megascript rnai kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    MEGAscript RNAi Kit
    Description:
    The Ambion MEGAscript RNAi Kit is for the synthesis of large mass amounts of dsRNA for RNAi experiments in nonmammalian systems The MEGAscript RNAi Kit uses Ambion s patented high yield transcription technology and includes reagents for transcription nuclease digestion and clean up The kit includes sufficient reagents for 20 reactions Synthesize Large Amounts of dsRNA The ability to generate large amounts of clean double stranded RNA is essential for the success of RNAi experiments The MEGAscript RNAi Kit allows RNAi researchers to synthesize 50 to 100 µg or more of double stranded RNA in a single transcription reaction The yield is typically 10 50 times the amount of RNA produced by conventional transcription reactions DNA of either PCR or plasmid origin can be used as a template for the transcription reaction The sense and antisense strands can be synthesized from a PCR generated DNA template containing T7 RNA Polymerase promoters on both ends of the template eliminating the need for a separate annealing step
    Catalog Number:
    am1626
    Price:
    None
    Applications:
    In Vitro Transcribed siRNA & Dicer siRNA|RNAi|RNAi, Epigenetics & Non-Coding RNA Research
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher megascript rnai kit
    P40 cytoplasmic distribution is controlled by CRM1-dependent nuclear export. (A). P40 cytoplasmic distribution is CRM1-dependent. P40-V 5 or P40 Δ360-374 -V 5 was expressed in Sf9 cells. At 44 hpt, the carrier solvent ethanol (1 μl) or an equivalent amount of ethanol containing LMB (0.1 μg/ml) were added to the culture medium. At 48 hpt, the cells were fixed and subjected to immunofluorescence microscopy using anti-V 5 . Scale bar: 20 μm. (B). CRM1 knockdown assay. Sf9 cells were transfected with ds-crm1 1-1000 , ds-crm1 1001-2000 , and ds-control (control dsRNA, included in the <t>MEGAscript</t> <t>RNAi</t> kit). At 72 hpt, cells were harvested and subjected to Western blot assay using anti-CRM1. (C). The impact of CRM1 knockdown on P40 subcellular distribution. Sf9 cells were transfected with ds-crm1 1-1000 or ds-control. At 24 hpt, plasmids encoding EGFP-P40 and P40-V 5 were transfected to dsRNA-bearing cells. At 72 hpt, cells were fixed and subjected to fluorescence microscopy assay. Scale bar: 5 μm. Densitometry assays were performed simultaneously. The bars represent the means and standard errors of the means for three independent experiments. Each experiment involves the quantification of 30 transfected cells for each plasmid. ***, P
    The Ambion MEGAscript RNAi Kit is for the synthesis of large mass amounts of dsRNA for RNAi experiments in nonmammalian systems The MEGAscript RNAi Kit uses Ambion s patented high yield transcription technology and includes reagents for transcription nuclease digestion and clean up The kit includes sufficient reagents for 20 reactions Synthesize Large Amounts of dsRNA The ability to generate large amounts of clean double stranded RNA is essential for the success of RNAi experiments The MEGAscript RNAi Kit allows RNAi researchers to synthesize 50 to 100 µg or more of double stranded RNA in a single transcription reaction The yield is typically 10 50 times the amount of RNA produced by conventional transcription reactions DNA of either PCR or plasmid origin can be used as a template for the transcription reaction The sense and antisense strands can be synthesized from a PCR generated DNA template containing T7 RNA Polymerase promoters on both ends of the template eliminating the need for a separate annealing step
    https://www.bioz.com/result/megascript rnai kit/product/Thermo Fisher
    Average 99 stars, based on 217 article reviews
    Price from $9.99 to $1999.99
    megascript rnai kit - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Autographa californica Multiple Nucleopolyhedrovirus Ac34 Protein Retains Cellular Actin-Related Protein 2/3 Complex in the Nucleus by Subversion of CRM1-Dependent Nuclear Export"

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac34 Protein Retains Cellular Actin-Related Protein 2/3 Complex in the Nucleus by Subversion of CRM1-Dependent Nuclear Export

