microamp fast optical 96 well reaction plate  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    MicroAmp Fast Optical 96 Well Reaction Plate
    Description:
    The Applied Biosystems MicroAmp Fast Optical 96 Well Reaction Plate with Barcode is an integral component of the Applied Biosystems Fast PCR System which reduces PCR reaction time from 2 hours to as little as 25 minutes • Maximum thermal conductivity for precise thermal cycling• Reproducible specific and sensitive PCR results in just 25 minutes• Validated with other system components for consistent results• Each reaction plate includes a unique serialized eight character number label barcode that is user readable and machine readable to prevent tracking errorsIncreased thermal contact for faster more uniform heatingThe advanced design of the MicroAmp Fast 96 Well Reaction Plate dramatically increases its thermal contact with the Applied Biosystems Veriti 96 Well Fast Thermal Cycler The plate also has a consistent well to well thickness so all of the samples cycle through the PCR process uniformly These features reduce experimental artifacts and help ensure fast accurate results Amplify in as little as 25 minutesGo fast with the Applied Biosystems Fast System comprising pre mixed Fast PCR master mixes specially designed 0 1 mL microplates and tubes and the Veriti 96 Well Fast Thermal Cycler Now you can amplify fragments under 500 bp from genomic backgrounds in about 25 minutes and in some cases as little as 10 minutes And you can amplify large fragments faster too up to 2 kb in as little as 40 50 minutes Or for sequencing applications the AmpliTaq Gold Fast PCR Master Mix UP reduces your cycling time to 50 minutes and produces amplicons optimal for high quality sequencing results
    Catalog Number:
    4346906
    Price:
    None
    Applications:
    Fast Real-Time PCR|PCR|PCR & Real-Time PCR|PCR Tubes, Plates & Accessories|Real Time PCR (qPCR)|Tubes, Plates & Accessories for Real-Time PCR
    Category:
    Lab Supplies Plastics Glassware
    Buy from Supplier


    Structured Review

    Thermo Fisher microamp fast optical 96 well reaction plate
    The Applied Biosystems MicroAmp Fast Optical 96 Well Reaction Plate with Barcode is an integral component of the Applied Biosystems Fast PCR System which reduces PCR reaction time from 2 hours to as little as 25 minutes • Maximum thermal conductivity for precise thermal cycling• Reproducible specific and sensitive PCR results in just 25 minutes• Validated with other system components for consistent results• Each reaction plate includes a unique serialized eight character number label barcode that is user readable and machine readable to prevent tracking errorsIncreased thermal contact for faster more uniform heatingThe advanced design of the MicroAmp Fast 96 Well Reaction Plate dramatically increases its thermal contact with the Applied Biosystems Veriti 96 Well Fast Thermal Cycler The plate also has a consistent well to well thickness so all of the samples cycle through the PCR process uniformly These features reduce experimental artifacts and help ensure fast accurate results Amplify in as little as 25 minutesGo fast with the Applied Biosystems Fast System comprising pre mixed Fast PCR master mixes specially designed 0 1 mL microplates and tubes and the Veriti 96 Well Fast Thermal Cycler Now you can amplify fragments under 500 bp from genomic backgrounds in about 25 minutes and in some cases as little as 10 minutes And you can amplify large fragments faster too up to 2 kb in as little as 40 50 minutes Or for sequencing applications the AmpliTaq Gold Fast PCR Master Mix UP reduces your cycling time to 50 minutes and produces amplicons optimal for high quality sequencing results
    https://www.bioz.com/result/microamp fast optical 96 well reaction plate/product/Thermo Fisher
    Average 90 stars, based on 376 article reviews
    Price from $9.99 to $1999.99
    microamp fast optical 96 well reaction plate - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Positive Control:

    Article Title: Molecular Detection of Leptospiral DNA in Environmental Water on St. Kitts
    Article Snippet: The assay was performed in a MicroAmp Fast Optical 96-well reaction plate (Applied Biosystems, Foster City, CA, USA). .. Each column, except positive control columns, had a no-template control.

