mgcl2  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq PCR Core Kit
    Description:
    Qiagen Taq PCR Core Kit, 250U, 5U/L, 5' -> 3' Exonuclease Enzyme Activity, 10 min. at 97C; 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, dNTP, ddNTP, dUTP, biotin-11-dUTP, DIG-11-dUTP, fluorescent-dNTP/ddNTP Substrate Analogs, ≥105 fold Amplification Efficiency, Genomic DNA and cDNA Sample, Ideal for Standard and Specialized PCR Applications, Includes Taq DNA Polymerase, 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2, dNTP Mix
    Catalog Number:
    201223
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen mgcl2
    Qiagen Taq PCR Core Kit, 250U, 5U/L, 5' -> 3' Exonuclease Enzyme Activity, 10 min. at 97C; 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, dNTP, ddNTP, dUTP, biotin-11-dUTP, DIG-11-dUTP, fluorescent-dNTP/ddNTP Substrate Analogs, ≥105 fold Amplification Efficiency, Genomic DNA and cDNA Sample, Ideal for Standard and Specialized PCR Applications, Includes Taq DNA Polymerase, 10x PCR Buffer, 10x CoralLoad PCR Buffer, 5x Q-Solution, 25mM MgCl2, dNTP Mix
    https://www.bioz.com/result/mgcl2/product/Qiagen
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    atpase
    nadh-coupled
    kapa taq polymerase
    dntp
    kapa taq buffer

    Images

    Related Articles

    Clone Assay:

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Paragraph title: RT-PCR and cloning of alt-mRNA ... Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    Amplification:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: Paragraph title: PCR amplification ... PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. The PCR primers for XBP1 and GAPDH were used as in previously described [ ].

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR products were purified by MinElute Reaction Cleanup kit (QIAGEN) followed by phenol-chloroform-isoamylalcohol extraction. sgRNAs were synthesized in vitro from purified PCR products by using SP6 RNA-polymerase (NEB).

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: The amplification data analysis was done according to the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: PCR was done using a master mix containing 69 μl of sterile water, 10 μl of 10× amplification buffer, 10 μl of 2 mM deoxynucleoside triphosphates, 3 μl of 3.75 mM MgCl2 , 1 μl of a 10 pM stock of each primer, and 0.5 μl (2.5 U) of Taq polymerase. .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Template DNA (1 μl) was added to a 0.5-ml thin-walled PCR tube, followed by the addition of 99 μl of PCR master mix.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: Paragraph title: (ii) Standard PCR amplification. ... A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl.

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The region containing the deletion was first amplified from genomic DNA by long-range PCR using the Expand LT and Expand 20KbPLUS PCR Systems (Roche, Indianapolis, IN, USA) and the following primers: MSH2 IVS7-5K-F Tm 68 (5′-ACTTCTTACTCCTTACTTCCTACTT-3′), MSH2 IVS8-10K-R Tm 68 (5′-AACAGGAGAGACCGCTAATAGATA-3′), TAAA-Rpt (5′-TGAGTATTGCTCTCTTGCTATCTTG-3′), and H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The following thermocycling conditions were used: denaturation 95°C for 2 min, and 35 cycles of 95°C for 10 s, 60°C for 30 s and 68°C for 20–30 min, depending on the expected size of the wild-type product.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively. .. The RT-PCR reaction was separated on a 2% agrose gel and the alt-mRNA band specific for miniμ-ter73 was gel purified and cloned into the TOPO vector pCRII (Invitrogen) for subsequent sequencing.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the first series of experiments, 250-bp-long promoter constructs containing the three haplotypes of the SNPs at positions − 835 (rs211302) and − 809 (rs211301) were PCR amplified and cloned into pGL3basic (Promega, Madison, WI). .. In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Positive Control:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Klebsiella pneumoniae , obtained from the Virginia Tech Animal Laboratory Services bacteriology laboratory was used as a positive control sample. .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Synthesized:

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: For RT-PCR, total RNA was treated with RNase-free rDNase at 37°C for 30 min using the DNA-free kit (Ambion) to eliminate trace amounts of genomic DNA in the RNA samples. cDNA was synthesized using the First-Strand cDNA synthesis kit (GE Healthcare) with oligo(dT18 ) primers following the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Quantitative RT-PCR:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    SYBR Green Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Real-time PCR was run using a SYBR green RT-PCR kit (No. 204243; Qiagen) with 25-μL reactions prepared with a final primer concentration of 0.5 μM. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Modification:

