mgcl2  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Qiagen mgcl2
    Mgcl2, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1543 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mgcl2/product/Qiagen
    Average 97 stars, based on 1543 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2020-01
    97/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany). .. Amplification of A. phagocytophilum genetic material was performed with the diagnostic kit PCR Anaplasma (Blirt-DNA Gdańsk, Poland) coding a fragment of 16S rDNA gene encoding small ribosomal 16S RNA subunit.

    Clone Assay:

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl. .. Second-round PCR products were subcloned using a PCR cloning kit (Qiagen) per the manufacturer's instructions.

    Amplification:

    Article Title: IGF-II transgenic mice display increased aberrant colon crypt multiplicity and tumor volume after 1,2-dimethylhydrazine treatment
    Article Snippet: Both primer-pairs yielded an amplification product of 499 bp [ ]. .. PCR analyses were carried out in 20-μl reactions containing 2 μl cDNA, 0.5 U Taq polymerase (Qiagen), 50 μM dNTPs, 1× PCR-buffer [Tris-HCl, KCl, (NH4 )2 SO4 , 1.5 mM MgCl2 , pH 8.7 at 20°C], 1× Q-Solution (Qiagen) and 0.1 μM of both sense and antisense primers. β-actin reactions contained additional 1.5 mM MgCl2 (Qiagen).

    Article Title: Global Co-Existence of Two Evolutionary Lineages of Parvovirus B19 1a, Different in Genome-Wide Synonymous Positions
    Article Snippet: The PCR mixture contained 800 µM of each primer, 2 units of long range PCR enzyme, 500 µM of each deoxyribonuleotide triphosphate (dNTP) in 1x Long range buffer containing 2.5 mM MgCl2 (Qiagen). .. DNA was amplified for 40 cycles; the preheating step, 93°C for 6 min, was followed by 40 cycles of 93°C for 15 s, 58°C for 30 s; 68°C for 6.5 min, and a final elongation step at 68°C for 10 min. After the final elongation the samples were cooled to 4°C.

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany). .. The experimental constructed amplification programme included initial denaturation at 94 °C for 3 min, 40 cycles (denaturation at 94 °C for 40s, annealing at 58 °C for 60s, extension at 72 °C for 60s) and final extention at 72 °C for 10 min [ – ].

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen). .. The genes for ACTB, hBD1, hBD2, hBD3, and LL-37 were amplified in a Rotor Gene 6000 real-time thermocycler using the following protocol: 35 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 15 s, and elongation at 72 °C for 20 s. To evaluate the relative expression of the genes, the RT-qPCR data were normalized to the expression of the β-actin control and analyzed using the delta Ct method (Rotor Gene 6000 series software 1.7).

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: Paragraph title: Locus selection and amplification. ... Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water.

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The reaction was optimized to obtain the best amplification kinetics and the cycle condition was performed for 1 cycle, 15 min at 95°, 30 s at 95°C and 50 s at 60°C for 50 cycles.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. The amplification of 16Sr RNA gene fragment was done with a 50μl reaction mixture containing 10x PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen) at final concentration of 1x; 1,25 U HotStarTaq DNA polymerase (Qiagen); 0,2 mM of each dNTPs (dNTP Mix, Qiagen); 1 mM MgCl2 (Qiagen), 0,2 μM of each primer; 5 μl template DNA and PCR-grated water up to 50 μl. ..

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: The amplification of 16Sr RNA gene fragment was done with a 50μl reaction mixture containing 10x PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen) at final concentration of 1x; 1,25 U HotStarTaq DNA polymerase (Qiagen); 0,2 mM of each dNTPs (dNTP Mix, Qiagen); 1 mM MgCl2 (Qiagen), 0,2 μM of each primer; 5 μl template DNA and PCR-grated water up to 50 μl. .. IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added.

    Synthesized:

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: Sequence for protozoan Babesia : F2 (5′ GAC ACA GGG AGG TAG TGA CAA G 3′) and R2 (5′- biotin CTA AGA ATT TCA CCT CTG ACA GT 3′) amplifying a fragment from V4 region of 18S rDNA gene [ ] were synthesized by Sigma-Aldrich (Germany) and performed with Taq PCR Core Kit (Qiagen, Germany). .. In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany).