    Quantitative RT-PCR:

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: The following primers were used for semi-quantitative PCR and real time (RT)-PCR: ACKR3 - 5’-ATGGATCTGCATCTCTTCGAC-3’ and 5’-GTAGCGGTCCACGCTCATGC-3’, β-Actin 5’-TCACCCACACTGTGCCCATCTACGA-3’ and 5’-CTAGAAGCATTTGCGGTGGACGATGG-3’. .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem).

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: Paragraph title: Isolation of total RNA, reverse transcription and real-time RT-PCR ... 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N.

    Real-time Polymerase Chain Reaction:

    Article Title: New insights into the mode of action of the lantibiotic salivaricin B
    Article Snippet: The bacterial culture was combined with SYTOX Green (final concentration 5 μM) before ninety microliter of this suspension was transferred to MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Life Technologies, USA). .. Ten microliter of pure salivaricin B (10X MIC) was added to this suspension and fluorescence signal from membrane-compromised bacteria labelled with SYTOX Green stain was detected with excitation and emission at 494 nm and 521 nm respectively using the Real-Time PCR as a fluorescence detection method as mentioned previously .

    Article Title: Placental Mitochondrial DNA Content and Particulate Air Pollution during in Utero Life
    Article Snippet: .. PCR reactions were set up by aliquoting 7.5 µL master mix into each well of a MicroAmp® Fast Optical 96-Well Reaction Plate compatible with the 7900HT Fast Real-Time PCR System (Applied Biosystems), followed by 2.5 µL of each experimental DNA sample, for a final volume of 10 µL per reaction. .. The master mix consisted of Fast SYBR® Green I dye 2× (Applied Biosystems; 5 µL/reaction), forward (0.3 µL/reaction) and reverse (0.3 µL/reaction) primer and RNase free water (1.9 µL/reaction).

    Article Title: In vivo and In vitro methods to identify DNA sequence variants that alter RNA Splicing
    Article Snippet: .. MicroAmp Fast Optical 96-well Reaction Plate with Barcode (Applied Biosystems Ref#4346906) and Optical Adhesive Covers (Applied Biosystems Part No. 4360954) Applied Biosystems 7500 Fast Real Time PCR System (ThermoFisher Scientific Cat No. 4351106) .. 1.5 mL microcentrifuge tubes 0.2 mL PCR strip tubes with caps PCR Thermocycler

    Article Title: Angiostatic, tumor inflammatory and anti-tumor effects of CXCL447–70 and CXCL4L147–70 in an EGF-dependent breast cancer model
    Article Snippet: Quantitative polymerase chain reactions (qPCR) based on the TaqMan principle were conducted to compare gene expression between samples. .. Primers and probes (Table ; Integrated DNA Technologies, Haasrode, Belgium), were diluted to the prescribed working concentrations in RNase-free water and added to the reaction mix in a MicroAmp® fast optical 96-well reaction plate (Applied Biosystems), together with 50 ng sample cDNA per reaction.

    Article Title: Dendritic Cell Migration Toward CCL21 Gradient Requires Functional Cx43
    Article Snippet: .. Reverse transcription was performed using Quantitect Reverse Transcription kits (Qiagen, Hilden, Germany) for qPCR with a UNOII PCR thermocycler (Biometra GmbH, Göttingen, Germany). qPCR were performed using primers and probes from TaqMan® (Thermo Fisher Scientific) on MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific), in a StepOnePlus™ Real-Time PCR System (Applied Biosystems,Foster City, CA). .. Gene expression was normalized to GAPDH expression in order to calculate 2−ΔCT .

    Article Title: UPR Induction Prevents Iron Accumulation and Oligodendrocyte Loss in ex vivo Cultured Hippocampal Slices
    Article Snippet: .. Following DNAse I treatment (18068-015, Thermofisher-Scientific, Dublin, Ireland) and cDNA synthesis using manufacturer protocol (1804014, Superscript II Reverse Transcriptase, Invitrogen, Dublin, Ireland), real-time PCR was accomplished using Applied Biosystems 4346906 MicroAmp® Fast Optical 96-Well Reaction Plate and Fast SYPR green master mix (applied Biosystems, 4385612) and the Step One real-time PCR System (Thermo-Fisher). .. Unless otherwise indicated, oligonucleotide primer sequences (Sigma-Aldrich, Dublin, Ireland) used were designed using Primer3.

