m13 puc19 reverse primer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    M13 Sequencing Reverse Primer
    Description:
    Use our tool to find and order pre designed primers for PCR and Sanger sequencing Free of SNPs and dimers target specific and suitable for universal PCR conditions these primers can be ordered unmodified M13 tailed HPLC purified or desalted All primers are checked by mass spectrometry
    Catalog Number:
    a15638
    Price:
    None
    Applications:
    Kits & Reagents for Sanger Sequencing|Sanger Sequencing|Sanger Sequencing Technology & Accessories|Sequencing
    Category:
    Oligos Primers Probes Nucleotides
    Buy from Supplier


    Structured Review

    Thermo Fisher m13 puc19 reverse primer
    Use our tool to find and order pre designed primers for PCR and Sanger sequencing Free of SNPs and dimers target specific and suitable for universal PCR conditions these primers can be ordered unmodified M13 tailed HPLC purified or desalted All primers are checked by mass spectrometry
    https://www.bioz.com/result/m13 puc19 reverse primer/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    m13 puc19 reverse primer - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: .. A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL). .. First, standard TCV RdRp reactions (including [32 P]UTP, see above) were performed with AU1/art and Mot1/pr templates separately, followed by removal of the free nucleotides by passing the reaction mixtures through Micro Bio-Spin columns (Bio-Rad).

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: The nucleotide sequences of clones (named pKitauei) of the PCR products were determined via sequencing. .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Article Title: RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs
    Article Snippet: .. We sequenced cDNA clones using the M13 rsp reverse primer and the BigDye terminator cycle sequencing reaction kit (PE Applied Biosystems) on an ABI Prism 3700 (Perkin Elmer) sequenator. .. We analysed sequences with the LASERGENE sequence analysis program package.

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Paragraph title: Cloning of lamprey HMGB1 ... DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Amplification:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: We selected eight microsatellite (Short Tandem Repeat—STR) loci (Fmin02, Fmin11, Fmin12, Fmin14, Fmin15, Fmin16, Fmin17, and Fmin18; [ ]) developed for the Great Frigatebird, F . minor , which were shown to exhibit consistent amplification and polymorphism in F . magnificens [ ] Every forward primer was 5’-tailed with an M13 sequence ( 5’-CACGACGTTGTAAAACGAC-3’ ) and used in combination with an M13 primer that had the same sequence but was dye labelled at its 5’ end [ ]. .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen).

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Amplification products were verified by gel electrophoresis and purified using the Wizard PCR cleanup kit (Promega, Madison, WI). .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Genome-wide identification of quantitative trait loci in a cross between Hampshire and Landrace II: Meat quality traits
    Article Snippet: A total of 120 microsatellite markers covering the autosomes were PCR amplified in 450 animals (excluding the 77 purebred Hampshire sows in the parental generation) and genotyped using either an ABI PRISM® 3100 Genetic Analyzer and ABI GeneMapper™ Genotyping Software in Copenhagen or a MegaBACE™ 1000 DNA Analysis System and Genetic Profiler (Amersham Biosciences) in Uppsala. .. A 20 μl PCR reaction with 1× PCR Buffer II, 2.5 mM MgCl2 , 0.3 mM dNTP, 0.03 μM forward primer, 0.3 μM of each reverse and M13-biotinylated primer, 0.75 U of AmpliTaq GOLD polymerase (Applied Biosystems) and 50–100 ng DNA was run using a standard touch-down PCR protocol.

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: The 18S small subunit ribosomal RNA (18S rRNA) was amplified by PCR using a set of universal eukaryotic primers (UEP-F, 5'-ACCTGGTTGATCCTGCCAG-3' and UEP-R, 5'-CTTCCGCAGGTTCACCTACGG-3', [ ]). .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Article Title: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The touchdown PCR method consisted of: 95 °C for 5 min; 3 cycles 95 °C for 30 s, 64 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 62 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 60 °C for 15 s, 72 °C for 30 s; 37 cycles 95 °C for 30 s, 58 °C for 15 s, 72 °C for 30 s; 70 °C for 5 min. Templates were purified using AMPure, and sequenced bidirectionally with M13 forward/reverse primers and the Big Dye Terminator Kit v.3.1 (Applied Biosystems) at Agencourt Biosciences.

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA). .. Statistical Analysis A receiver-operating characteristic (ROC) curve was generated to assess the similarity score for each of the 102 possible HPV genotype outcomes on array with the actual genotype(s) detected by sequencing of the 91 samples, for a total of 9282 tests.