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: .. Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. We ran the PCR reactions using a Touchdown (TD) approach.

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The primers and the probe sequence were selected from a region of the IS6110: Primers IS6110 D-1 (5′- ACCTGAAAGACGTTATCCACCAT-3′) and IS6110 D-2 (5′-CGGCTAGTGCATTGTCATAGGA-3′) which amplify a 100 bp fragment; the probe: (5′- [6 FAM] TCCGACCGCGCTCCGACCGACG-[TAMRA-Q]-3′), was synthesized and conjugated with the reporter dye FAM and TAMRA quencer dye, which were covalently linked to 5′ and 3′ ends oligonucleotide respectively.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added. .. The primers and the probe sequence were selected from a region of the IS6110 : Primers IS 6110 D-1 (5′- ACCTGAAAGACGTTATCCACCAT-3′) and IS6110 D-2 (5′-CGGCTAGTGCATTGTCATAGGA-3′) which amplify a 100 bp fragment; the probe: (5′- [6 FAM] TCCGACCGCGCTCCGACCGACG-[TAMRA-Q]3′), was synthesized and conjugated with the reporter dye FAM and TAMRA quencer dye, which were covalently linked to 5′ and 3′ ends oligonucleotide respectively.

    Construct:

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany). .. The experimental constructed amplification programme included initial denaturation at 94 °C for 3 min, 40 cycles (denaturation at 94 °C for 40s, annealing at 58 °C for 60s, extension at 72 °C for 60s) and final extention at 72 °C for 10 min [ – ].

    SYBR Green Assay:

    Article Title: Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes
    Article Snippet: Allele-specific gene expression RT–PCR performed as previously described with 2 µL cDNA, and the addition of 1.5 mM MgCl2 (QIAGEN) for WT cDNA or 2.5 mM MgCl2 for Mut cDNA. .. PCR conditions were 95°C for 15 min then 37 cycles (95°C, 1 min; 59°C, 30 s; 72°C, 1 min) with the final extension at 72°C for 5 min. SYBR® Green Real-time PCR performed with 2× JumpStart™ Taq ReadyMix™ (10 µL; Sigma-Aldrich), reference dye 0.02 µL, 2.5 mM MgCl2 , and same primers as above (2 µL).

    Incubation:

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: 17.8 μl of the hybridized second-round products were then incubated with 2.2 μl of 150 mmol/l MgCl2, 1 μl of Surveyor nuclease (Transgenomic, Omaha, NE), and 1 μl of Surveyor Enhancer S at 42° for 1 hour prior to loading on a 10% PAGE-TBE gel. .. The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl.

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. The temperature profile consisted of an initial enzyme activation at 95°C for 15 min, followed firstly by 13 cycles of 95°C for 30 sec, 64°C for 30 sec and 72°C for 60 sec, secondly by 29 cycles of 95°C for 30 sec, 57°C for 30 sec and 72°C for 60 sec, and finally by an incubation at 72°C for 7 min. PCR products were purified in a 96-well Millipore purification plate and resuspended in 30 µl of H2 O.

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: .. The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen). ..

    Infection:

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: Isolation of RNA and RT-qPCR (Reverse Transcription Real-Time PCR) for the Preparation of Beta-Defensin and Cathelicidin LL-37 Gene Fragments Monolayers of confluent limbo-corneal fibroblasts cultured on 6-well plates were infected with the 3 mycobacterial species for 3 h at an MOI of 10 with post-infection incubation periods of 6 h, 24 h, and 48 h. After each post-infection period, 500 μL TRIzol (Invitrogen) was added to each well to extract the total RNA. .. The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen).

    Expressing:

    Article Title: Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes
    Article Snippet: .. Allele-specific gene expression RT–PCR performed as previously described with 2 µL cDNA, and the addition of 1.5 mM MgCl2 (QIAGEN) for WT cDNA or 2.5 mM MgCl2 for Mut cDNA. ..

