separated core histones were stained with Coomassie brilliant blue (upper panel). The proteins were transferred to a membrane and immunolabeled with ACA serum (AK) (lower panel). Lane M in the lower panel is a recombinant CENP-A marker protein. Lanes 1 to 4 correspond to samples 1 to 4 of the soluble (sup.) fractions, and lanes 5 to 8 to samples 1 to 4 of the pellet fractions.
Figure Legend Snippet: Bulk chromatin and centromeric chromatin were solubilized by MNase digestion of HeLa nuclei in 0.3 M NaCl. (A) Centromeric proteins CENP-A, -B, and -C were solubilized by MNase digestion. Isolated HeLa nuclei (2 × 108 ) were suspended with 1 ml of WB containing 0.3 M NaCl (sample a in lane 1 and sample c in lanes 4 to 6) or 0.6 M NaCl (sample b in lanes 2 and 3). Sample c was digested with 60 U of MNase per ml for 10 min at 37°C. Soluble and insoluble materials from each sample were separated by centrifugation. ACA beads were added to the supernatant of sample c and incubated overnight at 4°C. Pellets were resuspended in 1 ml of SDS buffer by extensive sonication and 5 μl of each sample was separated by SDS-7.5% (for CENP-B and CENP-C) or 12.5% (for CENP-A) PAGE, and centromeric proteins were detected by immunostaining with ACA serum. Lane 1, supernatant fraction of a; lane 2, supernatant fraction of b; lane 3, pellet fraction of b; lane 4, supernatant fraction of c before addition of ACA beads; lane 5, supernatant fraction of c after addition of ACA beads; lane 6, pellet fraction of c. Lane M, marker centromeric proteins, CENP-A, CENP-B, and CENP-C. (B) Size distribution of DNA fragments from bulk chromatin after MNase digestion. HeLa nuclei were digested with MNase to various extents. The fragmented DNA in the soluble fractions was extracted with phenol and electrophoresed through 1% agarose gel. DNA was detected with ethidium bromide staining. Lane 1, 20 U/ml for 2 min (40 U/ml × min, sample 1); lane 2, 20 U/ml for 4 min (80 U/ml × min, sample 2); lane 3, 40 U/ml for 5 min (200 U/ml × min, sample 3); lane 4, 80 U/ml for 45 min (3,600 U/ml × min, sample 4). Positions of the DNA size markers are indicated at the left. (C) Detection of core histones and CENP-A in each fraction. Soluble (sup.) and insoluble (pellet) fractions were subjected to SDS-12.5% PAGE, and the separated core histones were stained with Coomassie brilliant blue (upper panel). The proteins were transferred to a membrane and immunolabeled with ACA serum (AK) (lower panel). Lane M in the lower panel is a recombinant CENP-A marker protein. Lanes 1 to 4 correspond to samples 1 to 4 of the soluble (sup.) fractions, and lanes 5 to 8 to samples 1 to 4 of the pellet fractions.

Techniques Used: Isolation, Western Blot, Centrifugation, Incubation, Sonication, Polyacrylamide Gel Electrophoresis, Immunostaining, Marker, Agarose Gel Electrophoresis, Staining, Immunolabeling, Recombinant

Related Articles

Centrifugation:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: Subsequently, the samples were subjected to mechanical disruption by two repetitive cycles of freeze-thawing in liquid nitrogen, and 5 mM CaCl2 , 30 μL 10% DOC and 1 × complete and EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland) were added and the mixture was left on ice for 5 min. Lysates were clarified by centrifugation at 16,000 × g for 10 min at 4 °C. .. For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein).

Article Title: Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy
Article Snippet: Spheroplast were pelleted by centrifugation at 3000g , and resuspended in 1.5 ml of NPS buffer (0.5 mmol/L Spermidine, 0.075% NP-40, 50 mmol/L NaCl, 10 mmol/L Tris pH 7.4, 5 mmol/L MgCl2 , 1 mmol/L CaCl2 , 1 mmol/L β-mercaptoethanol). .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Article Title: Diversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary originDiversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary origin
Article Snippet: Spheroplast were pelleted by centrifugation at 3000g , and resuspended in 1.5 ml of NPS buffer (0.5 mmol/L Spermidine, 0.075% NP‐40, 50 mmol/L NaCl, 10 mmol/L Tris pH 7.4, 5 mmol/L MgCl2 , 1 mmol/L CaCl2 , 1 mmol/L β‐mercaptoethanol). .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Article Title: Developmental regulation of N-terminal H2B methylation in Drosophila melanogaster
Article Snippet: Washed pellets were resuspended in 0.5 ml, 0.5M HCl and rotated at 4°C for 1 h. Solutions were cleared by centrifugation (13000g × 5 min × 4°C) and dialysed against 0.1 M acetic acid at 4°C (MWCO 6000–8000). .. For the isolation of histones using MNase, nuclei were isolated from SL2 cells using a nuclear extraction buffer (1 × PBS, 0.3% Triton X−100) and digested using 500mU of MNase (Roche) per 107 cells for 10 min at 26°C.

Mass Spectrometry:

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Identity of a part of recombinant proteins was confirmed by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and the purity of the proteins was also analyzed by SDS–PAGE ( Supplementary Figure S1 ). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text.

Blocking Assay:

Article Title: A multiple redundant genetic switch locks in the transcriptional signature of T regulatory cells
Article Snippet: Nuclear pellets were subsequently treated with nuclear lysis buffer (20 mM HEPES, 300 mM NaCl, 20 mM KCl, EDTA-free complete protease inhibitor cocktail) and MNase (Nuclease S7; Roche). .. Bound proteins were eluted by boiling, separated by SDS-PAGE, and electro-transferred to PVDF.

Incubation:

Article Title: T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent
Article Snippet: Cells were rinsed three times with ice-cold PBS, resuspended in lysis buffer (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2 , 0.5% NP-40, 0.15 mM spermine, and 0.5 mM spermidine), and incubated on ice for 10 min. .. For nucleosome mapping, MNase (Roche) was added, and reactions (5 min at 20°C in 200 μl) were terminated by the addition of 200 μl proteinase K buffer (100 mM Tris-Cl, pH 8.5, 5 mM EDTA, 200 mM NaCl, 0.2% SDS, and 100 μg/ml proteinase K).

Article Title: Alterations in sperm DNA methylation, non-coding RNA and histone retention associate with DDT-induced epigenetic transgenerational inheritance of disease
Article Snippet: “Complete buffer” was supplemented with Tergitol 0.5% and DOC (sodium deoxycholate, Sigma-Aldrich 30970). .. 10 Kuntz units of MNase (Roche, cat. no. 10107921001) were added, and the samples incubated for 5 min at 37 °C. .. The reaction was stopped by the addition of 2 µl of EDTA 0.5 M. Whether the samples were treated using the MNase and 10 µl of each sample was run on a 1.5% agarose gel to verify fragment size.