    Article Title: Acute Reduction of Microglia Does Not Alter Axonal Injury in a Mouse Model of Repetitive Concussive Traumatic Brain Injury
    Article Snippet: .. Samples were loaded on a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems), and qPCR was carried out on a 7500 Fast Real-Time PCR System (Applied Biosystems). ..

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: .. 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N. .. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N.

    Article Title: Improved Protocols for Illumina Sequencing
    Article Snippet: .. If an alternative kit is used then the user may have to supply the following PCR primers at 10μM: ​ Syb_FP5 (desalted) ATGATACGGCGACCACCGAG Syb_RP7 (desalted) CAAGCAGAAGACGGCATACGAG Template DNAs of unknown concentration (from Basic Protocol 4) 96-well qPCR plates (Life Technologies, cat. no. 4346906) Adhesive plate sealers (Life Technologies, cat. no. 4311971) Life Technologies StepOne Quantitative PCR machine (or equivalent) .. On first use add the PCR primer premix to the SYBR green mastermix to create an amplification mastermix. or 1b.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: .. 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N. ..

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: .. The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements. .. The PCR cycle protocol consists of 10 min at 95°C and 40 two-step cycles of 15 s each at 95°C and of 1 min at 60°C.

    Article Title: A Role for Regulatory T Cells in a Murine Model of Epicutaneous Toluene Diisocyanate Sensitization
    Article Snippet: Paragraph title: Real-Time PCR ... Master mix, primers, and cDNA were added to a MicroAmp Fast Optical 96-well reaction plate and analyzed on an Applied Biosystems 7500 Fast RT PCR system using cycling conditions as specified by the manufacturer. β-actin was used as the endogenous reference control gene as expression was determined to be stable following chemical exposure (data not shown).

    Article Title: Molecular Detection of Leptospiral DNA in Environmental Water on St. Kitts
    Article Snippet: Paragraph title: 2.4. Quantitative Polymerase Chain Reaction (qPCR) ... The assay was performed in a MicroAmp Fast Optical 96-well reaction plate (Applied Biosystems, Foster City, CA, USA).

    Incubation:

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: .. 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N. .. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: .. 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N. ..

    Expressing:

    Article Title: Angiostatic, tumor inflammatory and anti-tumor effects of CXCL447–70 and CXCL4L147–70 in an EGF-dependent breast cancer model
    Article Snippet: Paragraph title: Gene expression studies ... Primers and probes (Table ; Integrated DNA Technologies, Haasrode, Belgium), were diluted to the prescribed working concentrations in RNase-free water and added to the reaction mix in a MicroAmp® fast optical 96-well reaction plate (Applied Biosystems), together with 50 ng sample cDNA per reaction.

    Article Title: Dendritic Cell Migration Toward CCL21 Gradient Requires Functional Cx43
    Article Snippet: Reverse transcription was performed using Quantitect Reverse Transcription kits (Qiagen, Hilden, Germany) for qPCR with a UNOII PCR thermocycler (Biometra GmbH, Göttingen, Germany). qPCR were performed using primers and probes from TaqMan® (Thermo Fisher Scientific) on MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific), in a StepOnePlus™ Real-Time PCR System (Applied Biosystems,Foster City, CA). .. Gene expression was normalized to GAPDH expression in order to calculate 2−ΔCT .

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N. .. The setup of reactions consisted 8 ng of cDNA, 0,5 μl of TaqMan Gene Expression Assays, (Life Technologies), 5 μl of TaqMan Universal PCR master mix No AmpErase UNG (2×) (Life Technologies C.N.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N. .. The setup of reactions consisted 8 ng of cDNA, 0,5 μl of TaqMan Gene Expression Assays, (Life Technologies), 5 μl of TaqMan Universal PCR master mix No AmpErase UNG (2°X) (Life Technologies C.N.