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen). .. The genes for ACTB, hBD1, hBD2, hBD3, and LL-37 were amplified in a Rotor Gene 6000 real-time thermocycler using the following protocol: 35 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 15 s, and elongation at 72 °C for 20 s. To evaluate the relative expression of the genes, the RT-qPCR data were normalized to the expression of the β-actin control and analyzed using the delta Ct method (Rotor Gene 6000 series software 1.7).

    Article Title: Drug evaluation in cardiomyocytes derived from human induced pluripotent stem cells carrying a long QT syndrome type 2 mutation
    Article Snippet: Paragraph title: Analysis of KCNH2 1681 allele-specific expression ... Reverse transcription–PCR was performed as above, with 2 µL of cDNA, and addition of 2.5 mM MgCl2 (1 μL; QIAGEN) for detection of the mutant allele.

    Flow Cytometry:

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: The DNA extraction, PCR and post-PCR analyses were conducted in separate laminar flow biosafety cabinet and rooms. .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added.

    Concentration Assay:

    Article Title: Global Co-Existence of Two Evolutionary Lineages of Parvovirus B19 1a, Different in Genome-Wide Synonymous Positions
    Article Snippet: The PCR mixture contained 800 µM of each primer, 2 units of long range PCR enzyme, 500 µM of each deoxyribonuleotide triphosphate (dNTP) in 1x Long range buffer containing 2.5 mM MgCl2 (Qiagen). .. After amplification the PCR products were gel electrophoresed and the concentration was estimated (usually > 100 ng/µl).

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The reaction mixture was performed in a final volume of 30 µl.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. The amplification of 16Sr RNA gene fragment was done with a 50μl reaction mixture containing 10x PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen) at final concentration of 1x; 1,25 U HotStarTaq DNA polymerase (Qiagen); 0,2 mM of each dNTPs (dNTP Mix, Qiagen); 1 mM MgCl2 (Qiagen), 0,2 μM of each primer; 5 μl template DNA and PCR-grated water up to 50 μl. ..

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added. ..

    Cell Culture:

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: Isolation of RNA and RT-qPCR (Reverse Transcription Real-Time PCR) for the Preparation of Beta-Defensin and Cathelicidin LL-37 Gene Fragments Monolayers of confluent limbo-corneal fibroblasts cultured on 6-well plates were infected with the 3 mycobacterial species for 3 h at an MOI of 10 with post-infection incubation periods of 6 h, 24 h, and 48 h. After each post-infection period, 500 μL TRIzol (Invitrogen) was added to each well to extract the total RNA. .. The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen).

    Polymerase Chain Reaction:

    Article Title: IGF-II transgenic mice display increased aberrant colon crypt multiplicity and tumor volume after 1,2-dimethylhydrazine treatment
    Article Snippet: .. PCR analyses were carried out in 20-μl reactions containing 2 μl cDNA, 0.5 U Taq polymerase (Qiagen), 50 μM dNTPs, 1× PCR-buffer [Tris-HCl, KCl, (NH4 )2 SO4 , 1.5 mM MgCl2 , pH 8.7 at 20°C], 1× Q-Solution (Qiagen) and 0.1 μM of both sense and antisense primers. β-actin reactions contained additional 1.5 mM MgCl2 (Qiagen). ..

    Article Title: Global Co-Existence of Two Evolutionary Lineages of Parvovirus B19 1a, Different in Genome-Wide Synonymous Positions
    Article Snippet: .. The PCR mixture contained 800 µM of each primer, 2 units of long range PCR enzyme, 500 µM of each deoxyribonuleotide triphosphate (dNTP) in 1x Long range buffer containing 2.5 mM MgCl2 (Qiagen). .. DNA was amplified for 40 cycles; the preheating step, 93°C for 6 min, was followed by 40 cycles of 93°C for 15 s, 58°C for 30 s; 68°C for 6.5 min, and a final elongation step at 68°C for 10 min. After the final elongation the samples were cooled to 4°C.