Article Title: A tumor suppressor function of Smurf2 associated with controlling chromatin landscape and genome stability through RNF20
Article Snippet: The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time. .. The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time.

Article Title: The CHD6 chromatin remodeler is an oxidative DNA damage response factor
Article Snippet: Briefly, nuclei were isolated from confluent cultures of parental and ΔCHD6 A549 cells. .. For MNase (Nuclease S7, from Roche) digestion, 75 µL nuclei was used per time point, with the addition of 1 U/µL MNase and incubation at 25 °C for indicated times. .. Then, 75 µL reactions were quenched with the addition of 1.5 µL 0.5 M EDTA.

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: Cells were harvested by trypsinization, pelleted, and resuspended in co-IP buffer (50 mM HEPES, pH 7.2, 33 mM KAc, 1 mM MgCl2 , 0.5% Triton X-100, 10% glycerol) containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), and 1 mM ATP, and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. Cells were harvested by trypsinization, pelleted, and resuspended in co-IP buffer (50 mM HEPES, pH 7.2, 33 mM KAc, 1 mM MgCl2 , 0.5% Triton X-100, 10% glycerol) containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), and 1 mM ATP, and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: Supernatants were precleared with Protein A-Agarose (Roche) then incubated with 1 µg antibody at 4°C overnight with rotation. .. For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Identity of a part of recombinant proteins was confirmed by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and the purity of the proteins was also analyzed by SDS–PAGE ( Supplementary Figure S1 ). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text. .. Phosphorylation status was examined by phospho affinity gel electrophoresis using phos-tag® (Wako Pure Chemical Industries) ( ) in the presence of Mn2+ .

Article Title: Circadian Cycle-Dependent MeCP2 and Brain Chromatin Changes
Article Snippet: Nuclei were pre-warmed at 37°C and MNase (Roche) digested (2 U/mg tissue). .. Nuclei were pre-warmed at 37°C and MNase (Roche) digested (2 U/mg tissue).

Article Title: Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy
Article Snippet: Formaldehyde-treated cells were harvested by centrifugation, washed with Tris-buffered saline, and then incubated in Buffer Z2 (1 mol/L Sorbitol, 50 mmol/L Tris-Cl at pH 7.4, 10 mmol/L β-mercaptoethanol) containing 2.5 mg of zymolase 20T for 20 min at 30°C on rocker platform. .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Article Title: Diversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary originDiversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary origin
Article Snippet: Formaldehyde‐treated cells were harvested by centrifugation, washed with Tris‐buffered saline, and then incubated in Buffer Z2 (1 mol/L Sorbitol, 50 mmol/L Tris‐Cl at pH 7.4, 10 mmol/L β‐mercaptoethanol) containing 2.5 mg of zymolase 20T for 20 min at 30°C on rocker platform. .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Expressing:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For HEK 293T coimmunoprecipitation assays, cells were transiently transfected using expression vectors harboring individual Cdt1 alleles. .. Cells were harvested by trypsinization, pelleted, and resuspended in co-IP buffer (50 mM HEPES, pH 7.2, 33 mM KAc, 1 mM MgCl2 , 0.5% Triton X-100, 10% glycerol) containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), and 1 mM ATP, and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Western Blot:

Article Title: CENP-A, -B, and -C Chromatin Complex That Contains the I-Type ?-Satellite Array Constitutes the Prekinetochore in HeLa Cells
Article Snippet: The nuclear pellet (109 nuclei) was dissolved in 5 ml of ice-cold WB (20 mM HEPES [pH 8.0], 20 mM KCl, 0.5 mM EDTA, 0.5 mM dithiothreitol [DTT], 0.05 mM phenylmethylsulfonyl fluoride) containing 0.3 M NaCl. .. The nuclear suspension was digested with MNase (Roche Diagnostics) at 37°C after addition of CaCl2 to a final concentration of 2 mM.

Article Title: Analysis of PARP inhibitor toxicity by multidimensional fluorescence microscopy reveals mechanisms of sensitivity and resistance
Article Snippet: Cell pellets were collected by scraping in 1× PBS with 1× protease inhibitor (cOmplete, Roche) and split in two equal fractions: (A) For the total proteome cells were resuspended in 1× MNase buffer (0.3 M Sucrose, 50 mM Tris pH 7.5, 30 mM KCl, 7.5 mM NaCl, 4 mM MgCl2 , 1 mM CaCl2 , 0.125% NP-40, 0.25% Na-Deoxycholate) with 1× protease inhibitor and 10 U of MNase (10107921001, Roche) for every 5 million cells. .. Cells were incubated for 30 min at 37 °C, boiled in 1× SDS-loading buffer for 5 min, spun down at 16,000×g for 5 min and the supernatant was collected for western blot. (B) For chromatin-bound and soluble fractions cells were resuspended in chromatin extraction buffer (10 mM Hepes pH 7.6, 3 mM MgCl2 , 0.5% Triton-X-100, 1 mM DTT) with 1× protease inhibitor.

Transfection:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For HEK 293T coimmunoprecipitation assays, cells were transiently transfected using expression vectors harboring individual Cdt1 alleles. .. Cells were harvested by trypsinization, pelleted, and resuspended in co-IP buffer (50 mM HEPES, pH 7.2, 33 mM KAc, 1 mM MgCl2 , 0.5% Triton X-100, 10% glycerol) containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), and 1 mM ATP, and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Chromatography:

Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres
Article Snippet: The ‘601’ 1× 200 bp and ‘601’ 12× 200 bp DNA templates , were both purified by anion exchange chromatography. .. Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

Immunoprecipitation:

Article Title: A multiple redundant genetic switch locks in the transcriptional signature of T regulatory cells
Article Snippet: Paragraph title: Immunoprecipitation (IP) and Immunoblotting (IB) ... Nuclear pellets were subsequently treated with nuclear lysis buffer (20 mM HEPES, 300 mM NaCl, 20 mM KCl, EDTA-free complete protease inhibitor cocktail) and MNase (Nuclease S7; Roche).

Protease Inhibitor:

Article Title: A multiple redundant genetic switch locks in the transcriptional signature of T regulatory cells
Article Snippet: 293 cells double-transfected with vectors for Flag-FoxP3 plus any of the following TFs: SATB1, LEF1, GATA1 or Pbx1, lysed on ice with hypotonic solution (10 mm HEPES, 1.5 mM MgCl2, 10 mM KCl, and 0.05% NP-40 like/IgePal Ca-630) supplemented with EDTA-free complete protease inhibitors (Roche). .. Nuclear pellets were subsequently treated with nuclear lysis buffer (20 mM HEPES, 300 mM NaCl, 20 mM KCl, EDTA-free complete protease inhibitor cocktail) and MNase (Nuclease S7; Roche). .. Chromatin digestion was stopped by adding EDTA to 5 mM, and post-nuclear supernatants were incubated with Protein-G Sepharose beads coupled to antibodies for IP (Flag, M2, Sigma; FoxP3, FJK-16s, eBioscience; GATA1, Ab28839, Abcam; LEF1, Ab124271, Abcam; SATB1, 611182, BD; Control IgG) overnight at 4°C with constant rotation.

