mmp 13the full length gp73  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Sino Biological mmp 13the full length gp73
    Mmp 13the Full Length Gp73, supplied by Sino Biological, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmp 13the full length gp73/product/Sino Biological
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmp 13the full length gp73 - by Bioz Stars, 2021-09
    86/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion
    Article Snippet: .. Generation of stable hepG2 cell lines expressing ectopic GP73 and MMP-13The full-length GP73 and non-secreted GP73 cDNA (GP73-Δ(1-55)) was amplified by forward (5′ CCCAAGCTTGGGATGGGCTTGGGAAACGGG 3′) and reverse (5′ TGCTCT AGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, and forward (5′ CCCAAGCTTGGGTTCAACTACTGGATTGC 3′) and reverse (5′ TGCTCTAGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, respectively, using a cDNA template obtained from Sino Biological (Beijing, China). ..

    Amplification:

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion
    Article Snippet: .. Generation of stable hepG2 cell lines expressing ectopic GP73 and MMP-13The full-length GP73 and non-secreted GP73 cDNA (GP73-Δ(1-55)) was amplified by forward (5′ CCCAAGCTTGGGATGGGCTTGGGAAACGGG 3′) and reverse (5′ TGCTCT AGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, and forward (5′ CCCAAGCTTGGGTTCAACTACTGGATTGC 3′) and reverse (5′ TGCTCTAGAGCAGAGTGTATGATTCCGCT 3′) oligonucleotides, respectively, using a cDNA template obtained from Sino Biological (Beijing, China). ..

    Article Title: Golgi protein 73 activation of MMP-13 promotes hepatocellular carcinoma cell invasion
    Article Snippet: .. MMP-13 cDNAs were amplified by forward (5′ CCCAAGCTTGGGATGCATCCAGGGGTCC TGGCTGCCTTCCTCTTCTT 3′) and reverse (5′ TGCTCTAGAGCATTAACACCACAAAATGGAATTTG CTGGCATGACGCG 3′) oligonucleotides, using a cDNA template obtained from Sino Biological. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Sino Biological mmp 13the full length gp73
    Mmp 13the Full Length Gp73, supplied by Sino Biological, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mmp 13the full length gp73/product/Sino Biological
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mmp 13the full length gp73 - by Bioz Stars, 2021-09
    86/100 stars
      Buy from Supplier

    Image Search Results