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: .. The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl. .. 2 μl of a 1:200 dilution of the first-round PCR was used in the second round, which was the same as the first round save that extra MgCl2 was not added, the primers were Primer 3 (5′-GACATCCACCTGGAAACCATT-3′) and Primer 4 (5′-CGTCAGTGTCATCCCCTACT-3′), and annealing was done at 54.1° instead of 58.1°.

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: Paragraph title: PCR amplifications ... In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany).

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: .. Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. We ran the PCR reactions using a Touchdown (TD) approach.

    Article Title: Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes
    Article Snippet: Allele-specific gene expression RT–PCR performed as previously described with 2 µL cDNA, and the addition of 1.5 mM MgCl2 (QIAGEN) for WT cDNA or 2.5 mM MgCl2 for Mut cDNA. .. PCR conditions were 95°C for 15 min then 37 cycles (95°C, 1 min; 59°C, 30 s; 72°C, 1 min) with the final extension at 72°C for 5 min. SYBR® Green Real-time PCR performed with 2× JumpStart™ Taq ReadyMix™ (10 µL; Sigma-Aldrich), reference dye 0.02 µL, 2.5 mM MgCl2 , and same primers as above (2 µL).

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: .. Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water. .. All primer sets were designed to ensure they had similar melting temperatures, and reaction conditions were as follows: initial denaturation at 94°C for 1 min; 35 cycles of denaturation at 94°C for 1 min; and primer annealing at 58°C for 1 min and extension at 72°C for 2 min, followed by a final extension step of 72°C for 5 min. Amplicons were purified using the MiniElute UF plates (Qiagen, United Kingdom) according to the manufacturer's instructions and stored at −20°C.

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The reaction mixture was performed in a final volume of 30 µl.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. The amplification of 16Sr RNA gene fragment was done with a 50μl reaction mixture containing 10x PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen) at final concentration of 1x; 1,25 U HotStarTaq DNA polymerase (Qiagen); 0,2 mM of each dNTPs (dNTP Mix, Qiagen); 1 mM MgCl2 (Qiagen), 0,2 μM of each primer; 5 μl template DNA and PCR-grated water up to 50 μl. ..

    Article Title: Novel missense mutation in the bZIP transcription factor, MAF, associated with congenital cataract, developmental delay, seizures and hearing loss (Aymé-Gripp syndrome)
    Article Snippet: PCR reactions of 20 μl final volume consisting of 1X Coraload PCR buffer (Qiagen), 0.1 mM dNTPs (Roche Diagnostics, Basel, Switzerland), 0.5 μM each primer, 0.5U Hot Star Plus Taq Polymerase (Qiagen) and 40 ng of DNA was prepared. .. Final concentrating of Mg2+ was adjusted to 2.5 mM by adding the required amount of Mgcl2 (Qiagen).

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added. ..

    Non-Homologous End Joining:

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: The gel was stained with ethidium bromide and analyzed with densitometry to quantify the prevalence of NHEJ DNA repair at the ROSA26 locus. .. The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: IGF-II transgenic mice display increased aberrant colon crypt multiplicity and tumor volume after 1,2-dimethylhydrazine treatment
    Article Snippet: Paragraph title: RT-PCR ... PCR analyses were carried out in 20-μl reactions containing 2 μl cDNA, 0.5 U Taq polymerase (Qiagen), 50 μM dNTPs, 1× PCR-buffer [Tris-HCl, KCl, (NH4 )2 SO4 , 1.5 mM MgCl2 , pH 8.7 at 20°C], 1× Q-Solution (Qiagen) and 0.1 μM of both sense and antisense primers. β-actin reactions contained additional 1.5 mM MgCl2 (Qiagen).

    Article Title: Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes
    Article Snippet: .. Allele-specific gene expression RT–PCR performed as previously described with 2 µL cDNA, and the addition of 1.5 mM MgCl2 (QIAGEN) for WT cDNA or 2.5 mM MgCl2 for Mut cDNA. ..