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: Subsequently, the samples were subjected to mechanical disruption by two repetitive cycles of freeze-thawing in liquid nitrogen, and 5 mM CaCl2 , 30 μL 10% DOC and 1 × complete and EDTA-free protease inhibitor cocktail (Roche, Basel, Switzerland) were added and the mixture was left on ice for 5 min. Lysates were clarified by centrifugation at 16,000 × g for 10 min at 4 °C. .. For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein).

Article Title: Analysis of PARP inhibitor toxicity by multidimensional fluorescence microscopy reveals mechanisms of sensitivity and resistance
Article Snippet: The following primer pairs were used: hPARP1 F:GCATCAGCACCAAAAAGGAGGTGG hPARP1 R:GATTTGTTGATACCTTCCTCCTTGACCTGG hPARP2 F:GTGGAGAAGGATGGTGAGAAAG hPARP2 R: CTCAAGATTCCCACCCAGTTAC hPARP3 F:GCAAGTCAGCTGGATATGTTATTG hPARP3 R:CGTGTTGATATGGTGCTCTCT hPARG F: CGAGCAGGAGAAGTTCCTAAAC hPARG R: AGTTCGCTCACCATTCTCATC hBRCA1 F: TGAAATCAGTTTGGATTCTGC hBRCA1 R: CATGCAAGTTTGAAACAGAAC hBRCA2 F: CCAAAGTTTGTGAAGGGTCG hBRCA2 R: GTAGAACTAAGGGTGGGTGGTG hFANCD2 F: AAAACGGGAGAGAGTCAGAATCA hFANCD2 R: ACGCTCACAAGACAAAAGGCA hEIF2C2 F:GTCCCTTTTGAGACGATCCAG hEIF2C2 R:AGCCAAACCACACTTCTCG .. Cell pellets were collected by scraping in 1× PBS with 1× protease inhibitor (cOmplete, Roche) and split in two equal fractions: (A) For the total proteome cells were resuspended in 1× MNase buffer (0.3 M Sucrose, 50 mM Tris pH 7.5, 30 mM KCl, 7.5 mM NaCl, 4 mM MgCl2 , 1 mM CaCl2 , 0.125% NP-40, 0.25% Na-Deoxycholate) with 1× protease inhibitor and 10 U of MNase (10107921001, Roche) for every 5 million cells. .. Cells were incubated for 30 min at 37 °C, boiled in 1× SDS-loading buffer for 5 min, spun down at 16,000×g for 5 min and the supernatant was collected for western blot. (B) For chromatin-bound and soluble fractions cells were resuspended in chromatin extraction buffer (10 mM Hepes pH 7.6, 3 mM MgCl2 , 0.5% Triton-X-100, 1 mM DTT) with 1× protease inhibitor.

Footprinting:

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: The cell collection step was the same as for polysome profiling except that 1 mM of chloramphenicol was used in the sucrose solution. .. The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA. .. The lysates were then layered onto a 10–55% sucrose gradient and centrifuged.

Cell Culture:

Article Title: Developmental regulation of N-terminal H2B methylation in Drosophila melanogaster
Article Snippet: Paragraph title: Histone extraction from cultured cells ... For the isolation of histones using MNase, nuclei were isolated from SL2 cells using a nuclear extraction buffer (1 × PBS, 0.3% Triton X−100) and digested using 500mU of MNase (Roche) per 107 cells for 10 min at 26°C.

Sedimentation:

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein). .. For the selective purification of monosomes from polysomes (polysome sample), the supernatant was resolved on 10–55% (w/v) sucrose gradients by centrifugation using an SW41 rotor at 35,000 rpm for 2.5 h at 4 °C.

Sonication:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Recombinant:

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Identity of a part of recombinant proteins was confirmed by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and the purity of the proteins was also analyzed by SDS–PAGE ( Supplementary Figure S1 ). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text. .. Phosphorylation status was examined by phospho affinity gel electrophoresis using phos-tag® (Wako Pure Chemical Industries) ( ) in the presence of Mn2+ .

ChIP-sequencing:

Article Title: Alterations in sperm DNA methylation, non-coding RNA and histone retention associate with DDT-induced epigenetic transgenerational inheritance of disease
Article Snippet: Paragraph title: Histone chromatin immunoprecipitation ChIP-Seq- ... 10 Kuntz units of MNase (Roche, cat. no. 10107921001) were added, and the samples incubated for 5 min at 37 °C.

DNA Extraction:

Article Title: Global remodeling of nucleosome positions in C. elegans
Article Snippet: Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature. .. Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature.

Nucleic Acid Electrophoresis:

Article Title: Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Precipitates were resuspended in 40 μl of TE and incubated with 20 μg RNase A for 1 h at 37°C.

Article Title: Diversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary originDiversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary origin
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Precipitates were resuspended in 40 μl of TE and incubated with 20 μg RNase A for 1 hr at 37°C.

Sensitive Assay:

Article Title: Histone variant Htz1 promotes histone H3 acetylation to enhance nucleotide excision repair in Htz1 nucleosomes
Article Snippet: Paragraph title: MNase sensitivity assay ... Two hundred fifty microlitres aliquots were treated with 0, 5, 15, 30 and 50 U of MNase (Nuclease S7, Roche) for 10 min at 37°C.

Isolation:

Article Title: A tumor suppressor function of Smurf2 associated with controlling chromatin landscape and genome stability through RNF20
Article Snippet: In brief, cell nuclei were isolated using hypotonic buffer (10 mM Hepes, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M Sucrose, 10% Glycerol, 1mM DTT) supplemented with EDTA-free protease and phosphatase inhibitors and 0.1% Triton-X. .. The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time.

Article Title: The CHD6 chromatin remodeler is an oxidative DNA damage response factor
Article Snippet: Briefly, nuclei were isolated from confluent cultures of parental and ΔCHD6 A549 cells. .. For MNase (Nuclease S7, from Roche) digestion, 75 µL nuclei was used per time point, with the addition of 1 U/µL MNase and incubation at 25 °C for indicated times.