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: Each cDNA sample was analyzed for expression of TRPV1, TNFR1, and TNFR2 by real-time quantitative PCR using the TaqMan 5′ nuclease assays Mm01246301_m1 (TRPV1), Mm01182929_m1 (TNFR1), Mm00441889_m1 (TNFR2), and Mm99999915_g1 [glyceraldehyde-3-phosphate dehydrogenase (GAPDH)]. .. The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements.

    Article Title: A Role for Regulatory T Cells in a Murine Model of Epicutaneous Toluene Diisocyanate Sensitization
    Article Snippet: .. Master mix, primers, and cDNA were added to a MicroAmp Fast Optical 96-well reaction plate and analyzed on an Applied Biosystems 7500 Fast RT PCR system using cycling conditions as specified by the manufacturer. β-actin was used as the endogenous reference control gene as expression was determined to be stable following chemical exposure (data not shown). .. RT-PCR data were collected and represented as relative fold change over vehicle control, calculated by the following formula: 2−ΔΔCt = ΔCtSample – ΔCtControl .

    Ex Vivo:

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Sequencing:

    Article Title: UPR Induction Prevents Iron Accumulation and Oligodendrocyte Loss in ex vivo Cultured Hippocampal Slices
    Article Snippet: Following DNAse I treatment (18068-015, Thermofisher-Scientific, Dublin, Ireland) and cDNA synthesis using manufacturer protocol (1804014, Superscript II Reverse Transcriptase, Invitrogen, Dublin, Ireland), real-time PCR was accomplished using Applied Biosystems 4346906 MicroAmp® Fast Optical 96-Well Reaction Plate and Fast SYPR green master mix (applied Biosystems, 4385612) and the Step One real-time PCR System (Thermo-Fisher). .. Primer sequence details are summarized in the Supplementary Table .

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Dendritic Cell Migration Toward CCL21 Gradient Requires Functional Cx43
    Article Snippet: Paragraph title: RNA extraction, RT-PCR and qPCR ... Reverse transcription was performed using Quantitect Reverse Transcription kits (Qiagen, Hilden, Germany) for qPCR with a UNOII PCR thermocycler (Biometra GmbH, Göttingen, Germany). qPCR were performed using primers and probes from TaqMan® (Thermo Fisher Scientific) on MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific), in a StepOnePlus™ Real-Time PCR System (Applied Biosystems,Foster City, CA).

    Article Title: A Role for Regulatory T Cells in a Murine Model of Epicutaneous Toluene Diisocyanate Sensitization
    Article Snippet: .. Master mix, primers, and cDNA were added to a MicroAmp Fast Optical 96-well reaction plate and analyzed on an Applied Biosystems 7500 Fast RT PCR system using cycling conditions as specified by the manufacturer. β-actin was used as the endogenous reference control gene as expression was determined to be stable following chemical exposure (data not shown). .. RT-PCR data were collected and represented as relative fold change over vehicle control, calculated by the following formula: 2−ΔΔCt = ΔCtSample – ΔCtControl .

    Binding Assay:

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Magnetic Cell Separation:

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    Fluorescence:

    Article Title: New insights into the mode of action of the lantibiotic salivaricin B
    Article Snippet: The bacterial culture was combined with SYTOX Green (final concentration 5 μM) before ninety microliter of this suspension was transferred to MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Life Technologies, USA). .. The fluorescence was monitored for 10 minutes until stable base line was achieved.

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: .. The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements. .. The PCR cycle protocol consists of 10 min at 95°C and 40 two-step cycles of 15 s each at 95°C and of 1 min at 60°C.