    Cellular Antioxidant Activity Assay:

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: Sequence for protozoan Babesia : F2 (5′ GAC ACA GGG AGG TAG TGA CAA G 3′) and R2 (5′- biotin CTA AGA ATT TCA CCT CTG ACA GT 3′) amplifying a fragment from V4 region of 18S rDNA gene [ ] were synthesized by Sigma-Aldrich (Germany) and performed with Taq PCR Core Kit (Qiagen, Germany). .. In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany).

    DNA Extraction:

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: The DNA extraction, PCR and post-PCR analyses were conducted in separate laminar flow biosafety cabinet and rooms. .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added.

    Mutagenesis:

    Article Title: Drug evaluation in cardiomyocytes derived from human induced pluripotent stem cells carrying a long QT syndrome type 2 mutation
    Article Snippet: .. Reverse transcription–PCR was performed as above, with 2 µL of cDNA, and addition of 2.5 mM MgCl2 (1 μL; QIAGEN) for detection of the mutant allele. .. Primers used for the wild-type allele were F: ACTTCAAGGGCTGGTTCCTC and R: ATGCAGGCTAGCCAGTGCTC, and for the mutant allele were F: CTCTGGCTCTGAGGAGCTGA and R: ATGCAGGCTAGCCAGTGCTT.

    Isolation:

    Article Title: IGF-II transgenic mice display increased aberrant colon crypt multiplicity and tumor volume after 1,2-dimethylhydrazine treatment
    Article Snippet: Tissues were homogenized in Tri-Pure™ isolation reagent (Roche Diagnostics, Mannheim, Germany) using an ULTRA-TURRAX System T25 (ART, Mühlheim, Germany), and total RNA was prepared according to the manufacturer's instructions. .. PCR analyses were carried out in 20-μl reactions containing 2 μl cDNA, 0.5 U Taq polymerase (Qiagen), 50 μM dNTPs, 1× PCR-buffer [Tris-HCl, KCl, (NH4 )2 SO4 , 1.5 mM MgCl2 , pH 8.7 at 20°C], 1× Q-Solution (Qiagen) and 0.1 μM of both sense and antisense primers. β-actin reactions contained additional 1.5 mM MgCl2 (Qiagen).

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: Paragraph title: 4.6. Isolation of RNA and RT-qPCR (Reverse Transcription Real-Time PCR) for the Preparation of Beta-Defensin and Cathelicidin LL-37 Gene Fragments ... The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen).

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: Chromosomal DNA was isolated as described by Van Embden et al . .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added.

    Size-exclusion Chromatography:

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. The temperature profile consisted of an initial enzyme activation at 95°C for 15 min, followed firstly by 13 cycles of 95°C for 30 sec, 64°C for 30 sec and 72°C for 60 sec, secondly by 29 cycles of 95°C for 30 sec, 57°C for 30 sec and 72°C for 60 sec, and finally by an incubation at 72°C for 7 min. PCR products were purified in a 96-well Millipore purification plate and resuspended in 30 µl of H2 O.

    Purification:

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. The temperature profile consisted of an initial enzyme activation at 95°C for 15 min, followed firstly by 13 cycles of 95°C for 30 sec, 64°C for 30 sec and 72°C for 60 sec, secondly by 29 cycles of 95°C for 30 sec, 57°C for 30 sec and 72°C for 60 sec, and finally by an incubation at 72°C for 7 min. PCR products were purified in a 96-well Millipore purification plate and resuspended in 30 µl of H2 O.

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water. .. All primer sets were designed to ensure they had similar melting temperatures, and reaction conditions were as follows: initial denaturation at 94°C for 1 min; 35 cycles of denaturation at 94°C for 1 min; and primer annealing at 58°C for 1 min and extension at 72°C for 2 min, followed by a final extension step of 72°C for 5 min. Amplicons were purified using the MiniElute UF plates (Qiagen, United Kingdom) according to the manufacturer's instructions and stored at −20°C.