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: The frozen pellet of a 50 mL culture was re-suspended and thawed in 1 mL ice-cold lysis buffer for polysome isolation (10 mM MgCl2 , 100 mM NH4 Cl, 20 mM Tris-HCl pH 8.0, 20 U/mL of RNase-free DNase I (NEB 2 U/μL), 1 mM chloramphenicol (or 300 μg/mL), 20 μL/mL lysozyme (50 mg/mL in water) and 100 μ/mL SUPERase.In™ RNase Inhibitor (Thermo Fisher Scientific, Bremen, Germany)), vortexed and left on ice for 2 min with periodical agitation. .. For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein).

Article Title: Circadian Cycle-Dependent MeCP2 and Brain Chromatin Changes
Article Snippet: Nuclei from frontal cortices were isolated and diluted in micrococcal nuclease digestion buffer (50 mM NaCl, 10 mM PIPES pH 6.8, 5 mM MgCl2 and 1 mM MgCl2 ). .. Nuclei were pre-warmed at 37°C and MNase (Roche) digested (2 U/mg tissue).

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA. .. The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA.

Article Title: Global remodeling of nucleosome positions in C. elegans
Article Snippet: We call these in vitro reconstituted nucleosomes invitrosomes and will refer to them as such hereafter. .. Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature. .. The digestion was stopped by adding an equal volume of 3% SDS, 100 mM EDTA and 50 mM Tris.

Article Title: Developmental regulation of N-terminal H2B methylation in Drosophila melanogaster
Article Snippet: Dialysates were freeze-dried and reconstituted in 50 mM Tris pH = 6.8 containing 5 mM tris(2-carboxyethyl)phosphine hydrochloride (Pierce) by using 6.2 µl buffer per million cells. .. For the isolation of histones using MNase, nuclei were isolated from SL2 cells using a nuclear extraction buffer (1 × PBS, 0.3% Triton X−100) and digested using 500mU of MNase (Roche) per 107 cells for 10 min at 26°C. .. To isolate chromatin, the MNase reaction was quenched using 0.5 vol of 0.5 M EGTA and nuclear debris was centrifuged for 20 min at 800 g. The released chromatin fibers were harvested and stored at 4°C.

Clarification Assay:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Co-Immunoprecipitation Assay:

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For HEK 293T coimmunoprecipitation assays, cells were transiently transfected using expression vectors harboring individual Cdt1 alleles. .. Cells were harvested by trypsinization, pelleted, and resuspended in co-IP buffer (50 mM HEPES, pH 7.2, 33 mM KAc, 1 mM MgCl2 , 0.5% Triton X-100, 10% glycerol) containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), and 1 mM ATP, and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. Lysates were sonicated for 10 s at low power followed by incubation on ice for 20 min and clarification by centrifugation at 13,000 × g at 4°C.

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: Complexes were washed three times rapidly with 1 ml ice-cold co-IP buffer and then eluted by boiling in SDS sample buffer supplemented with 10% β-ME and 100 mM dithiothreitol (DTT) for subsequent immunoblot analysis. .. For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche).

Purification:

Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres
Article Snippet: The ‘601’ 1× 200 bp and ‘601’ 12× 200 bp DNA templates , were both purified by anion exchange chromatography. .. Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

Article Title: A tumor suppressor function of Smurf2 associated with controlling chromatin landscape and genome stability through RNF20
Article Snippet: The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time. .. The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time.

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein). .. Next, monosomes were recovered by ultracentrifugation over a 1 M sucrose cushion in polysome isolation buffer without RNase-free DNase I and lysozyme, and by the addition of 2 mM DTT using a TLA-120.2 rotor for 4 h at 75,000 rpm and 4 °C.

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Identity of a part of recombinant proteins was confirmed by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and the purity of the proteins was also analyzed by SDS–PAGE ( Supplementary Figure S1 ). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text. .. Phosphorylation status was examined by phospho affinity gel electrophoresis using phos-tag® (Wako Pure Chemical Industries) ( ) in the presence of Mn2+ .

Article Title: Histone variant Htz1 promotes histone H3 acetylation to enhance nucleotide excision repair in Htz1 nucleosomes
Article Snippet: Two hundred fifty microlitres aliquots were treated with 0, 5, 15, 30 and 50 U of MNase (Nuclease S7, Roche) for 10 min at 37°C. .. Two hundred fifty microlitres aliquots were treated with 0, 5, 15, 30 and 50 U of MNase (Nuclease S7, Roche) for 10 min at 37°C.

Polyacrylamide Gel Electrophoresis:

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA. .. The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA.

Staining:

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Precipitated proteins were denatured in a buffer containing [6 M guanidine–HCl, 50 mM Tris–HCl (pH 7.9) and 5 mM DTT], refolded by dialysis against a buffer containing [50 mM Hepes–NaOH (pH 8.0), 12.5 mM MgCl2 , 100 mM KCl, 0.2 mM EDTA, 0.1% NP40 and 1 mM DTT] and dialyzed against buffer H. The protein concentrations were estimated by comparison with proteins in a standard molecular mass marker (Bio-Rad) on SDS–PAGE stained with Coomassie Brilliant Blue (CBB). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text.

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA. .. The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA.

Chromatin Immunoprecipitation:

Article Title: Alterations in sperm DNA methylation, non-coding RNA and histone retention associate with DDT-induced epigenetic transgenerational inheritance of disease
Article Snippet: Paragraph title: Histone chromatin immunoprecipitation ChIP-Seq- ... 10 Kuntz units of MNase (Roche, cat. no. 10107921001) were added, and the samples incubated for 5 min at 37 °C.

SDS Page:

Article Title: A multiple redundant genetic switch locks in the transcriptional signature of T regulatory cells
Article Snippet: Nuclear pellets were subsequently treated with nuclear lysis buffer (20 mM HEPES, 300 mM NaCl, 20 mM KCl, EDTA-free complete protease inhibitor cocktail) and MNase (Nuclease S7; Roche). .. Chromatin digestion was stopped by adding EDTA to 5 mM, and post-nuclear supernatants were incubated with Protein-G Sepharose beads coupled to antibodies for IP (Flag, M2, Sigma; FoxP3, FJK-16s, eBioscience; GATA1, Ab28839, Abcam; LEF1, Ab124271, Abcam; SATB1, 611182, BD; Control IgG) overnight at 4°C with constant rotation.

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Identity of a part of recombinant proteins was confirmed by matrix-assisted laser-desorption time-of-flight mass spectrometry (MALDI-TOF-MS), and the purity of the proteins was also analyzed by SDS–PAGE ( Supplementary Figure S1 ). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text.

Plasmid Preparation:

Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres
Article Snippet: Briefly, human histones H3, H4, H2A, H2B were purified as monomers and mixed to form (H3–H4)2 tetramer and (H2A–H2B) dimer complexes , while human (CENP-A–H4)2 was purified from a bi-cistronic vector as a tetramer . .. Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

RNA Extraction:

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: Paragraph title: Ribosome footprinting and RNA extraction. ... The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA.