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1005994

    P40 cytoplasmic distribution is controlled by CRM1-dependent nuclear export. (A). P40 cytoplasmic distribution is CRM1-dependent. P40-V 5 or P40 Δ360-374 -V 5 was expressed in Sf9 cells. At 44 hpt, the carrier solvent ethanol (1 μl) or an equivalent amount of ethanol containing LMB (0.1 μg/ml) were added to the culture medium. At 48 hpt, the cells were fixed and subjected to immunofluorescence microscopy using anti-V 5 . Scale bar: 20 μm. (B). CRM1 knockdown assay. Sf9 cells were transfected with ds-crm1 1-1000 , ds-crm1 1001-2000 , and ds-control (control dsRNA, included in the MEGAscript RNAi kit). At 72 hpt, cells were harvested and subjected to Western blot assay using anti-CRM1. (C). The impact of CRM1 knockdown on P40 subcellular distribution. Sf9 cells were transfected with ds-crm1 1-1000 or ds-control. At 24 hpt, plasmids encoding EGFP-P40 and P40-V 5 were transfected to dsRNA-bearing cells. At 72 hpt, cells were fixed and subjected to fluorescence microscopy assay. Scale bar: 5 μm. Densitometry assays were performed simultaneously. The bars represent the means and standard errors of the means for three independent experiments. Each experiment involves the quantification of 30 transfected cells for each plasmid. ***, P
    Figure Legend Snippet: P40 cytoplasmic distribution is controlled by CRM1-dependent nuclear export. (A). P40 cytoplasmic distribution is CRM1-dependent. P40-V 5 or P40 Δ360-374 -V 5 was expressed in Sf9 cells. At 44 hpt, the carrier solvent ethanol (1 μl) or an equivalent amount of ethanol containing LMB (0.1 μg/ml) were added to the culture medium. At 48 hpt, the cells were fixed and subjected to immunofluorescence microscopy using anti-V 5 . Scale bar: 20 μm. (B). CRM1 knockdown assay. Sf9 cells were transfected with ds-crm1 1-1000 , ds-crm1 1001-2000 , and ds-control (control dsRNA, included in the MEGAscript RNAi kit). At 72 hpt, cells were harvested and subjected to Western blot assay using anti-CRM1. (C). The impact of CRM1 knockdown on P40 subcellular distribution. Sf9 cells were transfected with ds-crm1 1-1000 or ds-control. At 24 hpt, plasmids encoding EGFP-P40 and P40-V 5 were transfected to dsRNA-bearing cells. At 72 hpt, cells were fixed and subjected to fluorescence microscopy assay. Scale bar: 5 μm. Densitometry assays were performed simultaneously. The bars represent the means and standard errors of the means for three independent experiments. Each experiment involves the quantification of 30 transfected cells for each plasmid. ***, P

    Techniques Used: Immunofluorescence, Microscopy, Transfection, Western Blot, Fluorescence, Plasmid Preparation

    Related Articles

    Injection:

    Article Title: Extracellular leucine-rich repeat proteins are required to organize the apical extracellular matrix and maintain epithelial junction integrity in C. elegans
    Article Snippet: .. let-4 double-stranded RNA (dsRNA) was synthesized using the Megascript RNAi Kit (Ambion), using as template a fragment of the let-4 cDNA corresponding to exons 8-10 (Primers: oMS199 5′-GTAATACGACTCACTATAGGGCAGTCGTGAAGATGAGATTCGC-3′ and oMS200 5′-GTAATACGACTCACTATAGGGCGCAATAACTGGATCCAGGATTG-3′). dsRNA was injected into gravid hermaphrodites and embryos laid > 16 hours later were scored. ..

    Amplification:

    Article Title: Juvenile Hormone Prevents 20-Hydroxyecdysone-induced Metamorphosis by Regulating the Phosphorylation of a Newly Identified Broad Protein *
    Article Snippet: .. A fragment containing a 684-bp gene-specific region with T7 promoter sequences on both ends was amplified with primers to synthesize BrZ7 double-stranded RNA (dsRNA) by using the MEGAscriptTM RNA interference (RNAi) kit (Ambion, Austin TX) according to the manufacturer's instructions. .. The PCR primers are listed in .

