Structured Review

GE Healthcare megaprime kit
Megaprime Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/megaprime kit/product/GE Healthcare
Average 92 stars, based on 42 article reviews
Price from $9.99 to $1999.99
megaprime kit - by Bioz Stars, 2020-04
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham). .. The transposon-inactivated agrA gene was transferred into a wild-type background by generalized transduction with phage LMUP35 ( ).

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: For detection of gfp and 16S rRNA transcripts, the coding regions of the corresponding genes were amplified from plasmid clones by PCR. .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]). ..

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: Paragraph title: Identification and Cloning of T. gondii Type 2C Phosphatase (PP2C) ... After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W.

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: Restriction digestions, cloning, and DNA- and RNA-blot hybridizations were performed following standard protocols ( ). .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham).

Amplification:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham). .. The transposon-inactivated agrA gene was transferred into a wild-type background by generalized transduction with phage LMUP35 ( ).

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: A gfp -specific probe was prepared by amplification with primer pair PZF9/PZF10, a plastid 16S rRNA probe with primer pair P16Srrn-F/P16Srrn-R and an E. coli 16S rRNA probe with the same primer pair ( Supplementary Table S1 ). .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Mouse genomic DNA fragments including Eogt exon 10, a 7.8 kb upstream region (long arm), or 1.9 kb downstream region (short arm) were amplified by PCR with PrimeSTAR Max polymerase (Takara [R045A]). .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W. .. Ajioka, University of Cambridge, Cambridge, United Kingdom).

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Equalized loading of the mRNA samples was confirmed by stripping the blots and rehybridizing with an 18SrRNA probe (a 250-bp fragment that was PCR amplified from an F. bidentis 18S rRNA clone). .. The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Synthesized:

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: .. For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions. .. This fragment is internal to the PCR primers used for this assay.

Electrophoresis:

Article Title: Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2
Article Snippet: RNA concentrations were determined by A 260 measurement and the quality was checked by electrophoresis on 1% formaldehyde agarose gels. .. A 32 P-labeled PCR fragment (Megaprime Kit, GE Healthcare Life Sciences, Germany), representing the 5′ part of the TDG cDNA served as specific probe.

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: After native electrophoresis , the gel slice containing the ∼36-kDa actin-binding protein was subjected to tryptic digestion (30°C, 18 h, 0.3 mg of trypsin in 0.1 M Tris-HCl, pH 8.6, 0.01% [vol/vol] Tween 20), and the peptides were recovered by high-performance liquid chromatography (HPLC). .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W.

Incubation:

Article Title: Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18
Article Snippet: The filter was blocked in 10% milk/TBS-T for 1 h at room temperature, before incubating with mouse monoclonal antibody raised against thymine dimers (MC-062, Kamiya Biomedical, Seattle, WA, USA) diluited 1 : 500 in 5% nonfat milk/TBS-T for 1 h. Following washing, membranes were incubated with a secondary rabbit polyclonal anti-mouse fluorescein (FITC)-conjugated antibody (Dako, Ely, Cambs, UK), diluted 1 : 600 in 5% nonfat milk/TBS-T for 1 h. The filter was then incubated with tertiary swine polyclonal anti-rabbit alkaline phosphatase (AP) conjugated antibody, diluted 1 : 1500 in 5% nonfat milk/TBS-T for 1 h. After washing three times in TBS-T, the signal was detected by overlaying the ECF substrate (APBiotech, Bucks, UK) on the membrane for 7 min, according to the manufacturers' instructions. .. To evaluate uniformity of DNA sample loading, each filter was also hybridised with 32 P-labeled human β- actin. β- Actin (25 ng) DNA was radioactively labelled by using the Megaprime kit (Amersham, Bucks, UK), according to the manufacturers' instructions.

Stripping Membranes:

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Equalized loading of the mRNA samples was confirmed by stripping the blots and rehybridizing with an 18SrRNA probe (a 250-bp fragment that was PCR amplified from an F. bidentis 18S rRNA clone). .. The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Derivative Assay:

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions. .. Hybridization to the HIV-1–specific probe was used to determine whether the ambiguously sized products were derived from HIV-1.

Hybridization:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: Hybridization was detected on Hyperfilm-MP films (Amersham). .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham).

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: Paragraph title: Isolation of nucleic acids and hybridization procedures ... Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: Paragraph title: Southern hybridization ... For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions.