    DNA Ligation:

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: The PCR product was purified, cloned into a pMD19-T vector using a DNA Ligation kit (TaKaRa, China), and transformed into DH5α E. coli . .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Synthesized:

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Total RNA was isolated from lamprey lymphocyte-like cells using Trizol (Invitrogen, USA), and cDNA was synthesized with the High Fidelity PrimeScript™ RT-PCR Kit (TaKaRa, China). .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    TA Cloning:

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: The PCR products were then excised from 1% agarose gels, and purified PCR products were cloned into pCR 2.1-TOPO vectors using the TOPO TA cloning kit (Invitrogen; Carlsbad, California, USA). .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Incubation:

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: After overnight incubation, transformants were randomly selected and plasmids were extracted using the Wizard Plus Miniprep DNA purification system (Promega). .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Touchdown PCR:

    Article Title: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation
    Article Snippet: .. The touchdown PCR method consisted of: 95 °C for 5 min; 3 cycles 95 °C for 30 s, 64 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 62 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 60 °C for 15 s, 72 °C for 30 s; 37 cycles 95 °C for 30 s, 58 °C for 15 s, 72 °C for 30 s; 70 °C for 5 min. Templates were purified using AMPure, and sequenced bidirectionally with M13 forward/reverse primers and the Big Dye Terminator Kit v.3.1 (Applied Biosystems) at Agencourt Biosciences. .. Dye terminators were removed using CleanSEQ (Agencourt Biosciences), and sequence reactions were run on ABI PRISM 3730xl (Applied Biosystems).

    Transformation Assay:

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Purified fragments were ligated to the pGEM-T vector (Promega), transformed into Escherichia coli strain JM109 competent cells, and plated on LB medium (with 50 μg ml−1 ampicillin) following the manufacturer's instructions. .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: Gel-purified DNA was inserted into pCR2.1 TOPO vector (Invitrogen) and transformed into chemically competent TOP10 E. coli (Invitrogen), according to manufacturer's specifications. .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA).

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: The PCR product was purified, cloned into a pMD19-T vector using a DNA Ligation kit (TaKaRa, China), and transformed into DH5α E. coli . .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Hybridization:

    Article Title: RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs
    Article Snippet: We sequenced cDNA clones using the M13 rsp reverse primer and the BigDye terminator cycle sequencing reaction kit (PE Applied Biosystems) on an ABI Prism 3700 (Perkin Elmer) sequenator. .. After exclusion of the most abundant known snmRNAs by filter hybridisation screening (see below), about 5000 cDNA clones were analysed by sequencing and compared with each other using the Lasergene Seqman II program package to identify identical clones.

    Polymerase Chain Reaction:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen). ..

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: To detect template switch from R3(−)/art to AU1/art, we used reverse primer 248, which anneals to the 3′ end of the complementary AU1/art sequence for RT and the forward primer 18 (GTAATACGACTCACTATAGGAGAAAGCGAGTAAGACAG) for PCR. .. A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL).

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Amplification products were verified by gel electrophoresis and purified using the Wizard PCR cleanup kit (Promega, Madison, WI). .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Genome-wide identification of quantitative trait loci in a cross between Hampshire and Landrace II: Meat quality traits
    Article Snippet: .. A 20 μl PCR reaction with 1× PCR Buffer II, 2.5 mM MgCl2 , 0.3 mM dNTP, 0.03 μM forward primer, 0.3 μM of each reverse and M13-biotinylated primer, 0.75 U of AmpliTaq GOLD polymerase (Applied Biosystems) and 50–100 ng DNA was run using a standard touch-down PCR protocol. .. Starting with 95°C for 15 min, then 14 touch down cycles 95°C 30 s, 65–52°C 30 s, 72°C 30 s, followed by 30 cycles 95°C 30 s, 52°C 30 s, 72°C 30 s and ending with 72°C for 10 min. A standard pyrosequencing protocol was employed (Biotage).

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: The nucleotide sequences of clones (named pKitauei) of the PCR products were determined via sequencing. .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Article Title: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The touchdown PCR method consisted of: 95 °C for 5 min; 3 cycles 95 °C for 30 s, 64 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 62 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 60 °C for 15 s, 72 °C for 30 s; 37 cycles 95 °C for 30 s, 58 °C for 15 s, 72 °C for 30 s; 70 °C for 5 min. Templates were purified using AMPure, and sequenced bidirectionally with M13 forward/reverse primers and the Big Dye Terminator Kit v.3.1 (Applied Biosystems) at Agencourt Biosciences.