    Article Title: P2 nucleotide receptors on C2C12 satellite cells
    Article Snippet: Dulbecco’s modified essential medium (DMEM), fetal calf serum (FCS), horse serum (HS) was from Gibco BRL. .. Taq PCR Core Kit was obtained from QIAGEN and M-MLV Reverse Transcriptase from Sigma Chemical Co.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Incubation:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: After a 2-min incubation at 94 °C, 35 cycles of 94 °C 15 s, 60 °C 20 s, and 68 °C 1 min were performed, followed by a final extension at 68 °C for 5 min. PCR for norovirus genogroups I and II, adenovirus, sapovirus, and astrovirus were carried out at St. Jude Children’s Research Hospital. .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Activity Assay:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The CRISPR design web tool available at http://crispr.mit.edu was used to predict potential off-target sites . sgRNAs with highest on-target activity and lowest predicted off-target score were selected for the experiments. .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Expressing:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    Transplantation Assay:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Paragraph title: Selection and preparation of infant samples for HGM Gn pig transplantation ... Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Sequencing:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′.

    Generated:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    DNA Sequencing:

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: Paragraph title: MSH2 genomic DNA sequencing ... The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: cDNA was used as the template for RT-PCR. .. All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. Here, 2.5 units of Taq DNA Polymerase and 800 μM of each dNTP, 20 pmol of each primer and a total concentration of 2.5 mM MgCl2 were used for each reaction.

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: The RT-PCR step was performed using the One Step RT-PCR kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions using 10 µl of RNA and 100 pmol of each primer (Flavi1+/Flavi1−) in a 50-µl total reaction volume. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Paragraph title: Real-Time PCR and RT-PCR ... A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Total RNA was extracted using RNeasy and DNA removal columns from Qiagen. .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. GAPDH was used for normalization and the minimal cycle number required was applied for each gene product.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Paragraph title: Reverse transcription polymerase chain reaction ... Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Paragraph title: RT-PCR. ... Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Paragraph title: RT-PCR and cloning of alt-mRNA ... Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples. .. Norovirus I and II, sapovirus, adenovirus, and astrovirus real-time PCR primers, as well as, probes and conditions, were based on previous publications [ – ].

    Binding Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Multiplex Assay:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Each reaction mixture contained 200 µM dNTPs, 0.4 µM ssaV4 ( 5′ ATCCCCACGACTTCAGCAAG 3′ ) and ssaV7 ( 5′ CTTTCTGGCTCATCATGAGG 3′ ), and 0.1 µM aroC.Z1 ( 5′ GACAACTCTTTCGCGTAACC 3′ ) and aroC.Z3 ( 5′ TTACATCCGCATTCTGTGCC 3′ ), 10 ng genomic DNA and 1.25 u Taq DNA polymerase in a total volume of 50 µl reaction buffer.

    Fluorescence:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Real-time PCR analysis for mouse Runx2 (primers QT00102193 from Qiagen) was performed using the iCycler IQ detection system (Bio-Rad, Hercules, CA, USA) and SYBR Green I (Bio-Rad) as a double-strand DNA–specific binding dye, using β-microglobuline as reference gene (F 5′-TACTCAGCCACCCACCGGCCG-3′ , R 5′-GCTCGGCCATACTGGCATGCT-3′ )).

    Methylation:

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Paragraph title: Methylation analyses ... PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′.

    Mutagenesis:

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. Obtained sequences were visually inspected and manually edited and then assembled with a SeqScape HIV-1 Genotyping System Software v. 2.5 (Applied Biosystems, Foster City, CA).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. Most other haplotypes were generated with these primers using DNA from homozygous individuals containing the desired rare alleles as the template, except for haplotype 7, which used the modified upstream primer 5′-CTGACTCGAGGGTTTCTGAAGACAACA G TTCCC-3′.

    Isolation:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK).