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2
Article Snippet: Following pre-hybridization of the membrane at 65°C in hybridization buffer (0.5 M Na2 PO4 pH 7.2, 7% SDS) for 5 min, hybridization with probe was done for 20 h at 65°C. .. A 32 P-labeled PCR fragment (Megaprime Kit, GE Healthcare Life Sciences, Germany), representing the 5′ part of the TDG cDNA served as specific probe.

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Paragraph title: RNA Isolation, Northern Analysis, and Hybridization Probes ... The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

High Performance Liquid Chromatography:

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: After native electrophoresis , the gel slice containing the ∼36-kDa actin-binding protein was subjected to tryptic digestion (30°C, 18 h, 0.3 mg of trypsin in 0.1 M Tris-HCl, pH 8.6, 0.01% [vol/vol] Tween 20), and the peptides were recovered by high-performance liquid chromatography (HPLC). .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W.

Electroporation:

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Eogt -targeting vector DNA was linearized with AscI, and introduced into C57BL/6J ES cells ( ) by electroporation. .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Transfection:

Article Title: Chimeric constructs between two hepatitis B virus genomes confirm transcriptional impact of core promoter mutations and reveal multiple effects of core gene mutations
Article Snippet: Paragraph title: Transient transfection and analysis of HBV genome replication and virion secretion ... After transfer, the blots were hybridized with a 32 P dCTP labeled HBV DNA probe prepared by random priming (Megaprime kit, Amersham).

Sequencing:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham). .. The transposon-inactivated agrA gene was transferred into a wild-type background by generalized transduction with phage LMUP35 ( ).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Genomic DNA isolated from G418-resistant clones was subjected to PCR screening to confirm homologous recombination using KOD FX polymerase (Toyobo [KFX-101]), followed by a second screening to confirm the position of the third lox P sequence using LA Taq polymerase (Takara [RR002A]). .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: The latter was found in one clone from the T. gondii database of expressed sequence tags (TgESTzy48A06.r1, November 1999) (WashU-Merk Toxoplasma EST project; ). cDNA library screening and DNA sequencing: the oligonucleotide with the sequence: 5′-AGTGCAGACAACATTACTGCGATG-3′ corresponding to part of one peptide microsequence (SADNITAM) was used as the up stream primer, whereas 5′-AGACACACCAAGAATCTCGTC-3′ was chosen as the downstream primer in the TgESTzy48A06.r1clone. .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W.

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: The DNA sequence was obtained by using the IR Taq DNA-sequencing kit (Boehringer Mannheim) and an automated DNA sequencer (Li-Cor, Lincoln, NE). .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham).

Southern Blot:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: Paragraph title: Southern blot analysis. ... The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham).

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: Paragraph title: Determination of C by Southern blot marker frequency analysis. ... A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]). ..

Northern Blot:

Article Title: A Ufd2/D4Cole1e chimeric protein and overexpression of Rbp7 in the slow Wallerian degeneration (WldS) mouse
Article Snippet: Paragraph title: Northern Blotting Analysis. ... Probes were labeled using the Megaprime kit (Amersham Pharmacia) and [α-32 P]dCTP (Amersham Pharmacia) and hybridized for 1 h at 68°C in Expresshyb (CLONTECH).

Article Title: Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2
Article Snippet: Paragraph title: Northern blot analyses ... A 32 P-labeled PCR fragment (Megaprime Kit, GE Healthcare Life Sciences, Germany), representing the 5′ part of the TDG cDNA served as specific probe.

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Paragraph title: RNA Isolation, Northern Analysis, and Hybridization Probes ... The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Generated:

Article Title: Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18
Article Snippet: The spots, corresponding to the signal generated from DNA damage, were quantified using the IMAGEQuant programme. .. To evaluate uniformity of DNA sample loading, each filter was also hybridised with 32 P-labeled human β- actin. β- Actin (25 ng) DNA was radioactively labelled by using the Megaprime kit (Amersham, Bucks, UK), according to the manufacturers' instructions.

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: A psaB -specific probe generated with primer pair P7247/P7244 ( Supplementary Table S1 ) was used in the RFLP analysis of plastid transformants. .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: Chimeric constructs between two hepatitis B virus genomes confirm transcriptional impact of core promoter mutations and reveal multiple effects of core gene mutations
Article Snippet: After transfer, the blots were hybridized with a 32 P dCTP labeled HBV DNA probe prepared by random priming (Megaprime kit, Amersham). .. The 3-kb template DNA for probe preparation was generated from clone 2A by PCR.