    Sequencing:

    Article Title: Global Co-Existence of Two Evolutionary Lineages of Parvovirus B19 1a, Different in Genome-Wide Synonymous Positions
    Article Snippet: Paragraph title: Near Whole-genome Sequencing of B19V from 65 Blood Donors ... The PCR mixture contained 800 µM of each primer, 2 units of long range PCR enzyme, 500 µM of each deoxyribonuleotide triphosphate (dNTP) in 1x Long range buffer containing 2.5 mM MgCl2 (Qiagen).

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: Sequence for protozoan Babesia : F2 (5′ GAC ACA GGG AGG TAG TGA CAA G 3′) and R2 (5′- biotin CTA AGA ATT TCA CCT CTG ACA GT 3′) amplifying a fragment from V4 region of 18S rDNA gene [ ] were synthesized by Sigma-Aldrich (Germany) and performed with Taq PCR Core Kit (Qiagen, Germany). .. In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany).

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: Paragraph title: Big dye sequencing ... Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen).

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: The sequencing primers for rpoB were previously described by Khamis and colleagues ( ). .. Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water.

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The primers and the probe sequence were selected from a region of the IS6110: Primers IS6110 D-1 (5′- ACCTGAAAGACGTTATCCACCAT-3′) and IS6110 D-2 (5′-CGGCTAGTGCATTGTCATAGGA-3′) which amplify a 100 bp fragment; the probe: (5′- [6 FAM] TCCGACCGCGCTCCGACCGACG-[TAMRA-Q]-3′), was synthesized and conjugated with the reporter dye FAM and TAMRA quencer dye, which were covalently linked to 5′ and 3′ ends oligonucleotide respectively.

    Article Title: Novel missense mutation in the bZIP transcription factor, MAF, associated with congenital cataract, developmental delay, seizures and hearing loss (Aymé-Gripp syndrome)
    Article Snippet: The detected novel, coding variant in MAF was validated by Sanger sequencing using forward primer 5′-GGGGGTGTGTGTGTGAGC-3′ and reverse primer 5′-CTGGAGCTGGTGGCTGTT-3′. .. Final concentrating of Mg2+ was adjusted to 2.5 mM by adding the required amount of Mgcl2 (Qiagen).

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added. .. The primers and the probe sequence were selected from a region of the IS6110 : Primers IS 6110 D-1 (5′- ACCTGAAAGACGTTATCCACCAT-3′) and IS6110 D-2 (5′-CGGCTAGTGCATTGTCATAGGA-3′) which amplify a 100 bp fragment; the probe: (5′- [6 FAM] TCCGACCGCGCTCCGACCGACG-[TAMRA-Q]3′), was synthesized and conjugated with the reporter dye FAM and TAMRA quencer dye, which were covalently linked to 5′ and 3′ ends oligonucleotide respectively.

    Quantitative RT-PCR:

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: Paragraph title: 4.6. Isolation of RNA and RT-qPCR (Reverse Transcription Real-Time PCR) for the Preparation of Beta-Defensin and Cathelicidin LL-37 Gene Fragments ... The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen).

    Polyacrylamide Gel Electrophoresis:

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: 17.8 μl of the hybridized second-round products were then incubated with 2.2 μl of 150 mmol/l MgCl2, 1 μl of Surveyor nuclease (Transgenomic, Omaha, NE), and 1 μl of Surveyor Enhancer S at 42° for 1 hour prior to loading on a 10% PAGE-TBE gel. .. The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl.

    Software:

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen). .. The genes for ACTB, hBD1, hBD2, hBD3, and LL-37 were amplified in a Rotor Gene 6000 real-time thermocycler using the following protocol: 35 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 15 s, and elongation at 72 °C for 20 s. To evaluate the relative expression of the genes, the RT-qPCR data were normalized to the expression of the β-actin control and analyzed using the delta Ct method (Rotor Gene 6000 series software 1.7).

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water. .. The forward and reverse sequences of a given locus were edited, aligned, and trimmed to the desired length using the SeqManII software program (DNASTAR, Madison, WI).