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Paragraph title: RNA isolation and semiquantitative rtPCR. ... Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Total RNA was extracted using RNA STAT-60 total RNA/mRNA isolation reagent (Tel-test, Friendswood, TX) ( ). .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: DNA and RNA were extracted from 175 µl of sample using the MagMax Total Nucleic Acid isolation kit (ThermoFisher Scientific). .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Size-exclusion Chromatography:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK).

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan).

    Mouse Assay:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: For gene expression analysis, the bone marrow MSC from WT and CD36KO mice were seeded in 60-mm culture dishes and incubated for 7 days. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Polymerase Chain Reaction:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: Moreover, FXN-1 and FXN-2 primer specificity were evaluated by enzymatic digestion of PCR products obtained with semi-quantitative PCR. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR conditions were as follows: a denaturing stage at 95°C for 5 min, 40 cycles at 95°C for 50 s, 62.5°C for 50 s, 72°C for 10 min, and a final stage extension at 72°C for 10 min.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: Reverse transcription (RT) reactions were carried out with Omniscript RT kit (Qiagen, Mississauga, Ontario, Canada) using hexamers. .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. GAPDH was used as a reference gene for normalization.

    Article Title: P2 nucleotide receptors on C2C12 satellite cells
    Article Snippet: Expand RT enzyme was purchased from Roche. .. Taq PCR Core Kit was obtained from QIAGEN and M-MLV Reverse Transcriptase from Sigma Chemical Co. .. C2C12 cells, a murine myoblast cell line was from the American Tissue Culture Collection, Rockville, USA, (ATCC) and was a kind gift from Prof Jerzy Moraczewski, Warsaw University, Warsaw, Poland.

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Genomic DNA was isolated from glycerol stocks of S. Typhi isolates using a DNeasy blood and tissue kit (Qiagen, UK). .. Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. Each reaction mixture contained 200 µM dNTPs, 0.4 µM ssaV4 ( 5′ ATCCCCACGACTTCAGCAAG 3′ ) and ssaV7 ( 5′ CTTTCTGGCTCATCATGAGG 3′ ), and 0.1 µM aroC.Z1 ( 5′ GACAACTCTTTCGCGTAACC 3′ ) and aroC.Z3 ( 5′ TTACATCCGCATTCTGTGCC 3′ ), 10 ng genomic DNA and 1.25 u Taq DNA polymerase in a total volume of 50 µl reaction buffer.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: RNA integrity was obtained using the Agilent 2100 Bioanalyzer (Agilent Technologies). cDNA was obtained after reverse-transcription polymerase chain reactions using 500–2000 ng of RNA with random primers and the High Capacity cDNA Transcription Kit (Applied Biosystems) as per the manufacturer’s instructions. .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. The PCR primers for XBP1 and GAPDH were used as in previously described [ ].

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: cDNA was used as the template for RT-PCR. .. All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. Here, 2.5 units of Taq DNA Polymerase and 800 μM of each dNTP, 20 pmol of each primer and a total concentration of 2.5 mM MgCl2 were used for each reaction.

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: Briefly, DNA templates were generated by annealing a scaffold oligonucleotide (sequence: AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCT TATTTTAACTTGCTATTTCTAGCTCTAAAAC) with gene-specific oligonucleotides containing the SP6 promoter sequence (GCGATTTAGGTGACACTATA) followed by a 20 base target sequence without the PAM (see Supplementary Table ) and a sequence complementary to the scaffold oligo (GTTTTAGAGCTAGAAATAG). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR products were purified by MinElute Reaction Cleanup kit (QIAGEN) followed by phenol-chloroform-isoamylalcohol extraction. sgRNAs were synthesized in vitro from purified PCR products by using SP6 RNA-polymerase (NEB).