DNA Sequencing:

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: All insert sequences were confirmed by DNA sequencing. .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: The latter was found in one clone from the T. gondii database of expressed sequence tags (TgESTzy48A06.r1, November 1999) (WashU-Merk Toxoplasma EST project; ). cDNA library screening and DNA sequencing: the oligonucleotide with the sequence: 5′-AGTGCAGACAACATTACTGCGATG-3′ corresponding to part of one peptide microsequence (SADNITAM) was used as the up stream primer, whereas 5′-AGACACACCAAGAATCTCGTC-3′ was chosen as the downstream primer in the TgESTzy48A06.r1clone. .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W.

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: The DNA sequence was obtained by using the IR Taq DNA-sequencing kit (Boehringer Mannheim) and an automated DNA sequencer (Li-Cor, Lincoln, NE). .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: In a minority (18/90) of the breast milk samples, RT-PCR in the absence of competitor produced DNA products of an ambiguous size, smaller than the expected wild type product but larger than the competitor. .. For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions.

Binding Assay:

Article Title: Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18
Article Snippet: To evaluate antibody binding, the filter underwent scanning using the STORM 840 chemofluorescent imaging system. .. To evaluate uniformity of DNA sample loading, each filter was also hybridised with 32 P-labeled human β- actin. β- Actin (25 ng) DNA was radioactively labelled by using the Megaprime kit (Amersham, Bucks, UK), according to the manufacturers' instructions.

Imaging:

Article Title: Repair of UV-induced thymine dimers is compromised in cells expressing the E6 protein from human papillomaviruses types 5 and 18
Article Snippet: To evaluate antibody binding, the filter underwent scanning using the STORM 840 chemofluorescent imaging system. .. To evaluate uniformity of DNA sample loading, each filter was also hybridised with 32 P-labeled human β- actin. β- Actin (25 ng) DNA was radioactively labelled by using the Megaprime kit (Amersham, Bucks, UK), according to the manufacturers' instructions.

Isolation:

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: Paragraph title: Isolation of nucleic acids and hybridization procedures ... Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: A Ufd2/D4Cole1e chimeric protein and overexpression of Rbp7 in the slow Wallerian degeneration (WldS) mouse
Article Snippet: Total RNA was isolated from 6–8-week-old C57BL/ Wld S and C57BL/6J mouse tissues using the single-step guanidinium thiocyanate method ( ). .. Probes were labeled using the Megaprime kit (Amersham Pharmacia) and [α-32 P]dCTP (Amersham Pharmacia) and hybridized for 1 h at 68°C in Expresshyb (CLONTECH).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Genomic DNA isolated from G418-resistant clones was subjected to PCR screening to confirm homologous recombination using KOD FX polymerase (Toyobo [KFX-101]), followed by a second screening to confirm the position of the third lox P sequence using LA Taq polymerase (Takara [RR002A]). .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: Total RNA was isolated from different plant organs according to the method of . .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham).

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Paragraph title: RNA Isolation, Northern Analysis, and Hybridization Probes ... The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Northern blot:

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham). .. A 692-bp Rsa I fragment from CBF2 and a 1124-bp Hin dIII fragment from CBF3 containing corresponding coding regions were cloned into pBluescript and used as probes to simultaneously detect all members of the CBF gene family.

Labeling:

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare). .. Protein extraction and immunoblot analyses Plant total soluble protein (TSP) was extracted from leaf samples homogenized in a buffer containing 50 mM HEPES, 10 mM KAc, 5 mM MgAc, 1 mM EDTA, 1 mM Pefablock (Roth, Karlsruhe, Germany) and 1 mM DTT (pH 7.5).

Article Title: A Ufd2/D4Cole1e chimeric protein and overexpression of Rbp7 in the slow Wallerian degeneration (WldS) mouse
Article Snippet: .. Probes were labeled using the Megaprime kit (Amersham Pharmacia) and [α-32 P]dCTP (Amersham Pharmacia) and hybridized for 1 h at 68°C in Expresshyb (CLONTECH). ..

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W. .. Ajioka, University of Cambridge, Cambridge, United Kingdom).

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: .. For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham). .. A 692-bp Rsa I fragment from CBF2 and a 1124-bp Hin dIII fragment from CBF3 containing corresponding coding regions were cloned into pBluescript and used as probes to simultaneously detect all members of the CBF gene family.