Agarose Gel Electrophoresis:

Article Title: The CHD6 chromatin remodeler is an oxidative DNA damage response factor
Article Snippet: For MNase (Nuclease S7, from Roche) digestion, 75 µL nuclei was used per time point, with the addition of 1 U/µL MNase and incubation at 25 °C for indicated times. .. For MNase (Nuclease S7, from Roche) digestion, 75 µL nuclei was used per time point, with the addition of 1 U/µL MNase and incubation at 25 °C for indicated times.

Article Title: Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Precipitates were resuspended in 40 μl of TE and incubated with 20 μg RNase A for 1 h at 37°C.

Article Title: NF-κB inhibition by dimethylaminoparthenolide radiosensitizes non-small-cell lung carcinoma by blocking DNA double-strand break repair
Article Snippet: The pellets were then digested with 25, 12.5, 6.25, 3.12, or 1.56 units of MNase (Roche #107 921), in MNase buffer for 10 min at 37 °C. .. The pellets were then digested with 25, 12.5, 6.25, 3.12, or 1.56 units of MNase (Roche #107 921), in MNase buffer for 10 min at 37 °C.

Article Title: Diversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary originDiversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary origin
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Precipitates were resuspended in 40 μl of TE and incubated with 20 μg RNase A for 1 hr at 37°C.

Ethanol Precipitation:

Article Title: Global remodeling of nucleosome positions in C. elegans
Article Snippet: Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature. .. Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature.

Article Title: NF-κB inhibition by dimethylaminoparthenolide radiosensitizes non-small-cell lung carcinoma by blocking DNA double-strand break repair
Article Snippet: The pellets were then digested with 25, 12.5, 6.25, 3.12, or 1.56 units of MNase (Roche #107 921), in MNase buffer for 10 min at 37 °C. .. The pellets were then digested with 25, 12.5, 6.25, 3.12, or 1.56 units of MNase (Roche #107 921), in MNase buffer for 10 min at 37 °C.

Concentration Assay:

Article Title: CENP-A, -B, and -C Chromatin Complex That Contains the I-Type ?-Satellite Array Constitutes the Prekinetochore in HeLa Cells
Article Snippet: The nuclear pellet (109 nuclei) was dissolved in 5 ml of ice-cold WB (20 mM HEPES [pH 8.0], 20 mM KCl, 0.5 mM EDTA, 0.5 mM dithiothreitol [DTT], 0.05 mM phenylmethylsulfonyl fluoride) containing 0.3 M NaCl. .. The nuclear suspension was digested with MNase (Roche Diagnostics) at 37°C after addition of CaCl2 to a final concentration of 2 mM. .. The reaction was stopped by the addition of EGTA to a final concentration of 5 mM with quick chilling.

Article Title: T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent
Article Snippet: CD4+ T cells were subjected to cross-linking (20 min on ice) with one-tenth volume of 11% formaldehyde solution in 0.1 M NaCl, 1 mM EGTA, and 50 mM Hepes, pH 8.0 (1% vol/vol final concentration). .. For nucleosome mapping, MNase (Roche) was added, and reactions (5 min at 20°C in 200 μl) were terminated by the addition of 200 μl proteinase K buffer (100 mM Tris-Cl, pH 8.5, 5 mM EDTA, 200 mM NaCl, 0.2% SDS, and 100 μg/ml proteinase K).

Article Title: A tumor suppressor function of Smurf2 associated with controlling chromatin landscape and genome stability through RNF20
Article Snippet: After washing in the hypotonic buffer without Triton-X, an aliquot of the nuclei was re-suspended in 1N NaOH and normalized to ~ 1.5 mg ml−1 DNA concentration in the reaction buffer (15 mM Tris-HCl, pH 7.4, 60 mM KCl, 0.25 M sucrose, 1 mM CaCl2, 0.5 mM DTT). .. The digestion was carried out with micrococcal nuclease (MNase; Roche) at 5U MNase per 250 µl of reaction buffer at 25°C for indicated period of time.

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: Bacterial cells were pre-treated for 5 min with chloramphenicol (Sigma Aldrich) at a final concentration of 100 μg/mL prior to collection by centrifugation (6000 × g , 5 min) at 4 °C. .. For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein).

Article Title: Escherichia coli translation strategies differ across carbon, nitrogen and phosphorus limitation conditions
Article Snippet: The cell collection step was the same as for polysome profiling except that 1 mM of chloramphenicol was used in the sucrose solution. .. The footprinting and library preparation steps were adapted from Li et al. After quantification of RNA concentration with NanoDrop, samples with 500 μ g RNA were digested with 750U MNase (10107921001, Roche) for 1 h at 25 °C before being quenched with 6 mM EGTA. .. The lysates were then layered onto a 10–55% sucrose gradient and centrifuged.

Article Title: Histone variant Htz1 promotes histone H3 acetylation to enhance nucleotide excision repair in Htz1 nucleosomes
Article Snippet: In brief, 400 ml of cells in 5 ml of lysis solution (1 M sorbitol, 5 mM β-mercaptoethanol) was treated with Zymolyase-20T (ICN Biochemicals) at a concentration of 25 mg per 1 g of wet cells for 30 min at 30°C. .. Two hundred fifty microlitres aliquots were treated with 0, 5, 15, 30 and 50 U of MNase (Nuclease S7, Roche) for 10 min at 37°C.

Article Title: Evolutionary Diversification of Alanine Transaminases in Yeast: Catabolic Specialization and Biosynthetic Redundancy
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Article Title: Diversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary originDiversification of the kinetic properties of yeast NADP‐glutamate‐dehydrogenase isozymes proceeds independently of their evolutionary origin
Article Snippet: Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C. .. Samples were divided into three 500 μl aliquots that were then digested with 22.5 U of MNase (Nuclease S7 from Roche) at 50 min at 37°C.

Fractionation:

Article Title: Circadian Cycle-Dependent MeCP2 and Brain Chromatin Changes
Article Snippet: Paragraph title: Chromatin fractionation analysis ... Nuclei were pre-warmed at 37°C and MNase (Roche) digested (2 U/mg tissue).

Article Title: Analysis of PARP inhibitor toxicity by multidimensional fluorescence microscopy reveals mechanisms of sensitivity and resistance
Article Snippet: Paragraph title: Chromatin fractionation ... Cell pellets were collected by scraping in 1× PBS with 1× protease inhibitor (cOmplete, Roche) and split in two equal fractions: (A) For the total proteome cells were resuspended in 1× MNase buffer (0.3 M Sucrose, 50 mM Tris pH 7.5, 30 mM KCl, 7.5 mM NaCl, 4 mM MgCl2 , 1 mM CaCl2 , 0.125% NP-40, 0.25% Na-Deoxycholate) with 1× protease inhibitor and 10 U of MNase (10107921001, Roche) for every 5 million cells.

