mouse whole brain cdna (Zyagen Inc)
91
Structured Review
Zyagen Inc
mouse whole brain cdna
Mouse Whole Brain Cdna, supplied by Zyagen Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/md-201/bio_rxiv__2022__01__18__476718-240-21-25
Average 91 stars, based on 1 article reviews
Mouse Whole Brain Cdna, supplied by Zyagen Inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/md-201/bio_rxiv__2022__01__18__476718-240-21-25
Average 91 stars, based on 1 article reviews
mouse whole brain cdna - by Bioz Stars,
2026-09
91/100 stars
Images
Related Articles
Mutagenesis:Article Title: Control of Non-REM Sleep by Midbrain Neurotensinergic Neurons. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP for immunohistochemistry Aves Labs Cat# GFP-1020; RRID:AB_10000240 Bacterial and Virus Strains AAV2-EF1a-DIO-ChR2-eYFP UNC Chapel Hill Vector Core N/A AAVDJ-EF1a-DIO-ChR2-eYFP Stanford University Virus Core N/A AAV2-EF1a-DIO-iC++-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM3D(Gq)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM4D(Gi)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-mCherry UNC Chapel Hill Vector Core N/A AAV1-Syn-FLEx-GCaMP6f Penn Vector Core Cat# AV-1-PV2819 AAV2-CAG-FLEx-TCB Miyamichi et al., 2013 Addgene; Cat# 48332 AAV2-CAG-FLEx-RG Kim et al., 2016 Addgene; Cat# 74292 rAAV2-retro-EF1a-DIO-ChR2-eYFP This paper Tervo et al., 2016 rAAV2-retro-EF1a-DIO-eGFP This paper Tervo et al., 2016 AAV2-U6-DIO-lacZ sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Nts sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Slc17a6 sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 RG-deleted, eGFP-expressing rabies virus Gene Transfer Targeting and Therapeutics Core of Salk Institute N/A Chemicals, Peptides, and Recombinant Proteins Clozapine-N-oxide Sigma-aldrich Cat# C0832 Critical Commercial Assays SuperScript III kit Invitrogen Cat# 18080-051 Accuprime Taq polymerase Invitrogen Cat# 12339-024 AmpliTaq Gold 360 Master Mix Invitrogen Cat# 4398886 RNAscope Manual Fluorescent Multiplex kit V2 Advanced Cell Diagnostics Cat# 323100 Experimental Models: Organisms/Strains Mouse, Gad2cre The Jackson Laboratory Cat# 010802; RRID:IMSR_JAX: 010802 Mouse, Vglut2Cre The Jackson Laboratory Cat# 016963; RRID:IMSR_JAX: 016963 (Continued on next page) e1 Neuron 104, 1–15.e1–e6, November 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse, NtsCre The Jackson Laboratory Cat# 017525; RRID:IMSR_JAX: 017525 Mouse, THCre European Mouse Mutant Archive Cat# EM:00254; RRID:IMSR_EM: 00254 Oligonucleotides Gad2 (sense/anti-sense): multiplex, CAGCCTTAGGGATTGGAACA/ACCCAGTAGTCCC CTTTGCT; nested, GTTCCTTTCCTGGTGAGTGC/ TGCATCAGTCCCTCCTCTCT This paper N/A Vglut2(sense/anti-sense): multiplex, GCCGCTACA TCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAA GACACCAGAAGCCAGAACA This paper N/A GAPDH(sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTA GGAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCT TCCACAAT This paper N/A Mouse brain, Multiplex Assay:Article Title: Control of Non-REM Sleep by Midbrain Neurotensinergic Neurons. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP for immunohistochemistry Aves Labs Cat# GFP-1020; RRID:AB_10000240 Bacterial and Virus Strains AAV2-EF1a-DIO-ChR2-eYFP UNC Chapel Hill Vector Core N/A AAVDJ-EF1a-DIO-ChR2-eYFP Stanford University Virus Core N/A AAV2-EF1a-DIO-iC++-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM3D(Gq)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM4D(Gi)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-mCherry UNC Chapel Hill Vector Core N/A AAV1-Syn-FLEx-GCaMP6f Penn Vector Core Cat# AV-1-PV2819 AAV2-CAG-FLEx-TCB Miyamichi et al., 2013 Addgene; Cat# 48332 AAV2-CAG-FLEx-RG Kim et al., 2016 Addgene; Cat# 74292 rAAV2-retro-EF1a-DIO-ChR2-eYFP This paper Tervo et al., 2016 rAAV2-retro-EF1a-DIO-eGFP This paper Tervo et al., 2016 AAV2-U6-DIO-lacZ sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Nts sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Slc17a6 sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 RG-deleted, eGFP-expressing rabies virus Gene Transfer Targeting and Therapeutics Core of Salk Institute N/A Chemicals, Peptides, and Recombinant Proteins Clozapine-N-oxide Sigma-aldrich Cat# C0832 Critical Commercial Assays SuperScript III kit Invitrogen Cat# 18080-051 Accuprime Taq polymerase Invitrogen Cat# 12339-024 AmpliTaq Gold 360 Master Mix Invitrogen Cat# 4398886 RNAscope Manual Fluorescent Multiplex kit V2 Advanced Cell Diagnostics Cat# 323100 Experimental Models: Organisms/Strains Mouse, Gad2cre The Jackson Laboratory Cat# 010802; RRID:IMSR_JAX: 010802 Mouse, Vglut2Cre The Jackson Laboratory Cat# 016963; RRID:IMSR_JAX: 016963 (Continued on next page) e1 Neuron 104, 1–15.e1–e6, November 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse, NtsCre The Jackson Laboratory Cat# 017525; RRID:IMSR_JAX: 017525 Mouse, THCre European Mouse Mutant Archive Cat# EM:00254; RRID:IMSR_EM: 00254 Oligonucleotides Gad2 (sense/anti-sense): multiplex, CAGCCTTAGGGATTGGAACA/ACCCAGTAGTCCC CTTTGCT; nested, GTTCCTTTCCTGGTGAGTGC/ TGCATCAGTCCCTCCTCTCT This paper N/A Vglut2(sense/anti-sense): multiplex, GCCGCTACA TCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAA GACACCAGAAGCCAGAACA This paper N/A GAPDH(sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTA GGAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCT TCCACAAT This paper N/A Mouse brain, In Situ Hybridization:Article Title: Control of Non-REM Sleep by Midbrain Neurotensinergic Neurons. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP for immunohistochemistry Aves Labs Cat# GFP-1020; RRID:AB_10000240 Bacterial and Virus Strains AAV2-EF1a-DIO-ChR2-eYFP UNC Chapel Hill Vector Core N/A AAVDJ-EF1a-DIO-ChR2-eYFP Stanford University Virus Core N/A AAV2-EF1a-DIO-iC++-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM3D(Gq)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM4D(Gi)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-mCherry UNC Chapel Hill Vector Core N/A AAV1-Syn-FLEx-GCaMP6f Penn Vector Core Cat# AV-1-PV2819 AAV2-CAG-FLEx-TCB Miyamichi et al., 2013 Addgene; Cat# 48332 AAV2-CAG-FLEx-RG Kim et al., 2016 Addgene; Cat# 74292 rAAV2-retro-EF1a-DIO-ChR2-eYFP This paper Tervo et al., 2016 rAAV2-retro-EF1a-DIO-eGFP This paper Tervo et al., 2016 AAV2-U6-DIO-lacZ sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Nts sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Slc17a6 sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 RG-deleted, eGFP-expressing rabies virus Gene Transfer Targeting and Therapeutics Core of Salk Institute N/A Chemicals, Peptides, and Recombinant Proteins Clozapine-N-oxide Sigma-aldrich Cat# C0832 Critical Commercial Assays SuperScript III kit Invitrogen Cat# 18080-051 Accuprime Taq polymerase Invitrogen Cat# 12339-024 AmpliTaq Gold 360 Master Mix Invitrogen Cat# 4398886 RNAscope Manual Fluorescent Multiplex kit V2 Advanced Cell Diagnostics Cat# 323100 Experimental Models: Organisms/Strains Mouse, Gad2cre The Jackson Laboratory Cat# 010802; RRID:IMSR_JAX: 010802 Mouse, Vglut2Cre The Jackson Laboratory Cat# 016963; RRID:IMSR_JAX: 016963 (Continued on next page) e1 Neuron 104, 1–15.e1–e6, November 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse, NtsCre The Jackson Laboratory Cat# 017525; RRID:IMSR_JAX: 017525 Mouse, THCre European Mouse Mutant Archive Cat# EM:00254; RRID:IMSR_EM: 00254 Oligonucleotides Gad2 (sense/anti-sense): multiplex, CAGCCTTAGGGATTGGAACA/ACCCAGTAGTCCC CTTTGCT; nested, GTTCCTTTCCTGGTGAGTGC/ TGCATCAGTCCCTCCTCTCT This paper N/A Vglut2(sense/anti-sense): multiplex, GCCGCTACA TCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAA GACACCAGAAGCCAGAACA This paper N/A GAPDH(sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTA GGAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCT TCCACAAT This paper N/A Mouse brain, Article Title: Modified viral-genetic mapping reveals local and global connectivity relationships of ventral tegmental area dopamine cells Article Snippet: .. To make ISH probes, DNA fragments of 400-1000 bp containing the coding or untranslated region sequences were amplified by PCR from Software:Article Title: Control of Non-REM Sleep by Midbrain Neurotensinergic Neurons. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies anti-GFP for immunohistochemistry Aves Labs Cat# GFP-1020; RRID:AB_10000240 Bacterial and Virus Strains AAV2-EF1a-DIO-ChR2-eYFP UNC Chapel Hill Vector Core N/A AAVDJ-EF1a-DIO-ChR2-eYFP Stanford University Virus Core N/A AAV2-EF1a-DIO-iC++-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-eYFP UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM3D(Gq)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-hM4D(Gi)-mCherry UNC Chapel Hill Vector Core N/A AAV2-EF1a-DIO-mCherry UNC Chapel Hill Vector Core N/A AAV1-Syn-FLEx-GCaMP6f Penn Vector Core Cat# AV-1-PV2819 AAV2-CAG-FLEx-TCB Miyamichi et al., 2013 Addgene; Cat# 48332 AAV2-CAG-FLEx-RG Kim et al., 2016 Addgene; Cat# 74292 rAAV2-retro-EF1a-DIO-ChR2-eYFP This paper Tervo et al., 2016 rAAV2-retro-EF1a-DIO-eGFP This paper Tervo et al., 2016 AAV2-U6-DIO-lacZ sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Nts sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 AAV2-U6-DIO-Slc17a6 sgRNA-pCbh-Dio-ChR2-mCherry This paper Ma et al., 2019 RG-deleted, eGFP-expressing rabies virus Gene Transfer Targeting and Therapeutics Core of Salk Institute N/A Chemicals, Peptides, and Recombinant Proteins Clozapine-N-oxide Sigma-aldrich Cat# C0832 Critical Commercial Assays SuperScript III kit Invitrogen Cat# 18080-051 Accuprime Taq polymerase Invitrogen Cat# 12339-024 AmpliTaq Gold 360 Master Mix Invitrogen Cat# 4398886 RNAscope