    Isolation:

    Article Title: UPR Induction Prevents Iron Accumulation and Oligodendrocyte Loss in ex vivo Cultured Hippocampal Slices
    Article Snippet: Analysis of RNA Transcripts RNA was isolated from control and treated slice cultures using TRIreagent (T9424, Sigma-Aldrich, Dublin, Ireland) as per the manufacturer’s instructions. .. Following DNAse I treatment (18068-015, Thermofisher-Scientific, Dublin, Ireland) and cDNA synthesis using manufacturer protocol (1804014, Superscript II Reverse Transcriptase, Invitrogen, Dublin, Ireland), real-time PCR was accomplished using Applied Biosystems 4346906 MicroAmp® Fast Optical 96-Well Reaction Plate and Fast SYPR green master mix (applied Biosystems, 4385612) and the Step One real-time PCR System (Thermo-Fisher).

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: Semi-quantitative and quantitative PCR Total RNA was isolated with TRIzol Reagent (Ambion) and RNA concentration was determined. .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem).

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: Paragraph title: Isolation of total RNA, reverse transcription and real‐time PCR ... 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: Paragraph title: Isolation of total RNA, reverse transcription and real-time RT-PCR ... 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N.

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: For analysis of mRNA levels, total RNA was isolated from murine lumbar dorsal root ganglion (DRG) neurons of untreated and treated animals immediately after preparation by using TRI reagent (Sigma-Aldrich) according to the manufacturer's instructions. .. The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements.

    Purification:

    Article Title: Acute Reduction of Microglia Does Not Alter Axonal Injury in a Mouse Model of Repetitive Concussive Traumatic Brain Injury
    Article Snippet: The final RNA pellet was resuspended in 100 μL of RNAse-free water and further purified using an RNeasy Kit (Qiagen). .. Samples were loaded on a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems), and qPCR was carried out on a 7500 Fast Real-Time PCR System (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Placental Mitochondrial DNA Content and Particulate Air Pollution during in Utero Life
    Article Snippet: .. PCR reactions were set up by aliquoting 7.5 µL master mix into each well of a MicroAmp® Fast Optical 96-Well Reaction Plate compatible with the 7900HT Fast Real-Time PCR System (Applied Biosystems), followed by 2.5 µL of each experimental DNA sample, for a final volume of 10 µL per reaction. .. The master mix consisted of Fast SYBR® Green I dye 2× (Applied Biosystems; 5 µL/reaction), forward (0.3 µL/reaction) and reverse (0.3 µL/reaction) primer and RNase free water (1.9 µL/reaction).

    Article Title: In vivo and In vitro methods to identify DNA sequence variants that alter RNA Splicing
    Article Snippet: Primers for PCR reaction: N500-RTPCR-F2, N500-RTPCR-R1 Nuclease-free H20 Phusion High-Fidelity PCR Master Mix with GC Buffer DMSO (contained within NEB Biolabs Cat. No. M0532S) SYBR Green I Nucleic Acid Gel Stain 10,000x in DMSO (Sigma Aldrich S9430), diluted 1:1000 .. MicroAmp Fast Optical 96-well Reaction Plate with Barcode (Applied Biosystems Ref#4346906) and Optical Adhesive Covers (Applied Biosystems Part No. 4360954) Applied Biosystems 7500 Fast Real Time PCR System (ThermoFisher Scientific Cat No. 4351106)

    Article Title: Dendritic Cell Migration Toward CCL21 Gradient Requires Functional Cx43
    Article Snippet: .. Reverse transcription was performed using Quantitect Reverse Transcription kits (Qiagen, Hilden, Germany) for qPCR with a UNOII PCR thermocycler (Biometra GmbH, Göttingen, Germany). qPCR were performed using primers and probes from TaqMan® (Thermo Fisher Scientific) on MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific), in a StepOnePlus™ Real-Time PCR System (Applied Biosystems,Foster City, CA). .. Gene expression was normalized to GAPDH expression in order to calculate 2−ΔCT .

    Article Title: Acute Reduction of Microglia Does Not Alter Axonal Injury in a Mouse Model of Repetitive Concussive Traumatic Brain Injury
    Article Snippet: For each qPCR reaction, 1 μL of undiluted cDNA was added to 15 μL of Syber Green PCR Master Mix (Applied Biosystems), 13 uL of ddH2 0, and 1 μL of 10-mM forward and reverse primers ( ). .. Samples were loaded on a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems), and qPCR was carried out on a 7500 Fast Real-Time PCR System (Applied Biosystems).