Article Title: Chimeric constructs between two hepatitis B virus genomes confirm transcriptional impact of core promoter mutations and reveal multiple effects of core gene mutations
Article Snippet: .. After transfer, the blots were hybridized with a 32 P dCTP labeled HBV DNA probe prepared by random priming (Megaprime kit, Amersham). .. The 3-kb template DNA for probe preparation was generated from clone 2A by PCR.

Purification:

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: All hybridization probes were purified using the Nucleospin Extract II kit (Macherey-Nagel, Düren, Germany). .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Dot Blot:

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Total RNA was extracted from transgenic and wild-type plants, and northern- or slot-blot analysis was performed as previously described ( ; ). .. The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Polymerase Chain Reaction:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham). .. The transposon-inactivated agrA gene was transferred into a wild-type background by generalized transduction with phage LMUP35 ( ).

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: For detection of gfp and 16S rRNA transcripts, the coding regions of the corresponding genes were amplified from plasmid clones by PCR. .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: Southern hybrid-ization/autoradiography of these PCR products following standard methods was used to clarify their origin [ ]. .. For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions.

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: .. A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. To prepare the probe mixture, we used two PCR fragments, a 1,051-bp terC and a 1,196-bp oriC fragment, which hybridize to 4.1- and 2.14-kb chromosomal Hin dIII fragments, respectively.

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Genomic DNA isolated from G418-resistant clones was subjected to PCR screening to confirm homologous recombination using KOD FX polymerase (Toyobo [KFX-101]), followed by a second screening to confirm the position of the third lox P sequence using LA Taq polymerase (Takara [RR002A]). .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Article Title: Cell cycle regulation as a mechanism for functional separation of the apparently redundant uracil DNA glycosylases TDG and UNG2
Article Snippet: .. A 32 P-labeled PCR fragment (Megaprime Kit, GE Healthcare Life Sciences, Germany), representing the 5′ part of the TDG cDNA served as specific probe. .. After hybridization the membrane was washed twice with wash buffer I (40 mM Na2 PO4 pH 7.2, 5% SDS) for 20 min at 65°C, followed by one washing steps with wash buffer II (40 mM Na2 PO4 pH 7.2, 1% SDS) at 65°C for 10 min. After exposition of the membrane to a phosphoimager screen, signals were visualized on a Storm phosphoimager (GE Healthcare Life Sciences, Germany).

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W. .. Ajioka, University of Cambridge, Cambridge, United Kingdom).

Article Title: The Arabidopsis CBF Gene Family Is Composed of Three Genes Encoding AP2 Domain-Containing Proteins Whose Expression Is Regulated by Low Temperature but Not by Abscisic Acid or Dehydration 1
Article Snippet: For DNA- and RNA-blot hybridizations, DNA probes were radioactively labeled with [α-32 P]dCTP using the Megaprime kit (Amersham). .. The CBF1 -specific probe consisted of a 181-bp PCR-amplified fragment containing 25 nucleotides of coding sequence and 156 nucleotides of 3′-noncoding region that was obtained by using the primers 5′-GTGAAGCAAAGAAGTAGAAAACG-3′ and 5′-GTGACGTGTCGCTTTGGAGTTAC-3′ ( ).

Article Title: Chimeric constructs between two hepatitis B virus genomes confirm transcriptional impact of core promoter mutations and reveal multiple effects of core gene mutations
Article Snippet: After transfer, the blots were hybridized with a 32 P dCTP labeled HBV DNA probe prepared by random priming (Megaprime kit, Amersham). .. The 3-kb template DNA for probe preparation was generated from clone 2A by PCR.

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Equalized loading of the mRNA samples was confirmed by stripping the blots and rehybridizing with an 18SrRNA probe (a 250-bp fragment that was PCR amplified from an F. bidentis 18S rRNA clone). .. The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

cDNA Library Assay:

Article Title: Actin Dynamics Is Controlled by a Casein Kinase II and Phosphatase 2C Interplay on Toxoplasma gondii Toxofilin
Article Snippet: .. After polymerase chain reaction (PCR) amplification, the 207-base pair fragment was 32 P labeled (Megaprime kit; Amersham Biosciences, Amersham, United Kingdom) and used to screen a T. gondii tachyzoite cDNA library (kindly provided by J.W. .. Ajioka, University of Cambridge, Cambridge, United Kingdom).