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA). .. Statistical Analysis A receiver-operating characteristic (ROC) curve was generated to assess the similarity score for each of the 102 possible HPV genotype outcomes on array with the actual genotype(s) detected by sequencing of the 91 samples, for a total of 9282 tests.

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: The PCR product was purified, cloned into a pMD19-T vector using a DNA Ligation kit (TaKaRa, China), and transformed into DH5α E. coli . .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    DNA Sequencing:

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Approximately 400 ng of DNA from each cycle sequencing reaction mixture was sent to the University of Tennessee DNA sequencing facility.

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations. .. Finally, the obtained nucleotide sequence was compared with the 18S rRNA sequences of other myxosporeans in Genbank database via alignment using the CLUSTAL W software.

    Article Title: RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs
    Article Snippet: Paragraph title: DNA sequencing and sequence analysis ... We sequenced cDNA clones using the M13 rsp reverse primer and the BigDye terminator cycle sequencing reaction kit (PE Applied Biosystems) on an ABI Prism 3700 (Perkin Elmer) sequenator.

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA). .. Sequence alignment and construction of a phylogenetic tree A total of 16 HMGB1/2/3 sequences from other species were obtained from ExPASy ( http://www.expasy.ch/tools/blast/ , ).

    Sequencing:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: We selected eight microsatellite (Short Tandem Repeat—STR) loci (Fmin02, Fmin11, Fmin12, Fmin14, Fmin15, Fmin16, Fmin17, and Fmin18; [ ]) developed for the Great Frigatebird, F . minor , which were shown to exhibit consistent amplification and polymorphism in F . magnificens [ ] Every forward primer was 5’-tailed with an M13 sequence ( 5’-CACGACGTTGTAAAACGAC-3’ ) and used in combination with an M13 primer that had the same sequence but was dye labelled at its 5’ end [ ]. .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen).

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: Paragraph title: RT-PCR and sequencing analysis. ... A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL).

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Approximately 400 ng of DNA from each cycle sequencing reaction mixture was sent to the University of Tennessee DNA sequencing facility.

    Article Title: Genome-wide identification of quantitative trait loci in a cross between Hampshire and Landrace II: Meat quality traits
    Article Snippet: The single point mutation (C → T) in the pig ryanodine receptor (ryr1) gene changing an arginine to a cysteine at amino acid 615 [ ] was genotyped with pyrosequencing using the following primers: forward primer with an M13-tag sequence CACGACGTTGTAAAACGACAGTGCCCTCACACCTTGAC, reverse primer CCAGGGAGCAAGTTCTCAGT, M13-biotinylated primer CACGACGTTGTAAAACGAC and sequencing primer AGTAATGAGATCTTGGTTGGAG. .. A 20 μl PCR reaction with 1× PCR Buffer II, 2.5 mM MgCl2 , 0.3 mM dNTP, 0.03 μM forward primer, 0.3 μM of each reverse and M13-biotinylated primer, 0.75 U of AmpliTaq GOLD polymerase (Applied Biosystems) and 50–100 ng DNA was run using a standard touch-down PCR protocol.

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations. .. Finally, the obtained nucleotide sequence was compared with the 18S rRNA sequences of other myxosporeans in Genbank database via alignment using the CLUSTAL W software.

    Article Title: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation
    Article Snippet: Paragraph title: PCR amplification and sequencing ... The touchdown PCR method consisted of: 95 °C for 5 min; 3 cycles 95 °C for 30 s, 64 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 62 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 60 °C for 15 s, 72 °C for 30 s; 37 cycles 95 °C for 30 s, 58 °C for 15 s, 72 °C for 30 s; 70 °C for 5 min. Templates were purified using AMPure, and sequenced bidirectionally with M13 forward/reverse primers and the Big Dye Terminator Kit v.3.1 (Applied Biosystems) at Agencourt Biosciences.

    Article Title: RNomics in Drosophila melanogaster: identification of 66 candidates for novel non-messenger RNAs
    Article Snippet: .. We sequenced cDNA clones using the M13 rsp reverse primer and the BigDye terminator cycle sequencing reaction kit (PE Applied Biosystems) on an ABI Prism 3700 (Perkin Elmer) sequenator. .. We analysed sequences with the LASERGENE sequence analysis program package.

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA). .. Statistical Analysis A receiver-operating characteristic (ROC) curve was generated to assess the similarity score for each of the 102 possible HPV genotype outcomes on array with the actual genotype(s) detected by sequencing of the 91 samples, for a total of 9282 tests.