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: The following primers were used for semi-quantitative PCR and real time (RT)-PCR: ACKR3 - 5’-ATGGATCTGCATCTCTTCGAC-3’ and 5’-GTAGCGGTCCACGCTCATGC-3’, β-Actin 5’-TCACCCACACTGTGCCCATCTACGA-3’ and 5’-CTAGAAGCATTTGCGGTGGACGATGG-3’. .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem).

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N. .. The setup of reactions consisted 8 ng of cDNA, 0,5 μl of TaqMan Gene Expression Assays, (Life Technologies), 5 μl of TaqMan Universal PCR master mix No AmpErase UNG (2×) (Life Technologies C.N.

    Article Title: Improved Protocols for Illumina Sequencing
    Article Snippet: .. If an alternative kit is used then the user may have to supply the following PCR primers at 10μM: ​ Syb_FP5 (desalted) ATGATACGGCGACCACCGAG Syb_RP7 (desalted) CAAGCAGAAGACGGCATACGAG Template DNAs of unknown concentration (from Basic Protocol 4) 96-well qPCR plates (Life Technologies, cat. no. 4346906) Adhesive plate sealers (Life Technologies, cat. no. 4311971) Life Technologies StepOne Quantitative PCR machine (or equivalent) .. On first use add the PCR primer premix to the SYBR green mastermix to create an amplification mastermix. or 1b.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N. .. The setup of reactions consisted 8 ng of cDNA, 0,5 μl of TaqMan Gene Expression Assays, (Life Technologies), 5 μl of TaqMan Universal PCR master mix No AmpErase UNG (2°X) (Life Technologies C.N.

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: Reverse transcription to cDNA was performed using the GeneAmp RNA PCR Kit (Applied Biosystems, Foster City, CA). .. The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements.

    Article Title: A Role for Regulatory T Cells in a Murine Model of Epicutaneous Toluene Diisocyanate Sensitization
    Article Snippet: For analysis of mRNA expression, TaqMan Universal Fast master mix (Applied Biosystems, Calsbad, California), cDNA, and mouse-specific mRNA primers (TaqMan Custom PCR Arrays, Carlsbad, California) were combined and PCR was performed according to manufacturer protocol. .. Master mix, primers, and cDNA were added to a MicroAmp Fast Optical 96-well reaction plate and analyzed on an Applied Biosystems 7500 Fast RT PCR system using cycling conditions as specified by the manufacturer. β-actin was used as the endogenous reference control gene as expression was determined to be stable following chemical exposure (data not shown).

    SYBR Green Assay:

    Article Title: Placental Mitochondrial DNA Content and Particulate Air Pollution during in Utero Life
    Article Snippet: PCR reactions were set up by aliquoting 7.5 µL master mix into each well of a MicroAmp® Fast Optical 96-Well Reaction Plate compatible with the 7900HT Fast Real-Time PCR System (Applied Biosystems), followed by 2.5 µL of each experimental DNA sample, for a final volume of 10 µL per reaction. .. The master mix consisted of Fast SYBR® Green I dye 2× (Applied Biosystems; 5 µL/reaction), forward (0.3 µL/reaction) and reverse (0.3 µL/reaction) primer and RNase free water (1.9 µL/reaction).

    Article Title: In vivo and In vitro methods to identify DNA sequence variants that alter RNA Splicing
    Article Snippet: Primers for PCR reaction: N500-RTPCR-F2, N500-RTPCR-R1 Nuclease-free H20 Phusion High-Fidelity PCR Master Mix with GC Buffer DMSO (contained within NEB Biolabs Cat. No. M0532S) SYBR Green I Nucleic Acid Gel Stain 10,000x in DMSO (Sigma Aldrich S9430), diluted 1:1000 .. MicroAmp Fast Optical 96-well Reaction Plate with Barcode (Applied Biosystems Ref#4346906) and Optical Adhesive Covers (Applied Biosystems Part No. 4360954) Applied Biosystems 7500 Fast Real Time PCR System (ThermoFisher Scientific Cat No. 4351106)

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem). .. Expression of the TATA-box binding protein (TBP1) was used as control: 5’GTTCTGGGAAAATGGTGTGCACAGGAGCCAAG3’ and 5’GCTGGAAAACCCAACTTCTGTACAACTCTAGC3’.