    Real-time Polymerase Chain Reaction:

    Article Title: Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes
    Article Snippet: Allele-specific gene expression RT–PCR performed as previously described with 2 µL cDNA, and the addition of 1.5 mM MgCl2 (QIAGEN) for WT cDNA or 2.5 mM MgCl2 for Mut cDNA. .. PCR conditions were 95°C for 15 min then 37 cycles (95°C, 1 min; 59°C, 30 s; 72°C, 1 min) with the final extension at 72°C for 5 min. SYBR® Green Real-time PCR performed with 2× JumpStart™ Taq ReadyMix™ (10 µL; Sigma-Aldrich), reference dye 0.02 µL, 2.5 mM MgCl2 , and same primers as above (2 µL).

    Article Title: Defensin Production by Human Limbo-Corneal Fibroblasts Infected with Mycobacteria
    Article Snippet: .. The RT reactions were incubated at 42 °C for 1 h. After the formation of the cDNA, real-time PCR (qPCR) was performed using a master mix containing 1.5 mM MgCl2 (Qiagen). ..

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added. .. The reaction mixture was performed in a final volume of 30 µl.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: The amplification of 16Sr RNA gene fragment was done with a 50μl reaction mixture containing 10x PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen) at final concentration of 1x; 1,25 U HotStarTaq DNA polymerase (Qiagen); 0,2 mM of each dNTPs (dNTP Mix, Qiagen); 1 mM MgCl2 (Qiagen), 0,2 μM of each primer; 5 μl template DNA and PCR-grated water up to 50 μl. .. IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added.

    Article Title: Presence of mycobacterial L-forms in human blood: Challenge of BCG vaccination
    Article Snippet: .. IS6110 Real Time PCR The Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 μM and 0.5 μM respectively, finally 5 μl of template was added. ..

    RNA Extraction:

    Article Title: Drug evaluation in cardiomyocytes derived from human induced pluripotent stem cells carrying a long QT syndrome type 2 mutation
    Article Snippet: Analysis of KCNH2 1681 allele-specific expression RNA extraction from cells performed using the RNeasy Mini kit (QIAGEN). .. Reverse transcription–PCR was performed as above, with 2 µL of cDNA, and addition of 2.5 mM MgCl2 (1 μL; QIAGEN) for detection of the mutant allele.

    Selection:

    Article Title: Multilocus Sequence Typing Identifies Evidence for Recombination and Two Distinct Lineages of Corynebacterium diphtheriae ▿
    Article Snippet: Paragraph title: Locus selection and amplification. ... Each 25-μl PCR was carried out using 10 ng of chromosomal DNA, 5 μl Q solution (Qiagen, United Kingdom), 4.0 μl chromosomal DNA (5 to 20 ng/μl), 1.0 μl forward primer (10 pmol/μl), 1.0 μl reverse primer (10 pmol/μl), 2.5 μl 10× PCR buffer (Qiagen) (containing 15 mM MgCl2 ), 0.5 μl deoxynucleoside triphosphate (dNTP) solution (Qiagen) (10 mM [each] dNTP), 0.125 μl Taq polymerase (Qiagen, 5 U/μl), 0.5 μl MgCl2 (Qiagen) (25 mM), and PCR-grade water.

    Activation Assay:

    Article Title: Commercially Available Outbred Mice for Genome-Wide Association Studies
    Article Snippet: Each 50 µl PCR contained 50 ng of genomic DNA, 1 Unit of HotStar Taq, 5 pmol of forward and reverse primers (synthesized at MWG Biotech, Ebersberg, Germany), 2 mM of each dNTP, 1× HotStar Taq PCR buffer as supplied by the enzyme manufacturer (contains 1.5 mM MgCl2 , Tris-Cl, KCl and (NH4 )2 SO4 , pH 8.7) and 25 mM MgCl2 (Qiagen). .. The temperature profile consisted of an initial enzyme activation at 95°C for 15 min, followed firstly by 13 cycles of 95°C for 30 sec, 64°C for 30 sec and 72°C for 60 sec, secondly by 29 cycles of 95°C for 30 sec, 57°C for 30 sec and 72°C for 60 sec, and finally by an incubation at 72°C for 7 min. PCR products were purified in a 96-well Millipore purification plate and resuspended in 30 µl of H2 O.