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: Samples underwent an initial cycle at 50 °C for 30 min and 95 °C for 15 min, followed by 40 PCR cycles at 94 °C for 30 s, 40 °C for 4 min, 72 °C for 1 min, and a final elongation step at 72 °C for 10 min. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: For RT-PCR, total RNA was treated with RNase-free rDNase at 37°C for 30 min using the DNA-free kit (Ambion) to eliminate trace amounts of genomic DNA in the RNA samples. cDNA was synthesized using the First-Strand cDNA synthesis kit (GE Healthcare) with oligo(dT18 ) primers following the manufacturer’s protocol. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction. .. The amplification was conducted in a VERITI thermal cycler with the following thermal cycler conditions: 10 min at 94°C; 45 s at 94°C, 45 s at 56°C, and 1 min at 72°C, with 32 cycles; and 10 min at 72°C.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: PCR was done using a master mix containing 69 μl of sterile water, 10 μl of 10× amplification buffer, 10 μl of 2 mM deoxynucleoside triphosphates, 3 μl of 3.75 mM MgCl2 , 1 μl of a 10 pM stock of each primer, and 0.5 μl (2.5 U) of Taq polymerase. .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Template DNA (1 μl) was added to a 0.5-ml thin-walled PCR tube, followed by the addition of 99 μl of PCR master mix.

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Total RNA was extracted using RNeasy and DNA removal columns from Qiagen. .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. GAPDH was used for normalization and the minimal cycle number required was applied for each gene product.

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and was subjected to genotyping by an in-house nested polymerase chain reaction (PCR) protocol amplifying the HIV-1 pol gene. .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A three-step PCR protocol was used to amplify a 123-bp DNA segment from control viral DNA preparations. .. A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The region containing the deletion was first amplified from genomic DNA by long-range PCR using the Expand LT and Expand 20KbPLUS PCR Systems (Roche, Indianapolis, IN, USA) and the following primers: MSH2 IVS7-5K-F Tm 68 (5′-ACTTCTTACTCCTTACTTCCTACTT-3′), MSH2 IVS8-10K-R Tm 68 (5′-AACAGGAGAGACCGCTAATAGATA-3′), TAAA-Rpt (5′-TGAGTATTGCTCTCTTGCTATCTTG-3′), and H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The following thermocycling conditions were used: denaturation 95°C for 2 min, and 35 cycles of 95°C for 10 s, 60°C for 30 s and 68°C for 20–30 min, depending on the expected size of the wild-type product.

    Article Title: Alternative splicing induced by nonsense mutations in the immunoglobulin ? VDJ exon is independent of truncation of the open reading frame
    Article Snippet: Total RNA from cells expressing either miniμ-ter73 or -ter310 was isolated and reverse transcribed as for real-time RT-PCR, except that 6 ng/μL of oligo 5′-(dT)30VN-3′ were used instead of random hexamers. .. Reverse transcribed material corresponding to 100 ng RNA was amplified with the PCR Core Kit (Qiagen) in 50 μL PCR buffer containing 200 nM dNTPs, 5 U Taq polymerase, and 244 nM forward (5′-ACTGCATTGTCGACCTCACCATGG GATGGAG-3′) and reverse primer (5′-GGGATGGTGAAGGTTA GGATGTC-3′), which are complementary to the leader exon and the constant region exon C3, respectively. .. The RT-PCR reaction was separated on a 2% agrose gel and the alt-mRNA band specific for miniμ-ter73 was gel purified and cloned into the TOPO vector pCRII (Invitrogen) for subsequent sequencing.

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: PCR buffer for the RNA samples was Taqman fast virus 1-step (ThermoFisher Scientific). .. Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Article Title: TP53 Status is Associated with Thrombospondin1 Expression In vitro
    Article Snippet: Genomic DNA (800 ng) was modified with sodium bisulfite as previously described ( ) to convert unmethylated cytosines to uracils. .. PCR amplification prior to pyrosequencing was performed with the HotStar Taq PCR Kit (Qiagen) using 40 ng of bisulfite modified DNA (assuming complete recovery) in a 25 μl reaction volume with 1.5 mM MgCl2 and 100 nM each of forward primer 5′-AGT TTT TTT TAG GGA TGT TTT GTT GAT-3′ and reverse primer 5′-(biotin)-CCA AAC TTA AAA ACA CTA AAA CTT CTC A-3′. .. PCR conditions were 95°C for 15 min, followed by touchdown PCR using 55 total cycles with a 30 s denaturation at 94°C, a 30 s annealing step (5 cycles at 69°C, 5 cycles at 66°C, 5 cycles at 63°C, 5 cycles at 60°C, and 40 cycles at 57°C) and a 30 s extension step at 72°C, followed by a final 10 min extension step at 72°C.