DNA Purification:

Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres
Article Snippet: Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time. .. Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

Lysis:

Article Title: T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent
Article Snippet: Cells were rinsed three times with ice-cold PBS, resuspended in lysis buffer (10 mM Tris, pH 7.4, 10 mM NaCl, 3 mM MgCl2 , 0.5% NP-40, 0.15 mM spermine, and 0.5 mM spermidine), and incubated on ice for 10 min. .. For nucleosome mapping, MNase (Roche) was added, and reactions (5 min at 20°C in 200 μl) were terminated by the addition of 200 μl proteinase K buffer (100 mM Tris-Cl, pH 8.5, 5 mM EDTA, 200 mM NaCl, 0.2% SDS, and 100 μg/ml proteinase K).

Article Title: A multiple redundant genetic switch locks in the transcriptional signature of T regulatory cells
Article Snippet: 293 cells double-transfected with vectors for Flag-FoxP3 plus any of the following TFs: SATB1, LEF1, GATA1 or Pbx1, lysed on ice with hypotonic solution (10 mm HEPES, 1.5 mM MgCl2, 10 mM KCl, and 0.05% NP-40 like/IgePal Ca-630) supplemented with EDTA-free complete protease inhibitors (Roche). .. Nuclear pellets were subsequently treated with nuclear lysis buffer (20 mM HEPES, 300 mM NaCl, 20 mM KCl, EDTA-free complete protease inhibitor cocktail) and MNase (Nuclease S7; Roche). .. Chromatin digestion was stopped by adding EDTA to 5 mM, and post-nuclear supernatants were incubated with Protein-G Sepharose beads coupled to antibodies for IP (Flag, M2, Sigma; FoxP3, FJK-16s, eBioscience; GATA1, Ab28839, Abcam; LEF1, Ab124271, Abcam; SATB1, 611182, BD; Control IgG) overnight at 4°C with constant rotation.

Article Title: Cdt1 variants reveal unanticipated aspects of interactions with cyclin/CDK and MCM important for normal genome replication
Article Snippet: For polyhistidine pull-down assays, U2OS cells harboring each individual allele were plated in complete medium plus 1 µg/ml doxycycline for 16 h, and then lysed in 50 mM HEPES, pH 8.0, 33 mM KAc, 117 mM NaCl, 20 mM imidazole, 0.5% Triton X-100, 10% glycerol containing protease inhibitors (0.1 mM AEBSF, 10 µg/ml pepstatin A, 10 µg/ml leupeptin, 10 µg/ml aprotinin), phosphatase inhibitors (5 µg/ml phosvitin, 1 mM β-glycerol phosphate, 1 mM Na-orthovanadate), 1 mM ATP, and 1 mM MgCl2 , and supplemented with 5 mM CaCl2 and 15 U of S7 micrococcal nuclease (Roche). .. Clarified lysates were incubated with nickel NTA agarose (Qiagen) for 2 h at 4°C with rotation.

Article Title: Ribosome signatures aid bacterial translation initiation site identification
Article Snippet: The frozen pellet of a 50 mL culture was re-suspended and thawed in 1 mL ice-cold lysis buffer for polysome isolation (10 mM MgCl2 , 100 mM NH4 Cl, 20 mM Tris-HCl pH 8.0, 20 U/mL of RNase-free DNase I (NEB 2 U/μL), 1 mM chloramphenicol (or 300 μg/mL), 20 μL/mL lysozyme (50 mg/mL in water) and 100 μ/mL SUPERase.In™ RNase Inhibitor (Thermo Fisher Scientific, Bremen, Germany)), vortexed and left on ice for 2 min with periodical agitation. .. For the monosome sample, the supernatant was subjected to MNase (Roche Diagnostics, Belgium) digestion using 600 U MNase (~1000 U per mg of protein).

Article Title: Histone variant Htz1 promotes histone H3 acetylation to enhance nucleotide excision repair in Htz1 nucleosomes
Article Snippet: In brief, 400 ml of cells in 5 ml of lysis solution (1 M sorbitol, 5 mM β-mercaptoethanol) was treated with Zymolyase-20T (ICN Biochemicals) at a concentration of 25 mg per 1 g of wet cells for 30 min at 30°C. .. Two hundred fifty microlitres aliquots were treated with 0, 5, 15, 30 and 50 U of MNase (Nuclease S7, Roche) for 10 min at 37°C.

Marker:

Article Title: Intrinsically disordered regions of nucleophosmin/B23 regulate its RNA binding activity through their inter- and intra-molecular association
Article Snippet: Precipitated proteins were denatured in a buffer containing [6 M guanidine–HCl, 50 mM Tris–HCl (pH 7.9) and 5 mM DTT], refolded by dialysis against a buffer containing [50 mM Hepes–NaOH (pH 8.0), 12.5 mM MgCl2 , 100 mM KCl, 0.2 mM EDTA, 0.1% NP40 and 1 mM DTT] and dialyzed against buffer H. The protein concentrations were estimated by comparison with proteins in a standard molecular mass marker (Bio-Rad) on SDS–PAGE stained with Coomassie Brilliant Blue (CBB). .. The phosphorylation of recombinant proteins was performed as described in , using mitotic cell extracts as an enzyme source in a buffer containing [20 mM Tris–HCl (pH 7.4), 10 mM MgCl2 , 50 mM NaCl, 3 mM ATP, 1 mM β-D-glycerophosphate, 1 mM NaVO4 and 1 mM NaF] at 37°C for 1 h. After phosphorylation reaction, CaCl2 (final 5 mM) and MNase (Nuclease S7, Roche Applied Science) were added, and proteins were incubated for additional 30 min followed by purification using GST-tag as described earlier in the text.

Gel Extraction:

Article Title: Global remodeling of nucleosome positions in C. elegans
Article Snippet: Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature. .. Invitrosome core DNAs from both Rsa I and Hinc II reconstitutions were isolated by diluting 60 μl of the respective invitrosomes into a total volume of 200 μl containing 5 mM MgCl2, 5 mM CaCl2, 70 mM KCl and 10 mM Hepes at pH 7.9 (final concentrations) and digesting with 20 units of MNase (Roche) resuspended at 1 U/μl for 15 min at room temperature.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • mnase  (Roche)
    95
    Roche mnase
    Terminally unwrapped CENP-A <t>nucleosomes</t> and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and <t>MNase</t> cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.
    Mnase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mnase/product/Roche
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mnase - by Bioz Stars, 2019-12
    95/100 stars
      Buy from Supplier

    Image Search Results


    Terminally unwrapped CENP-A nucleosomes and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and MNase cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.