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Cloning of lamprey HMGB1 Construction of a cDNA library from lamprey lymphocyte-like cells and expressed sequence tags (EST) sequencing were previously completed by our lab. .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Nucleic Acid Electrophoresis:

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Amplification products were verified by gel electrophoresis and purified using the Wizard PCR cleanup kit (Promega, Madison, WI). .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Mutagenesis:

    Article Title: Genome-wide identification of quantitative trait loci in a cross between Hampshire and Landrace II: Meat quality traits
    Article Snippet: The single point mutation (C → T) in the pig ryanodine receptor (ryr1) gene changing an arginine to a cysteine at amino acid 615 [ ] was genotyped with pyrosequencing using the following primers: forward primer with an M13-tag sequence CACGACGTTGTAAAACGACAGTGCCCTCACACCTTGAC, reverse primer CCAGGGAGCAAGTTCTCAGT, M13-biotinylated primer CACGACGTTGTAAAACGAC and sequencing primer AGTAATGAGATCTTGGTTGGAG. .. A 20 μl PCR reaction with 1× PCR Buffer II, 2.5 mM MgCl2 , 0.3 mM dNTP, 0.03 μM forward primer, 0.3 μM of each reverse and M13-biotinylated primer, 0.75 U of AmpliTaq GOLD polymerase (Applied Biosystems) and 50–100 ng DNA was run using a standard touch-down PCR protocol.

    Isolation:

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: The obtained RT-PCR products were either gel isolated or directly cloned into pGEM-T Easy vector (Promega). .. A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL).

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Total RNA was isolated from lamprey lymphocyte-like cells using Trizol (Invitrogen, USA), and cDNA was synthesized with the High Fidelity PrimeScript™ RT-PCR Kit (TaKaRa, China). .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Size-exclusion Chromatography:

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: PCR was conducted using a mixture containing 100 ng of genomic DNA, 10 µM of each primer, 2.5 mM dNTP mix, 2.5 units of Taq polymerase (Promega, Madison, Wisconsin, USA) and the manufacturer's reaction buffer in a final volume of 50 µl under the following conditions: 94℃ for 7 min (initial denaturation), followed by 30 cycles of 94℃ for 30 sec (denaturation), 55℃ for 30 sec (annealing), and 72℃ for 1 min (extension), and a final extension of 72℃ for 10 min. .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Purification:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: The amplified products were assessed on a 1% agarose gel, purified enzymatically with shrimp alkaline phosphatase and exonuclease I (GE Healthcare), and Sanger sequenced by Macrogen Inc., South Korea. .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen).

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: Purified fragments were ligated to the pGEM-T vector (Promega), transformed into Escherichia coli strain JM109 competent cells, and plated on LB medium (with 50 μg ml−1 ampicillin) following the manufacturer's instructions. .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: The PCR products were then excised from 1% agarose gels, and purified PCR products were cloned into pCR 2.1-TOPO vectors using the TOPO TA cloning kit (Invitrogen; Carlsbad, California, USA). .. DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations.

    Article Title: Recurrent somatic mutation of FAT1 in multiple human cancers leads to aberrant Wnt activation
    Article Snippet: .. The touchdown PCR method consisted of: 95 °C for 5 min; 3 cycles 95 °C for 30 s, 64 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 62 °C for 15 s, 72 °C for 30 s; 3 cycles 95 °C for 30 s, 60 °C for 15 s, 72 °C for 30 s; 37 cycles 95 °C for 30 s, 58 °C for 15 s, 72 °C for 30 s; 70 °C for 5 min. Templates were purified using AMPure, and sequenced bidirectionally with M13 forward/reverse primers and the Big Dye Terminator Kit v.3.1 (Applied Biosystems) at Agencourt Biosciences. .. Dye terminators were removed using CleanSEQ (Agencourt Biosciences), and sequence reactions were run on ABI PRISM 3730xl (Applied Biosystems).

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: The PCR products were visualized by agarose gel electrophoresis, and amplicons of correct size were gel purified using the PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, Calif, USA). .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA).

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: The PCR product was purified, cloned into a pMD19-T vector using a DNA Ligation kit (TaKaRa, China), and transformed into DH5α E. coli . .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: Paragraph title: RT-PCR and sequencing analysis. ... A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL).