    Expressing:

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac34 Protein Retains Cellular Actin-Related Protein 2/3 Complex in the Nucleus by Subversion of CRM1-Dependent Nuclear Export
    Article Snippet: .. CRM1 knockdown assay To knockdown the expression of CRM1, primers encompassing the 1–1000 nt (TAATACGACTCACTATAGGGATGGCAACTTTAGAGCAACA, TAATACGACTCACTATAGGGACTTCAGATATCAGTACAAG) or the 1001–2000 nt (TAATACGACTCACTATAGGGAGAAGAAGTAGAAATTTTTA, TAATACGACTCACTATAGGGTGTCCAAATATATTCTACCC) of S . frugiperda CRM1 mRNA (Genbank accession: KT208379.1) were synthesized and served as gene specific primers to prepare dsRNA by using MEGAscript RNAi kit (Ambion) according to the manufacturer’s protocols. .. Sf9 cells were transfected with 5 μg dsRNA/105 cells using the Cellfectin II reagent (Invitrogen).

    Synthesized:

    Article Title: Suppressor of sable [Su(s)] and Wdr82 down-regulate RNA from heat-shock-inducible repetitive elements by a mechanism that involves transcription termination
    Article Snippet: .. LacZ dsRNA was synthesized from the template provided with the Ambion Megascript RNAi kit. ..

    Article Title: Transcriptional Analysis of The Adaptive Digestive System of The Migratory Locust in Response to Plant Defensive Protease Inhibitors
    Article Snippet: .. Synthesis of dsRNA for RNAi studies Double stranded RNAs for gfp (589 bp), LmHex2 (715 bp), LmHex3 (715 bp), LmHex6 (735 bp) and LmMet (421 bp) were synthesized using the MEGAscript RNAi kit (Thermo Fisher Scientific, Waltham, USA), according to the manufacturer’s instructions. .. Sense and antisense strands were synthesized from a PCR-generated DNA template containing T7 RNA Polymerase promoters on both 5′ ends of the primers.

    Article Title: Autographa californica Multiple Nucleopolyhedrovirus Ac34 Protein Retains Cellular Actin-Related Protein 2/3 Complex in the Nucleus by Subversion of CRM1-Dependent Nuclear Export
    Article Snippet: .. CRM1 knockdown assay To knockdown the expression of CRM1, primers encompassing the 1–1000 nt (TAATACGACTCACTATAGGGATGGCAACTTTAGAGCAACA, TAATACGACTCACTATAGGGACTTCAGATATCAGTACAAG) or the 1001–2000 nt (TAATACGACTCACTATAGGGAGAAGAAGTAGAAATTTTTA, TAATACGACTCACTATAGGGTGTCCAAATATATTCTACCC) of S . frugiperda CRM1 mRNA (Genbank accession: KT208379.1) were synthesized and served as gene specific primers to prepare dsRNA by using MEGAscript RNAi kit (Ambion) according to the manufacturer’s protocols. .. Sf9 cells were transfected with 5 μg dsRNA/105 cells using the Cellfectin II reagent (Invitrogen).

    Article Title: Extracellular leucine-rich repeat proteins are required to organize the apical extracellular matrix and maintain epithelial junction integrity in C. elegans
    Article Snippet: .. let-4 double-stranded RNA (dsRNA) was synthesized using the Megascript RNAi Kit (Ambion), using as template a fragment of the let-4 cDNA corresponding to exons 8-10 (Primers: oMS199 5′-GTAATACGACTCACTATAGGGCAGTCGTGAAGATGAGATTCGC-3′ and oMS200 5′-GTAATACGACTCACTATAGGGCGCAATAACTGGATCCAGGATTG-3′). dsRNA was injected into gravid hermaphrodites and embryos laid > 16 hours later were scored. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher megascript rnai kit
    Megascript Rnai Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 217 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megascript rnai kit/product/Thermo Fisher
    Average 99 stars, based on 217 article reviews
    Price from $9.99 to $1999.99
    megascript rnai kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results