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the first series of experiments, 250-bp-long promoter constructs containing the three haplotypes of the SNPs at positions − 835 (rs211302) and − 809 (rs211301) were PCR amplified and cloned into pGL3basic (Promega, Madison, WI). .. In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. The PCR fragment was cloned into pGL3basic to create KIF5B Haplotype 2 (containing all the common alleles).

    Construct:

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Amplification was performed with SYBR Green JumpStart Taq ReadyMix (Sigma, St. Louis, MO) using a real-time PCR system (Applied Biosystems, Carlsbad, CA).

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: Paragraph title: Cloning of human KIF5B haplotype promoter constructs and expression vectors. ... In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′.

    CRISPR:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The CRISPR design web tool available at http://crispr.mit.edu was used to predict potential off-target sites . sgRNAs with highest on-target activity and lowest predicted off-target score were selected for the experiments. .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Nested PCR:

    Article Title: A four-year survey (2011–2014) of West Nile virus infection in humans, mosquitoes and birds, including the 2012 meningoencephalitis outbreak in Tunisia
    Article Snippet: Samples underwent an initial cycle at 50 °C for 30 min and 95 °C for 15 min, followed by 40 PCR cycles at 94 °C for 30 s, 40 °C for 4 min, 72 °C for 1 min, and a final elongation step at 72 °C for 10 min. .. The nested-PCR reaction was performed using the Taq PCR Core kit (Qiagen, Barcelona, Spain) per the manufacturer’s instructions. .. One microliter of the first amplification product was added to 100 pmol of the second primer set (Flavi2+/Flavi2−) in a final volume of 50 µl.

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and was subjected to genotyping by an in-house nested polymerase chain reaction (PCR) protocol amplifying the HIV-1 pol gene. .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Purification:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC). .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Plasmid Preparation:

    Article Title: KIF5B gene sequence variation and response of cardiac stroke volume to regular exercise
    Article Snippet: In the second phase, a 1794-bp human KIF5B promoter fragment (from nucleotides 1866 to 73 upstream of the ATG) was amplified from human genomic DNA with the Expand High Fidelity polymerase (Roche, Indianapolis, IN) and Q-solution from the Taq-pol kit (Qiagen, Valencia, CA) using the PCR primers 5′-CTGACTCGAGGGTTTCTGAAGACAACACTTCCC-3′ and 5′-GACGAAGCTTTGAGGGCTTGTGGTCGCGAG-3′. .. Most other haplotypes were generated with these primers using DNA from homozygous individuals containing the desired rare alleles as the template, except for haplotype 7, which used the modified upstream primer 5′-CTGACTCGAGGGTTTCTGAAGACAACA G TTCCC-3′.

    Software:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen). .. To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: The Sequence Scan for CRISPR software (available at http://crispr.dfci.harvard.edu/SSC/ ) was used to identify single guide RNA (sgRNA) sequences with high on-target activity . .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. The amplified products, 1.6 kb in length (full-length protease and near complete reverse transcriptase), were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and sequenced bidirectionally on an ABI Prism 310- Genetic Analyzer (Applied Biosystems, Foster City, CA) using Big Dye Terminator chemistry and six sequencing primers.

    Real-time Polymerase Chain Reaction:

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. Amplification products were resolved in 2% agarose gel and were visualized under UV by ethidium bromide staining.

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Paragraph title: Real-Time PCR and RT-PCR ... A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    RNA Extraction:

    Article Title: Aggregation-prone c9FTD/ALS poly(GA) RAN-translated proteins cause neurotoxicity by inducing ER stress
    Article Snippet: Paragraph title: RNA extraction, semi-quantitative PCR and quantitative PCR (qRT-PCR) ... To examine XBP1 splicing in neurons, 2 μl of cDNA was used in a 20 μl reaction according to the manufacturer’s protocol for a Taq PCR Core kit (Qiagen).

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Data were further analyzed with Cell Quest software (BD Biosciences) and WinMDI software v. 2.9 (The Scripps Research Institute). .. Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Article Title: Ten Years Survey of Primary HIV-1 Resistance in Serbia: The Occurrence of Multiclass Resistance
    Article Snippet: Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany). .. Reverse transcription was performed using the One Step RNA PCR Kit (Qiagen, Hilden, Germany), followed by a nested PCR protocol using the Taq PCR Core Kit (Qiagen, Hilden, Germany).