Manual Fluorescent Multiplex kit V2 Advanced Cell Diagnostics Cat# 323100 Experimental Models: Organisms/Strains Mouse, Gad2cre The Jackson Laboratory Cat# 010802; RRID:IMSR_JAX: 010802 Mouse, Vglut2Cre The Jackson Laboratory Cat# 016963; RRID:IMSR_JAX: 016963 (Continued on next page) e1 Neuron 104, 1–15.e1–e6, November 20, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse, NtsCre The Jackson Laboratory Cat# 017525; RRID:IMSR_JAX: 017525 Mouse, THCre European Mouse Mutant Archive Cat# EM:00254; RRID:IMSR_EM: 00254 Oligonucleotides Gad2 (sense/anti-sense): multiplex, CAGCCTTAGGGATTGGAACA/ACCCAGTAGTCCC CTTTGCT; nested, GTTCCTTTCCTGGTGAGTGC/ TGCATCAGTCCCTCCTCTCT This paper N/A Vglut2(sense/anti-sense): multiplex, GCCGCTACA TCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAA GACACCAGAAGCCAGAACA This paper N/A GAPDH(sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTA GGAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCT TCCACAAT This paper N/A Mouse brain, Fluorescence In Situ Hybridization:Article Title: Identification of Preoptic Sleep Neurons Using Retrograde Labeling and Gene Profiling Article Snippet: First, FISH for CCK, CRH, TAC1 and GAD1 was performed using RNAscope assays according to the manufacturer’s instructions (Advanced cell Diagnostics). .. Second, to make TAC1, GAD1 and GAD2 FISH probes, DNA fragments containing the coding or untranslated sequences were amplified using PCR from Article Title: Sleep Regulation by Neurotensinergic Neurons in a Thalamo-Amygdala Circuit. Article Snippet: .. The following primer sequences were used for cloning of Gad1, Gad2, Slc17a6, Nts, Prkcd, and Penk probes (50 > 30) (see also Table S1): Gad1 (sense/anti-sense): TGTGCCCAAACTGGTCCT / TGGCCGATGATTCTGGTT; Gad2 (sense/anti-sense): TCTTTTCTCCTGGTGGCG / TTGAGAGGCGGCTCATTC; Slc17a6 (sense/anti-sense): CCAAATCTTACGGTGCTACCTC / TAGCCATCTTTCCTGTTCCACT; Nts (sense/anti-sense): ATGAGAGGAATGAATCTCCAGC / TCAGTAGTAGTAGGAACCCCTCT; Prkcd (sense/anti-sense): TTCCTGCGCATCTCCTTC / TGCATTGCCTGCATTTGT; Penk (sense/anti-sense): CCTGAGGCTTTGCACCTGG / TCCCAGTAGCTCTTTCAGCAG; To make FISH probes, DNA fragments were amplified using PCR from Amplification:Article Title: Identification of Preoptic Sleep Neurons Using Retrograde Labeling and Gene Profiling Article Snippet: First, FISH for CCK, CRH, TAC1 and GAD1 was performed using RNAscope assays according to the manufacturer’s instructions (Advanced cell Diagnostics). .. Second, to make TAC1, GAD1 and GAD2 FISH probes, DNA fragments containing the coding or untranslated sequences were amplified using PCR from Article Title: Modified viral-genetic mapping reveals local and global connectivity relationships of ventral tegmental area dopamine cells Article Snippet: .. To make ISH probes, DNA fragments of 400-1000 bp containing the coding or untranslated region sequences were amplified by PCR from Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing Article Snippet: .. The sequences were amplified by RT-PCR from Article Title: Sleep Regulation by Neurotensinergic Neurons in a Thalamo-Amygdala Circuit. Article Snippet: .. The following primer sequences were used for cloning of Gad1, Gad2, Slc17a6, Nts, Prkcd, and Penk probes (50 > 30) (see