    CTG Assay:

    Article Title: Co-infections with Borrelia species, Anaplasma phagocytophilum and Babesia spp. in patients with tick-borne encephalitis
    Article Snippet: Sequence for protozoan Babesia : F2 (5′ GAC ACA GGG AGG TAG TGA CAA G 3′) and R2 (5′- biotin CTA AGA ATT TCA CCT CTG ACA GT 3′) amplifying a fragment from V4 region of 18S rDNA gene [ ] were synthesized by Sigma-Aldrich (Germany) and performed with Taq PCR Core Kit (Qiagen, Germany). .. In reaction for Babesia spp., 5 μl of extracted DNA were added to a reaction mixture (total volume of 50 μl) containing 5 μl of buffer x 10 with 15 mM MgCl2 (Qiagen, Germany), 2 μl of 25 mM MgCl2 , 1 μl 10 mM dNTPs, 1 μl 20 μM of each primer and 0.25 μl (5U/μl) Taq DNA polymerase (Qiagen, Germany).

    Staining:

    Article Title: In Vivo Zinc Finger Nuclease-mediated Targeted Integration of a Glucose-6-phosphatase Transgene Promotes Survival in Mice With Glycogen Storage Disease Type IA
    Article Snippet: The gel was stained with ethidium bromide and analyzed with densitometry to quantify the prevalence of NHEJ DNA repair at the ROSA26 locus. .. The first round of PCR was set up as follows: 500 ng genomic DNA; 2.5 μl of 10× standard Taq buffer with 15 mmol/l MgCl2 (Qiagen, Venlo, Limburg); 1 μl of 25 mmol/l MgCl2; 3 μl of 2.5 mmol/l dNTP mix; Q-Solution (Qiagen), 1.25 μl of 10 μmol/l Primer 1 (5′-GTAATCAATACCATGTGGCTC-3′); 1.25 μl of 10 μmol/l Primer 2 (5′-TCGAGCTGGTCTTCTACGTC-3′); 0.25 μl Taq (Qiagen); and water to 25 μl.

    Variant Assay:

    Article Title: Novel missense mutation in the bZIP transcription factor, MAF, associated with congenital cataract, developmental delay, seizures and hearing loss (Aymé-Gripp syndrome)
    Article Snippet: The detected novel, coding variant in MAF was validated by Sanger sequencing using forward primer 5′-GGGGGTGTGTGTGTGAGC-3′ and reverse primer 5′-CTGGAGCTGGTGGCTGTT-3′. .. Final concentrating of Mg2+ was adjusted to 2.5 mM by adding the required amount of Mgcl2 (Qiagen).

    Hood:

    Article Title: Mycobacterial L-forms are found in cord blood: A potential vertical transmission of BCG from vaccinated mothers
    Article Snippet: The DNA extraction, PCR and post-PCR analyses were conducted in separate laminar flow biosafety cabinet and rooms. .. Real Time PCR mixtures containing a final concentration of 1X PCR buffer (Tris.Cl; KCl; (NH4)2SO4; 15 mM MgCl2, pH 8,7, Qiagen), 2.5 mM MgCl2, 0,2 mM of each dNTPs (dNTP Mix, Qiagen), 1,75 U HotStarTaq DNA polymerase (Qiagen), the target specific primers and probes, were used at a final concentration of 0.5 µM, finally 5 µl of DNA template was added.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen hotstartaq plus master mix kit
    Hotstartaq Plus Master Mix Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 270 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstartaq plus master mix kit/product/Qiagen
    Average 90 stars, based on 270 article reviews
    Price from $9.99 to $1999.99
    hotstartaq plus master mix kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Qiagen toptaq master mix kit
    Toptaq Master Mix Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/toptaq master mix kit/product/Qiagen
    Average 90 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    toptaq master mix kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Qiagen type it microsatellite pcr kit
    Type It Microsatellite Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/type it microsatellite pcr kit/product/Qiagen
    Average 90 stars, based on 105 article reviews
    Price from $9.99 to $1999.99
    type it microsatellite pcr kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results