Plasmid Preparation:

Article Title: Identification of the agr Locus of Listeria monocytogenes: Role in Bacterial Virulence
Article Snippet: The probe used corresponds to a 0.7-kb internal portion of the plasmid pAT113 located between oriRK2 and the multiple cloning site. .. The fragment was (i) amplified by PCR with primer RK2-F and the forward primer of mp18/pUC18 (sequencing primer 1211; NE Biolabs), (ii) digested with Hin dIII (downstream of the multiple cloning site) to remove the region of the polylinker, and (iii) 32 P-labeled using the megaprime kit (Amersham).

Article Title: Selection of Shine-Dalgarno sequences in plastids
Article Snippet: For detection of gfp and 16S rRNA transcripts, the coding regions of the corresponding genes were amplified from plasmid clones by PCR. .. Probes were radioactively labeled with α32 P-dCTP using the MegaPrime kit (GE Healthcare).

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Paragraph title: Eogt targeting vector ... Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Software:

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ). .. Hybridizations were visualized and quantified using a phosphorimager equipped with ImageQuant software (Molecular Dynamics, Sunnyvale, CA).

Transgenic Assay:

Article Title: Untranslated Regions from C4 Amaranth AhRbcS1 mRNAs Confer Translational Enhancement and Preferential Bundle Sheath Cell Expression in Transgenic C4Flaveria bidentis 1
Article Snippet: Total RNA was extracted from transgenic and wild-type plants, and northern- or slot-blot analysis was performed as previously described ( ; ). .. The DNA probe fragments were [32 P]-labeled using a Megaprime kit (Amersham Biosciences, Piscataway, NJ).

Produced:

Article Title: Cell-Free Human Immunodeficiency Virus Type 1 in Breast Milk
Article Snippet: In a minority (18/90) of the breast milk samples, RT-PCR in the absence of competitor produced DNA products of an ambiguous size, smaller than the expected wild type product but larger than the competitor. .. For these analyses, a 32 P-labeled probe was synthesized by random priming of an HIV-1 gag fragment (nt 905–1044, HIV-1LAI ) using the Megaprime kit (Amersham, Arlington Heights, IL), following the manufacturer’s instructions.

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham). .. The terC probe was produced by using pBD2348 ( ) as the template and the primers ter1 (GTTGAAGTACTTGAGTCACC) and ter2 (CATTCAGACTTGAATGCGTG).

Immunoprecipitation:

Article Title: Chimeric constructs between two hepatitis B virus genomes confirm transcriptional impact of core promoter mutations and reveal multiple effects of core gene mutations
Article Snippet: Virus particles were immunoprecipitated from 1.5 ml of culture supernatant by a 1.5 μl of the anti-HBs antibody (horse polyclonal anti-Ad/Ay, Abcam) conjugated to protein G beads. .. After transfer, the blots were hybridized with a 32 P dCTP labeled HBV DNA probe prepared by random priming (Megaprime kit, Amersham).

Marker:

Article Title: Low-Temperature-Induced DnaA Protein Synthesis Does Not Change Initiation Mass in Escherichia coli K-12
Article Snippet: Paragraph title: Determination of C by Southern blot marker frequency analysis. ... A hybridization probe mixture was prepared by labeling Qiaquick spin column purified PCR fragments with [35 S]dATP, using DNA polymerase I Klenow fragment and random priming (Megaprime kit; Amersham).

Homologous Recombination:

Article Title: O-GlcNAc on NOTCH1 EGF repeats regulates ligand-induced Notch signaling and vascular development in mammals
Article Snippet: Genomic DNA isolated from G418-resistant clones was subjected to PCR screening to confirm homologous recombination using KOD FX polymerase (Toyobo [KFX-101]), followed by a second screening to confirm the position of the third lox P sequence using LA Taq polymerase (Takara [RR002A]). .. Selected ES clones were subjected to Southern blotting using long-arm (900 bp) or short-arm (1 kb) probes radiolabelled with [32 P]dCTP using the Megaprime Kit (GE Healthcare [RPN1606]).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    GE Healthcare megaprime dna labeling kit
    Megaprime Dna Labeling Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megaprime dna labeling kit/product/GE Healthcare
    Average 92 stars, based on 85 article reviews
    Price from $9.99 to $1999.99
    megaprime dna labeling kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare megaprime kit
    Megaprime Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megaprime kit/product/GE Healthcare
    Average 92 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    megaprime kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare megaprime dna labeling system kit
    Megaprime Dna Labeling System Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megaprime dna labeling system kit/product/GE Healthcare
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    megaprime dna labeling system kit - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    Image Search Results