    RNA Extraction:

    Article Title: Dendritic Cell Migration Toward CCL21 Gradient Requires Functional Cx43
    Article Snippet: Paragraph title: RNA extraction, RT-PCR and qPCR ... Reverse transcription was performed using Quantitect Reverse Transcription kits (Qiagen, Hilden, Germany) for qPCR with a UNOII PCR thermocycler (Biometra GmbH, Göttingen, Germany). qPCR were performed using primers and probes from TaqMan® (Thermo Fisher Scientific) on MicroAmp Fast Optical 96-Well Reaction Plate with Barcode (Thermo Fisher Scientific), in a StepOnePlus™ Real-Time PCR System (Applied Biosystems,Foster City, CA).

    Recombinant:

    Article Title: Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia) Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin‐induced cachexia
    Article Snippet: Y00147) and 1 μl Recombinant RNasin Ribonuclease Inhibitor 40 U/μl (Promega C.N. .. 18064–014) was added and incubated at 25°C for 10 min, at 42°C for 50 min and at 70°C for 15 min. Real‐time PCR was performed in triplicate using the Applied Biosystems Real‐time PCR 7500 Fast system, MicroAmp Fast Optical 96‐Well Reaction Plate 0.1 mL (Life Technologies C.N.

    Article Title: Growth hormone secretagogues hexarelin and JMV2894 protect skeletal muscle from mitochondrial damages in a rat model of cisplatin-induced cachexia
    Article Snippet: Y00147) and 1 μl Recombinant RNasin Ribonuclease Inhibitor 40 U/μl (Promega C.N. .. 18064–014) was added and incubated at 25 °C for 10 min, at 42 °C for 50 min and at 70 °C for 15 min. Real-time PCR was performed in triplicate using the Applied Biosystems Real-time PCR 7500 Fast system, MicroAmp Fast Optical 96-Well Reaction Plate 0.1 mL (Life Technologies C. N. 4346906) and MicroAmp Optical Adhesive Film (Life Technologies C.N.

    Tube Formation Assay:

    Article Title: New insights into the mode of action of the lantibiotic salivaricin B
    Article Snippet: Paragraph title: Pore formation assay ... The bacterial culture was combined with SYTOX Green (final concentration 5 μM) before ninety microliter of this suspension was transferred to MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Life Technologies, USA).

    Homogenization:

    Article Title: Acute Reduction of Microglia Does Not Alter Axonal Injury in a Mouse Model of Repetitive Concussive Traumatic Brain Injury
    Article Snippet: Tissue was later lysed in Qiazol (Qiagen, Jena, Germany) and disrupted using a rotor-stator homogenizer, following the manufacturer's protocol for homogenization of fatty tissues. .. Samples were loaded on a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems), and qPCR was carried out on a 7500 Fast Real-Time PCR System (Applied Biosystems).

    Concentration Assay:

    Article Title: New insights into the mode of action of the lantibiotic salivaricin B
    Article Snippet: .. The bacterial culture was combined with SYTOX Green (final concentration 5 μM) before ninety microliter of this suspension was transferred to MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Life Technologies, USA). .. The fluorescence was monitored for 10 minutes until stable base line was achieved.

    Article Title: Placental Mitochondrial DNA Content and Particulate Air Pollution during in Utero Life
    Article Snippet: Extracted genomic DNA was diluted to a final concentration of 5 ng/µL in RNase free water, before the qPCR runs. .. PCR reactions were set up by aliquoting 7.5 µL master mix into each well of a MicroAmp® Fast Optical 96-Well Reaction Plate compatible with the 7900HT Fast Real-Time PCR System (Applied Biosystems), followed by 2.5 µL of each experimental DNA sample, for a final volume of 10 µL per reaction.