    Journal: Nature structural & molecular biology

    Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres

    doi: 10.1038/nsmb.2562

    Figure Lengend Snippet: Terminally unwrapped CENP-A nucleosomes and their conventional counterparts with wrapped termini are similarly phased at normal centromeres ( a,b ) The position of each individual CENP-A ( a ) or bulk nucleosome ( b ) along a dimerized α-satellite consensus sequence is indicated by a horizontal line. Each fragment is color-coded based on length, as indicated. ( c,d ) The midpoint positions of CENP-A ( c ) or bulk nucleosome ( d ) fragments along the dimer α-satellite consensus sequence. Solid vertical lines indicate the location of the 17 bp CENP-B box ( B ) in ( a–d ). ( e,f ) Models of the preferred positioning and MNase cleavage sites on CENP-A ( e ) and bulk ( f ) nucleosomes at normal centromeres.

    Article Snippet: Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

    Techniques: Sequencing

    CENP-A nucleosomes are less phased and gain symmetric MNase digestion on the Y chromosome centromere that lacks functional CENP-B boxes ( a–c ) Maps of chromosome X HOR-aligned CENP-A sequences. ( d–f ). Maps of chromosome Y HOR-aligned CENP-A sequences. Data and models are shown in the same manner as for the global analysis of CENP-A nucleosome-associated α-satellite sequences ( Fig. 5 ).

    Journal: Nature structural & molecular biology

    Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres

    doi: 10.1038/nsmb.2562

    Figure Lengend Snippet: CENP-A nucleosomes are less phased and gain symmetric MNase digestion on the Y chromosome centromere that lacks functional CENP-B boxes ( a–c ) Maps of chromosome X HOR-aligned CENP-A sequences. ( d–f ). Maps of chromosome Y HOR-aligned CENP-A sequences. Data and models are shown in the same manner as for the global analysis of CENP-A nucleosome-associated α-satellite sequences ( Fig. 5 ).

    Article Snippet: Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

    Techniques: Functional Assay

    Nuclease digestion of native CENP-A-containing particles resembles that of octameric nucleosomes with loose termini ( a ) DNA length distributions of MNase-digested CENP-A native ChIP and bulk nucleosomes from the same preparation. ( b ) Fluorescence in situ hybridization using DNA from bulk nucleosomes or CENP-A native ChIP as probes. Bulk nucleosome DNA labels the entire chromosome whereas CENP-A probe labels solely centromeric regions, as expected. ( c ) Quantitative real-time PCR analysis comparing enrichment of CENP-A native ChIP DNA relative to bulk nucleosome DNA. CENP-A ChIP sequences are enriched for α-satellite regions (α-satellite1, α-satellite2), but not at pericentric or promoter (aldo) regions, as expected. Error bars represent s.e.m. from three independent replicates. ( d ) Standard digestion (red) or overdigestion (blue, threefold higher concentration of MNase used) of chromatin. ( e ) DNA length distributions of CENP-A native ChIP following standard digestion (red) or overdigestion (blue) of chromatin.

    Journal: Nature structural & molecular biology

    Article Title: The octamer is the major form of CENP-A nucleosomes at human centromeres

    doi: 10.1038/nsmb.2562

    Figure Lengend Snippet: Nuclease digestion of native CENP-A-containing particles resembles that of octameric nucleosomes with loose termini ( a ) DNA length distributions of MNase-digested CENP-A native ChIP and bulk nucleosomes from the same preparation. ( b ) Fluorescence in situ hybridization using DNA from bulk nucleosomes or CENP-A native ChIP as probes. Bulk nucleosome DNA labels the entire chromosome whereas CENP-A probe labels solely centromeric regions, as expected. ( c ) Quantitative real-time PCR analysis comparing enrichment of CENP-A native ChIP DNA relative to bulk nucleosome DNA. CENP-A ChIP sequences are enriched for α-satellite regions (α-satellite1, α-satellite2), but not at pericentric or promoter (aldo) regions, as expected. Error bars represent s.e.m. from three independent replicates. ( d ) Standard digestion (red) or overdigestion (blue, threefold higher concentration of MNase used) of chromatin. ( e ) DNA length distributions of CENP-A native ChIP following standard digestion (red) or overdigestion (blue) of chromatin.

    Article Snippet: Tetrasomes, nucleosomes, or nucleosomal arrays were digested with 2 U/µg MNase (Roche) in the presence of 3 mM CaCl2 for 0.5 to 2 min. Each comparison shown between CENP-A-containing and H3-containing particles was performed in parallel under identical reaction conditions for the same length of time.

    Techniques: Chromatin Immunoprecipitation, Fluorescence, In Situ, Hybridization, Real-time Polymerase Chain Reaction, Concentration Assay

    Bulk chromatin and centromeric chromatin were solubilized by MNase digestion of HeLa nuclei in 0.3 M NaCl. (A) Centromeric proteins CENP-A, -B, and -C were solubilized by MNase digestion. Isolated HeLa nuclei (2 × 108 ) were suspended with 1 ml of WB containing 0.3 M NaCl (sample a in lane 1 and sample c in lanes 4 to 6) or 0.6 M NaCl (sample b in lanes 2 and 3). Sample c was digested with 60 U of MNase per ml for 10 min at 37°C. Soluble and insoluble materials from each sample were separated by centrifugation. ACA beads were added to the supernatant of sample c and incubated overnight at 4°C. Pellets were resuspended in 1 ml of SDS buffer by extensive sonication and 5 μl of each sample was separated by SDS-7.5% (for CENP-B and CENP-C) or 12.5% (for CENP-A) PAGE, and centromeric proteins were detected by immunostaining with ACA serum. Lane 1, supernatant fraction of a; lane 2, supernatant fraction of b; lane 3, pellet fraction of b; lane 4, supernatant fraction of c before addition of ACA beads; lane 5, supernatant fraction of c after addition of ACA beads; lane 6, pellet fraction of c. Lane M, marker centromeric proteins, CENP-A, CENP-B, and CENP-C. (B) Size distribution of DNA fragments from bulk chromatin after MNase digestion. HeLa nuclei were digested with MNase to various extents. The fragmented DNA in the soluble fractions was extracted with phenol and electrophoresed through 1% agarose gel. DNA was detected with ethidium bromide staining. Lane 1, 20 U/ml for 2 min (40 U/ml × min, sample 1); lane 2, 20 U/ml for 4 min (80 U/ml × min, sample 2); lane 3, 40 U/ml for 5 min (200 U/ml × min, sample 3); lane 4, 80 U/ml for 45 min (3,600 U/ml × min, sample 4). Positions of the DNA size markers are indicated at the left. (C) Detection of core histones and CENP-A in each fraction. Soluble (sup.) and insoluble (pellet) fractions were subjected to SDS-12.5% PAGE, and the separated core histones were stained with Coomassie brilliant blue (upper panel). The proteins were transferred to a membrane and immunolabeled with ACA serum (AK) (lower panel). Lane M in the lower panel is a recombinant CENP-A marker protein. Lanes 1 to 4 correspond to samples 1 to 4 of the soluble (sup.) fractions, and lanes 5 to 8 to samples 1 to 4 of the pellet fractions.