also Table S1): Gad1 (sense/anti-sense): TGTGCCCAAACTGGTCCT / TGGCCGATGATTCTGGTT; Gad2 (sense/anti-sense): TCTTTTCTCCTGGTGGCG / TTGAGAGGCGGCTCATTC; Slc17a6 (sense/anti-sense): CCAAATCTTACGGTGCTACCTC / TAGCCATCTTTCCTGTTCCACT; Nts (sense/anti-sense): ATGAGAGGAATGAATCTCCAGC / TCAGTAGTAGTAGGAACCCCTCT; Prkcd (sense/anti-sense): TTCCTGCGCATCTCCTTC / TGCATTGCCTGCATTTGT; Penk (sense/anti-sense): CCTGAGGCTTTGCACCTGG / TCCCAGTAGCTCTTTCAGCAG; To make FISH probes, DNA fragments were amplified using PCR from Polymerase Chain Reaction:Article Title: Identification of Preoptic Sleep Neurons Using Retrograde Labeling and Gene Profiling Article Snippet: First, FISH for CCK, CRH, TAC1 and GAD1 was performed using RNAscope assays according to the manufacturer’s instructions (Advanced cell Diagnostics). .. Second, to make TAC1, GAD1 and GAD2 FISH probes, DNA fragments containing the coding or untranslated sequences were amplified using PCR from Article Title: Modified viral-genetic mapping reveals local and global connectivity relationships of ventral tegmental area dopamine cells Article Snippet: .. To make ISH probes, DNA fragments of 400-1000 bp containing the coding or untranslated region sequences were amplified by PCR from Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing Article Snippet: .. The sequences were amplified by RT-PCR from Article Title: Sleep Regulation by Neurotensinergic Neurons in a Thalamo-Amygdala Circuit. Article Snippet: .. The following primer sequences were used for cloning of Gad1, Gad2, Slc17a6, Nts, Prkcd, and Penk probes (50 > 30) (see also Table S1): Gad1 (sense/anti-sense): TGTGCCCAAACTGGTCCT / TGGCCGATGATTCTGGTT; Gad2 (sense/anti-sense): TCTTTTCTCCTGGTGGCG / TTGAGAGGCGGCTCATTC; Slc17a6 (sense/anti-sense): CCAAATCTTACGGTGCTACCTC / TAGCCATCTTTCCTGTTCCACT; Nts (sense/anti-sense): ATGAGAGGAATGAATCTCCAGC / TCAGTAGTAGTAGGAACCCCTCT; Prkcd (sense/anti-sense): TTCCTGCGCATCTCCTTC / TGCATTGCCTGCATTTGT; Penk (sense/anti-sense): CCTGAGGCTTTGCACCTGG / TCCCAGTAGCTCTTTCAGCAG; To make FISH probes, DNA fragments were amplified using PCR from Reverse Transcription Polymerase Chain Reaction:Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing Article Snippet: .. The sequences were amplified by RT-PCR from Plasmid Preparation:Article Title: Differential maturation of vesicular glutamate and GABA transporter expression in the mouse auditory forebrain during the first weeks of hearing Article Snippet: .. The sequences were amplified by RT-PCR from Cloning:Article Title: Sleep Regulation by Neurotensinergic Neurons in a Thalamo-Amygdala Circuit. Article Snippet: .. The following primer sequences were used for cloning of Gad1, Gad2, Slc17a6, Nts, Prkcd, and Penk probes (50 > 30) (see also Table S1): Gad1 (sense/anti-sense): TGTGCCCAAACTGGTCCT / TGGCCGATGATTCTGGTT; Gad2 (sense/anti-sense): TCTTTTCTCCTGGTGGCG / TTGAGAGGCGGCTCATTC; Slc17a6 (sense/anti-sense): CCAAATCTTACGGTGCTACCTC / TAGCCATCTTTCCTGTTCCACT; Nts (sense/anti-sense): ATGAGAGGAATGAATCTCCAGC / TCAGTAGTAGTAGGAACCCCTCT; Prkcd (sense/anti-sense): TTCCTGCGCATCTCCTTC / TGCATTGCCTGCATTTGT; Penk (sense/anti-sense): CCTGAGGCTTTGCACCTGG / TCCCAGTAGCTCTTTCAGCAG; To make FISH probes, DNA fragments were amplified using PCR from |