    Article Title: ACKR3 expression on diffuse large B cell lymphoma is required for tumor spreading and tissue infiltration
    Article Snippet: Semi-quantitative and quantitative PCR Total RNA was isolated with TRIzol Reagent (Ambion) and RNA concentration was determined. .. Amplification of cDNA obtained from ex vivo VAL cells was performed after CD19+ cells enrichment by magnetic separation with anti-human CD19 microbeads (MACS, Miltenyi Biotec). qPCR was performed using the PerfeCta SYBR Green FastMIX (ROX) (Quanta Bioscience) on MicroAmp Fast Optical 96-well Reaction plate (Applied Biosystem).

    Article Title: Improved Protocols for Illumina Sequencing
    Article Snippet: .. If an alternative kit is used then the user may have to supply the following PCR primers at 10μM: ​ Syb_FP5 (desalted) ATGATACGGCGACCACCGAG Syb_RP7 (desalted) CAAGCAGAAGACGGCATACGAG Template DNAs of unknown concentration (from Basic Protocol 4) 96-well qPCR plates (Life Technologies, cat. no. 4346906) Adhesive plate sealers (Life Technologies, cat. no. 4311971) Life Technologies StepOne Quantitative PCR machine (or equivalent) .. On first use add the PCR primer premix to the SYBR green mastermix to create an amplification mastermix. or 1b.

    Article Title: Endogenous Tumor Necrosis Factor α (TNFα) Requires TNF Receptor Type 2 to Generate Heat Hyperalgesia in a Mouse Cancer Model
    Article Snippet: The reactions were performed in a MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems) using the 7500 Fast Real-Time PCR System (Applied Biosystems) for thermal cycling and real-time fluorescence measurements. .. Threshold cycle ( C T ) values were recorded as a measure of initial template concentration.

    Staining:

    Article Title: New insights into the mode of action of the lantibiotic salivaricin B
    Article Snippet: The bacterial culture was combined with SYTOX Green (final concentration 5 μM) before ninety microliter of this suspension was transferred to MicroAmp Fast Optical 96-Well Reaction Plate (Applied Biosystems, Life Technologies, USA). .. Ten microliter of pure salivaricin B (10X MIC) was added to this suspension and fluorescence signal from membrane-compromised bacteria labelled with SYTOX Green stain was detected with excitation and emission at 494 nm and 521 nm respectively using the Real-Time PCR as a fluorescence detection method as mentioned previously .

    Article Title: In vivo and In vitro methods to identify DNA sequence variants that alter RNA Splicing
    Article Snippet: Primers for PCR reaction: N500-RTPCR-F2, N500-RTPCR-R1 Nuclease-free H20 Phusion High-Fidelity PCR Master Mix with GC Buffer DMSO (contained within NEB Biolabs Cat. No. M0532S) SYBR Green I Nucleic Acid Gel Stain 10,000x in DMSO (Sigma Aldrich S9430), diluted 1:1000 .. MicroAmp Fast Optical 96-well Reaction Plate with Barcode (Applied Biosystems Ref#4346906) and Optical Adhesive Covers (Applied Biosystems Part No. 4360954) Applied Biosystems 7500 Fast Real Time PCR System (ThermoFisher Scientific Cat No. 4351106)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher microamp fast optical 96 well reaction plate
    Microamp Fast Optical 96 Well Reaction Plate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/microamp fast optical 96 well reaction plate/product/Thermo Fisher
    Average 90 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    microamp fast optical 96 well reaction plate - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher microamp optical 96 well reaction plate
    Microamp Optical 96 Well Reaction Plate, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 139 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/microamp optical 96 well reaction plate/product/Thermo Fisher
    Average 90 stars, based on 139 article reviews
    Price from $9.99 to $1999.99
    microamp optical 96 well reaction plate - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Applied Biosystems MicroAmp EnduraPlate plastic consumables offer excellent PCR or qPCR performance in formats developed to meet your experimental needs All of our plastic consumables are validated with Applied Biosystems
      Buy from Supplier

    Image Search Results