    Journal:

    Article Title: CENP-A, -B, and -C Chromatin Complex That Contains the I-Type ?-Satellite Array Constitutes the Prekinetochore in HeLa Cells

    doi: 10.1128/MCB.22.7.2229-2241.2002

    Figure Lengend Snippet: Bulk chromatin and centromeric chromatin were solubilized by MNase digestion of HeLa nuclei in 0.3 M NaCl. (A) Centromeric proteins CENP-A, -B, and -C were solubilized by MNase digestion. Isolated HeLa nuclei (2 × 108 ) were suspended with 1 ml of WB containing 0.3 M NaCl (sample a in lane 1 and sample c in lanes 4 to 6) or 0.6 M NaCl (sample b in lanes 2 and 3). Sample c was digested with 60 U of MNase per ml for 10 min at 37°C. Soluble and insoluble materials from each sample were separated by centrifugation. ACA beads were added to the supernatant of sample c and incubated overnight at 4°C. Pellets were resuspended in 1 ml of SDS buffer by extensive sonication and 5 μl of each sample was separated by SDS-7.5% (for CENP-B and CENP-C) or 12.5% (for CENP-A) PAGE, and centromeric proteins were detected by immunostaining with ACA serum. Lane 1, supernatant fraction of a; lane 2, supernatant fraction of b; lane 3, pellet fraction of b; lane 4, supernatant fraction of c before addition of ACA beads; lane 5, supernatant fraction of c after addition of ACA beads; lane 6, pellet fraction of c. Lane M, marker centromeric proteins, CENP-A, CENP-B, and CENP-C. (B) Size distribution of DNA fragments from bulk chromatin after MNase digestion. HeLa nuclei were digested with MNase to various extents. The fragmented DNA in the soluble fractions was extracted with phenol and electrophoresed through 1% agarose gel. DNA was detected with ethidium bromide staining. Lane 1, 20 U/ml for 2 min (40 U/ml × min, sample 1); lane 2, 20 U/ml for 4 min (80 U/ml × min, sample 2); lane 3, 40 U/ml for 5 min (200 U/ml × min, sample 3); lane 4, 80 U/ml for 45 min (3,600 U/ml × min, sample 4). Positions of the DNA size markers are indicated at the left. (C) Detection of core histones and CENP-A in each fraction. Soluble (sup.) and insoluble (pellet) fractions were subjected to SDS-12.5% PAGE, and the separated core histones were stained with Coomassie brilliant blue (upper panel). The proteins were transferred to a membrane and immunolabeled with ACA serum (AK) (lower panel). Lane M in the lower panel is a recombinant CENP-A marker protein. Lanes 1 to 4 correspond to samples 1 to 4 of the soluble (sup.) fractions, and lanes 5 to 8 to samples 1 to 4 of the pellet fractions.

    Article Snippet: The nuclear suspension was digested with MNase (Roche Diagnostics) at 37°C after addition of CaCl2 to a final concentration of 2 mM.

    Techniques: Isolation, Western Blot, Centrifugation, Incubation, Sonication, Polyacrylamide Gel Electrophoresis, Immunostaining, Marker, Agarose Gel Electrophoresis, Staining, Immunolabeling, Recombinant

    Nucleosomes positioned in IFN-γ promoter chromatin in CD4 T cells. (a and b) Naive CD4 T cells were cross-linked with formaldehyde, and their chromatin was treated with MNase ( 5 , 7 .5, and 10 enzyme units). DNAs were then purified, digested with the indicated RE (or left undigested; 0), and analyzed by Southern blots using a probe indicated in panel c (directly adjacent to the RE site for HincII-cut DNAs [a] or EcoRI digests [b]). (c) Diagram of RE sites and inferred nucleosome positions at the IFN-γ promoter. The fragment used as a probe in Southern blotting and primers used for LM-PCR are shown above the gene; the transcription start site (+1) is indicated by an arrow. (d) LM-PCR mapping of nucleosome boundaries in the IFN-γ promoter. DNA purified from MNase (2.5 and 1 enzyme unit)-cleaved chromatin of naive or Th1 (6-d culture) CD4 T cells was analyzed by LM-PCR using primer x (nucleosome 1) or y (nucleosome 2) and a linker primer and was analyzed by Southern blot probed with an internal oligonucleotide (1 and 2 for nucleosomes 1 and 2). As a control for MNase cleavage preferences in DNA, pure cellular DNA was analyzed using the same preparation of MNase, linker ligation, and PCR (naked DNA). Shown is an autoradiograph representative of five independent experiments.

    Journal: The Journal of Experimental Medicine

    Article Title: T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-? promoter are Stat4 dependent

    doi: 10.1084/jem.20060066

    Figure Lengend Snippet: Nucleosomes positioned in IFN-γ promoter chromatin in CD4 T cells. (a and b) Naive CD4 T cells were cross-linked with formaldehyde, and their chromatin was treated with MNase ( 5 , 7 .5, and 10 enzyme units). DNAs were then purified, digested with the indicated RE (or left undigested; 0), and analyzed by Southern blots using a probe indicated in panel c (directly adjacent to the RE site for HincII-cut DNAs [a] or EcoRI digests [b]). (c) Diagram of RE sites and inferred nucleosome positions at the IFN-γ promoter. The fragment used as a probe in Southern blotting and primers used for LM-PCR are shown above the gene; the transcription start site (+1) is indicated by an arrow. (d) LM-PCR mapping of nucleosome boundaries in the IFN-γ promoter. DNA purified from MNase (2.5 and 1 enzyme unit)-cleaved chromatin of naive or Th1 (6-d culture) CD4 T cells was analyzed by LM-PCR using primer x (nucleosome 1) or y (nucleosome 2) and a linker primer and was analyzed by Southern blot probed with an internal oligonucleotide (1 and 2 for nucleosomes 1 and 2). As a control for MNase cleavage preferences in DNA, pure cellular DNA was analyzed using the same preparation of MNase, linker ligation, and PCR (naked DNA). Shown is an autoradiograph representative of five independent experiments.

    Article Snippet: For nucleosome mapping, MNase (Roche) was added, and reactions (5 min at 20°C in 200 μl) were terminated by the addition of 200 μl proteinase K buffer (100 mM Tris-Cl, pH 8.5, 5 mM EDTA, 200 mM NaCl, 0.2% SDS, and 100 μg/ml proteinase K).

    Techniques: Purification, Southern Blot, Polymerase Chain Reaction, Ligation, Autoradiography