    Selection:

    Article Title: Modeling human enteric dysbiosis and rotavirus immunity in gnotobiotic pigs
    Article Snippet: Paragraph title: Selection and preparation of infant samples for HGM Gn pig transplantation ... Taq core kit (Qiagen, Valencia, CA.) was used for DNA samples.

    Agarose Gel Electrophoresis:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. The PCR program was performed as follows: initial denaturation for 5 min at 95°C; 35 cycles with denaturation for 30 s at 95°C; primer-annealing for 30 s at the correspondent temperature; elongation for 45 s at 72°C; and additional elongation for 7 min at 72°C.

    Article Title: Multiplex PCR Protocol for the Diagnosis of Staphylococcal Infection
    Article Snippet: Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.). .. Amplification buffer (10×), deoxynucleoside triphosphates, MgCl2 , and Taq polymerase were all from the Taq PCR core kit (Qiagen, Inc., Valencia, Calif.).

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    Article Title: Germline truncating mutations in both MSH2 and BRCA2 in a single kindred
    Article Snippet: The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′). .. The deletion region was also amplified using Platinum Taq (Invitrogen), the PCR Core Kit (Qiagen), and the following primers: H2 EX8 ALUYF (5′-AACTTTGCCACCCATTTCAG-3′) and MSH2, IVS8 10318R (5′-TTTGCTTGCTGATGTTCTGG-3′).

    Electrophoresis:

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Cav1.2 splice variant with exon 9* is critical for regulation of cerebral artery diameter
    Article Snippet: Semi-quantitative PCR was performed using primers detecting the region spanning exons 7–11 of Cav 1.2 (Genbank accession No. ; ) of the following sequences: forward 5′-TGCTTTCGCCATGTTGACG-3′ and reverse 5′-GAATTTCGACTTGGAGATCCGG-3′. .. Amplification was performed with Taq PCR core kit (Qiagen) using the following protocol: 94°C for 3 min; 35 cycles of 94°C for 1 min; 55°C for 1 min; 72°C for 1 min; and final extension at 72°C for 10 min. PCR products were separated by electrophoresis using 2% agarose gel. .. Quantitative real-time PCR was performed using primers detecting exons 9*-10 (α1 C9/9*/10 , forward 5′-CTTGCATGCCCAGAAGAAAG-3′ and reverse 5′-TAGCGGCTGAATTTCGACTT-3′), exons 9–10 (α1 C9/9*/10 , forward 5′-CCCGAAACATGAGCATGC-3′ and reverse 5′-GCACTTTCTCCTGCAGAACC-3′) by using a sense primer specific for the boundary of exons 9/10 of Cav 1.2 , and 18S (18S, forward 5′-AGTCGCCGTGCCTACCAT-3′ and reverse 5′-GCCTGCTGCCTTCCTTG-3′).

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. PCR was performed using a PTC-225 DNA Engine Tetrad (MJ Research, Inc., Waltham, Mass.) under the following conditions: 1 cycle at 95°C for 5 min, followed by 40 cycles of programmed amplification (denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s).

    ALP Assay:

    Article Title: Establishment and Characterization of Immortalized Human Amniotic Epithelial Cells
    Article Snippet: Total RNA was extracted from 5×106 of each of fHAE, HAE p1, HAE p2, and iHAE cells using TRIzol RNA extraction buffer (Nippon Gene, Tokyo, Japan). cDNA was synthesized from 1 μg of total RNA using an Omniscript RT Kit (QIAGEN, Tokyo, Japan). cDNA was subjected to the polymerase chain reaction (PCR) using a Taq PCR Core Kit (QIAGEN, Tokyo, Japan). .. DNase I digestion of RNA was performed on purified RNA using a One-Step DNase I kit (QIAGEN, Inc., CA, USA).

    Spectrophotometry:

    Article Title: Multiplexed, Real-Time PCR for Quantitative Detection of Human Adenovirus
    Article Snippet: A PCR mix was prepared by using a Taq PCR Core kit (Qiagen), consisting of 10 μl of 10× PCR buffer, 20 μl of 5× Q solution, 1 μl of 10 mM deoxynucleoside triphosphates, 5 U of Taq polymerase, 8 μl of 4 pM degenerate forward primer, 8 μl of 16 pM degenerate reverse primer, and 1 μl of target viral nucleic acid, in a final total volume of 100 μl. .. Products were purified by using a QIAquick PCR purification kit (Qiagen) and detected by agarose gel (4%) electrophoresis.

