Structured Review

Trion Research mfe i sal i
Mfe I Sal I, supplied by Trion Research, used in various techniques. Bioz Stars score: 85/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mfe i sal i/product/Trion Research
Average 85 stars, based on 16 article reviews
Price from $9.99 to $1999.99
mfe i sal i - by Bioz Stars, 2020-09
85/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: The Rho-GEF Trio regulates a novel pro-inflammatory pathway through the transcription factor Ets2
Article Snippet: .. Adenovirus production GFP-TrioD1 (1233–1685), GFP-TrioD2 (1849–2218), GFP-TrioN (1–1685) were obtained by PCR amplification, with peGFP-TrioD1, peGFP-TrioD2 and peGFP-TrioN as template and primer pairs JR22F (GAGATCGTCGACCTGGTTTAGTGAACCGTCAGA) and JR4R (GAGATCGAATTCCTAGGCGTCATTGCTGGAGAC), JR22F and JR20R (GAGATCGAATTC CTATAAAAAATTGCGCTGGTTTTCT), JR23F (GAGATCCAATTGCTGGTTTAGTGAACCGTCAGA) and JR24R (GAGATCGTCGACCTAGGCGTCATTGCTGGAGAC) respectively. .. The PCR product was cloned as a Sal I/Eco RI (TrioD1/D2) or Mfe I/Sal I (TrioN) fragment into pENTR1A (Invitrogen) with Sal I/Eco RI (TrioD1/D2) or Eco RI/Xho I (TrioN) and recombined into the pAd/CMV/V5-DEST vector (Invitrogen) with Clonase II enzyme mix according to the manufacturer's instructions (Invitrogen).

Produced:

Article Title: The Rho-GEF Trio regulates a novel pro-inflammatory pathway through the transcription factor Ets2
Article Snippet: .. Adenovirus expressing GFP-TrioD1, GFP-TrioD2 or GFP-TrioN was produced by transfecting Pac I (Westburg, Leusden) -digested pAd-GFP-TrioD1, pAd-GFP-TrioD2 or pAd-GFP-TrioN into HEK293T cells. .. shRNA lentivirus production shRNA constructs (Sigma Mission library) targeting Trio (Trio1, TRC_871; Trio2, TRC_872; Trio3, TRC_873; Trio4, TRC_874; Trio5, TRC_10561), Rac1 (TRC_4872), RhoA (TRC_47711), CDC42 (TRC_47630) and RhoG (TRC_48019) or non-targeting shCtrl (shc002) construct were packaged into lentivirus in HEK293T cells by means of third generation lentiviral packaging plasmids ( ).

Amplification:

Article Title: The Rho-GEF Trio regulates a novel pro-inflammatory pathway through the transcription factor Ets2
Article Snippet: .. Adenovirus production GFP-TrioD1 (1233–1685), GFP-TrioD2 (1849–2218), GFP-TrioN (1–1685) were obtained by PCR amplification, with peGFP-TrioD1, peGFP-TrioD2 and peGFP-TrioN as template and primer pairs JR22F (GAGATCGTCGACCTGGTTTAGTGAACCGTCAGA) and JR4R (GAGATCGAATTCCTAGGCGTCATTGCTGGAGAC), JR22F and JR20R (GAGATCGAATTC CTATAAAAAATTGCGCTGGTTTTCT), JR23F (GAGATCCAATTGCTGGTTTAGTGAACCGTCAGA) and JR24R (GAGATCGTCGACCTAGGCGTCATTGCTGGAGAC) respectively. .. The PCR product was cloned as a Sal I/Eco RI (TrioD1/D2) or Mfe I/Sal I (TrioN) fragment into pENTR1A (Invitrogen) with Sal I/Eco RI (TrioD1/D2) or Eco RI/Xho I (TrioN) and recombined into the pAd/CMV/V5-DEST vector (Invitrogen) with Clonase II enzyme mix according to the manufacturer's instructions (Invitrogen).

other:

Article Title: The Rho-GEF Trio regulates a novel pro-inflammatory pathway through the transcription factor Ets2
Article Snippet: With an adenoviral approach GFP, GFP-TrioD1 or GFP-TrioD2 was expressed in control and Trio-silenced HUVEC.

Expressing:

Article Title: The Rho-GEF Trio regulates a novel pro-inflammatory pathway through the transcription factor Ets2
Article Snippet: .. Adenovirus expressing GFP-TrioD1, GFP-TrioD2 or GFP-TrioN was produced by transfecting Pac I (Westburg, Leusden) -digested pAd-GFP-TrioD1, pAd-GFP-TrioD2 or pAd-GFP-TrioN into HEK293T cells. .. shRNA lentivirus production shRNA constructs (Sigma Mission library) targeting Trio (Trio1, TRC_871; Trio2, TRC_872; Trio3, TRC_873; Trio4, TRC_874; Trio5, TRC_10561), Rac1 (TRC_4872), RhoA (TRC_47711), CDC42 (TRC_47630) and RhoG (TRC_48019) or non-targeting shCtrl (shc002) construct were packaged into lentivirus in HEK293T cells by means of third generation lentiviral packaging plasmids ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Trion Research mfe i sal i
    Mfe I Sal I, supplied by Trion Research, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mfe i sal i/product/Trion Research
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mfe i sal i - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results