    Produced:

    Article Title: A Rapid CRISPR/Cas-based Mutagenesis Assay in Zebrafish for Identification of Genes Involved in Thyroid Morphogenesis and Function
    Article Snippet: DNA templates for sgRNA synthesis were produced using the PCR-based short-oligo method as described . .. PCR amplification was performed with Taq PCR Core Kit (QIAGEN) using 20 nM scaffold oligo, 20 nM gene-specific oligo, and 260 nM of each universal flanking primer (forward: GCGATTTAGGTGACACTATA, reverse: AAAGCACCGACTCGGTGCCAC).

    Concentration Assay:

    Article Title: Disruption of OPR7 and OPR8 Reveals the Versatile Functions of Jasmonic Acid in Maize Development and Defense
    Article Snippet: Real-time PCR was run using a SYBR green RT-PCR kit (No. 204243; Qiagen) with 25-μL reactions prepared with a final primer concentration of 0.5 μM. .. A Taq PCR Core kit (Qiagen) was used to amplify the interest genes using cDNA as template with amount equal to 50 ng of total RNA for one 25-μL reaction.

    CTG Assay:

    Article Title: No non-redundant function of suppressor of cytokine signaling 2 in insulin producing ?-cells
    Article Snippet: Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen). .. Oligo(dT) primed cDNA was prepared from total RNA (ImProm-II Reverse Transcription System; Promega) and semiquantitative rtPCR performed by using the Taq PCR Core Kit (Qiagen).

    Staining:

    Article Title: Frataxin mRNA Isoforms in FRDA Patients and Normal Subjects: Effect of Tocotrienol Supplementation
    Article Snippet: PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions. .. PCR analysis was performed using a Taq PCR core kit (Qiagen S.r.l., Milan, Italy), according to manufacturer's instructions.

    Article Title: Low-Bone-Mass Phenotype of Deficient Mice for the Cluster of Differentiation 36 (CD36)
    Article Snippet: PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ). .. PCR amplifications for semi-quantitative analysis were conducted with Taq PCR core kit (Qiagen) using specific primer sets for OCN (F: 5′-CAAGTCCCACACAGCAGCTT-3′ , R: 5′AAAGCCGAGCTGCCAGAGTT-3′), BSP (F: 5′-ACTCCAACTGCCCAAGAAGG-3′ , R: 5′-CTGTGGTTCCTTCTGCACCT-3′ ), Osx (F: 5′-TTCGCATCTGAAAGCCCACT-3′ , R: 5′-TGCGCTGATGTTTGCTCAAG-3′ ) and collagen type I alpha 1 (Col1α1; (F 5′-ACTTCAGCTTCCTGCCTCAG-3′ , R 5′-GCTTCTTTTCCTTGGGGTTC-3′ ).

    Article Title: A Randomised Trial Evaluating the Safety and Immunogenicity of the Novel Single Oral Dose Typhoid Vaccine M01ZH09 in Healthy Vietnamese Children
    Article Snippet: Multiplex PCRs were performed using a Taq PCR core kit (Qiagen, UK). .. PCRs were performed for 25 cycles as follows: 94°C for 30 sec, 57°C for 30 sec and 72°C for 2.5 min.

    Article Title: Comparison of the reaction of bone-derived cells to enhanced MgCl2-salt concentrations
    Article Snippet: All enzymes, nucleotides, buffers and other chemicals for RT-PCR were purchased from Qiagen (Taq PCR Core Kit, Hilden, Germany). .. The PCR program was performed as follows: initial denaturation for 5 min at 95°C; 35 cycles with denaturation for 30 s at 95°C; primer-annealing for 30 s at the correspondent temperature; elongation for 45 s at 72°C; and additional elongation for 7 min at 72°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    Qiagen mgcl2
    Mgcl2, supplied by Qiagen, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mgcl2/product/Qiagen
    Average 75 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    mgcl2 - by Bioz Stars, 2019-12
    75/100 stars
      Buy from Supplier

    99
    Qiagen atp binding cassette transporter g1
    Expression of <t>ATP‐binding</t> cassette transporter G1 ( ABCG 1) protein in THP ‐1 macrophages treated with bilirubin and in peripheral blood mononuclear cells ( PBMC s) from Gilbert syndrome ( GS ) patients. A, Bilirubin suppresses the expression of ABCG 1 protein in THP ‐1‐derived macrophages. THP ‐1 cells were differentiated for 72 hours with 200 nmol/L phorbol‐12‐myristate‐13‐acetate and then loaded with unlabeled cholesterol for another 24 hours. Cells were treated with bilirubin (17.1 μmol/L) for 4, 8, 16, and 24 hours. The protein levels of ABCG 1 were detected by western blotting. Control was treated with solvent vehicle (0.1% dimethyl sulfoxide). The bar graphs present mean± SD from 3 independent experiments. B, Expression of ABCG 1 protein was not changed significantly in PBMC s from participants with high bilirubin blood levels ( GS ) compared with healthy controls. The protein levels of ABCG 1 were detected by western blotting. The bar graphs present mean± SEM (n=28 per group). * P
    Atp Binding Cassette Transporter G1, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp binding cassette transporter g1/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    atp binding cassette transporter g1 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Expression of ATP‐binding cassette transporter G1 ( ABCG 1) protein in THP ‐1 macrophages treated with bilirubin and in peripheral blood mononuclear cells ( PBMC s) from Gilbert syndrome ( GS ) patients. A, Bilirubin suppresses the expression of ABCG 1 protein in THP ‐1‐derived macrophages. THP ‐1 cells were differentiated for 72 hours with 200 nmol/L phorbol‐12‐myristate‐13‐acetate and then loaded with unlabeled cholesterol for another 24 hours. Cells were treated with bilirubin (17.1 μmol/L) for 4, 8, 16, and 24 hours. The protein levels of ABCG 1 were detected by western blotting. Control was treated with solvent vehicle (0.1% dimethyl sulfoxide). The bar graphs present mean± SD from 3 independent experiments. B, Expression of ABCG 1 protein was not changed significantly in PBMC s from participants with high bilirubin blood levels ( GS ) compared with healthy controls. The protein levels of ABCG 1 were detected by western blotting. The bar graphs present mean± SEM (n=28 per group). * P

    Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

    Article Title: Bilirubin Decreases Macrophage Cholesterol Efflux and ATP‐Binding Cassette Transporter A1 Protein Expression

    doi: 10.1161/JAHA.117.005520

    Figure Lengend Snippet: Expression of ATP‐binding cassette transporter G1 ( ABCG 1) protein in THP ‐1 macrophages treated with bilirubin and in peripheral blood mononuclear cells ( PBMC s) from Gilbert syndrome ( GS ) patients. A, Bilirubin suppresses the expression of ABCG 1 protein in THP ‐1‐derived macrophages. THP ‐1 cells were differentiated for 72 hours with 200 nmol/L phorbol‐12‐myristate‐13‐acetate and then loaded with unlabeled cholesterol for another 24 hours. Cells were treated with bilirubin (17.1 μmol/L) for 4, 8, 16, and 24 hours. The protein levels of ABCG 1 were detected by western blotting. Control was treated with solvent vehicle (0.1% dimethyl sulfoxide). The bar graphs present mean± SD from 3 independent experiments. B, Expression of ABCG 1 protein was not changed significantly in PBMC s from participants with high bilirubin blood levels ( GS ) compared with healthy controls. The protein levels of ABCG 1 were detected by western blotting. The bar graphs present mean± SEM (n=28 per group). * P

    Article Snippet: Primers used for quantitative reverse transcription polymerase chain reaction were specific for ABCA1 (HS_ABCA1_1_SG QuantiTect primer assay, catalog no. QT00064869; Qiagen), ATP‐binding cassette transporter G1 (ABCG1; Hs_ABCG1_1_SG QuantiTect Primer Assay, catalog no. QT00021035; Qiagen), and 18S (Hs_RRN18S_1_SG QuantiTect Primer assay, catalog no. QT00199367; Qiagen).

    Techniques: Expressing, Binding Assay, Derivative Assay, Western Blot