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Total RNA was isolated from lamprey lymphocyte-like cells using Trizol (Invitrogen, USA), and cDNA was synthesized with the High Fidelity PrimeScript™ RT-PCR Kit (TaKaRa, China). .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    cDNA Library Assay:

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: Cloning of lamprey HMGB1 Construction of a cDNA library from lamprey lymphocyte-like cells and expressed sequence tags (EST) sequencing were previously completed by our lab. .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Plasmid Preparation:

    Article Title: Mechanism of RNA Recombination in Carmo- and Tombusviruses: Evidence for Template Switching by the RNA-Dependent RNA Polymerase In Vitro †
    Article Snippet: The obtained RT-PCR products were either gel isolated or directly cloned into pGEM-T Easy vector (Promega). .. A representative number of independent clones were sequenced using the M13/pUC19 reverse primer (Gibco BRL).

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA). .. Approximately 400 ng of DNA from each cycle sequencing reaction mixture was sent to the University of Tennessee DNA sequencing facility.

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: Gel-purified DNA was inserted into pCR2.1 TOPO vector (Invitrogen) and transformed into chemically competent TOP10 E. coli (Invitrogen), according to manufacturer's specifications. .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA).

    Article Title: Identification and Characterization of the Lamprey High-Mobility Group Box 1 Gene
    Article Snippet: The PCR product was purified, cloned into a pMD19-T vector using a DNA Ligation kit (TaKaRa, China), and transformed into DH5α E. coli . .. DNA sequencing was conducted with M13 Forward/Reverse primers using a model ABI 377 DNA Sequencer (Applied Biosystems, USA).

    Software:

    Article Title: Genome-wide identification of quantitative trait loci in a cross between Hampshire and Landrace II: Meat quality traits
    Article Snippet: A total of 120 microsatellite markers covering the autosomes were PCR amplified in 450 animals (excluding the 77 purebred Hampshire sows in the parental generation) and genotyped using either an ABI PRISM® 3100 Genetic Analyzer and ABI GeneMapper™ Genotyping Software in Copenhagen or a MegaBACE™ 1000 DNA Analysis System and Genetic Profiler (Amersham Biosciences) in Uppsala. .. A 20 μl PCR reaction with 1× PCR Buffer II, 2.5 mM MgCl2 , 0.3 mM dNTP, 0.03 μM forward primer, 0.3 μM of each reverse and M13-biotinylated primer, 0.75 U of AmpliTaq GOLD polymerase (Applied Biosystems) and 50–100 ng DNA was run using a standard touch-down PCR protocol.

    Article Title: Molecular Identification and Real-time Quantitative PCR (qPCR) for Rapid Detection of Thelohanellus kitauei, a Myxozoan Parasite Causing Intestinal Giant Cystic Disease in the Israel Carp
    Article Snippet: DNA sequencing was conducted with M13 Forward/Reverse primers using an ABI3730 automatic sequencer (96-capillary, Applied Biosystems, Foster City, California, USA) and Applied Biosystems BigDye® Terminator Cycle Sequencing Kits v3.1, in accordance with the manufacturer's recommendations. .. Finally, the obtained nucleotide sequence was compared with the 18S rRNA sequences of other myxosporeans in Genbank database via alignment using the CLUSTAL W software.

    Functional Assay:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: [ ] using species-specific primers, strongly suggesting that we are studying the functional cytb copy. .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen).

    Agarose Gel Electrophoresis:

    Article Title: Population Genetic Structure of the Magnificent Frigatebird Fregata magnificens (Aves, Suliformes) Breeding Colonies in the Western Atlantic Ocean
    Article Snippet: The amplified products were assessed on a 1% agarose gel, purified enzymatically with shrimp alkaline phosphatase and exonuclease I (GE Healthcare), and Sanger sequenced by Macrogen Inc., South Korea. .. The PCR reactions were performed individually for each locus in a 10-μl volume containing 1 μl of diluted DNA, 1x PCR Buffer (Invitrogen), 2.5 mM MgCl2 , 0.2 mM dNTPs, 0.4 μM of reverse and M13-fluorescent primers, 0.05 μM of M13-tailed forward primer, and 0.1 unit of Taq Platinum DNA Polymerase (Invitrogen).

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: The PCR products were visualized by agarose gel electrophoresis, and amplicons of correct size were gel purified using the PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, Calif, USA). .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA).

    DNA Purification:

    Article Title: Prevalence of Lysogeny among Soil Bacteria and Presence of 16S rRNA and trzN Genes in Viral-Community DNA ▿
    Article Snippet: After overnight incubation, transformants were randomly selected and plasmids were extracted using the Wizard Plus Miniprep DNA purification system (Promega). .. Plasmid insert DNA was bidirectionally sequenced using M13 forward/reverse primers and the Big Dye cycle sequencing kit (Applied Biosystems, Foster City, CA).

    Gel Extraction:

    Article Title: Validation of a Diagnostic Microarray for Human Papillomavirus: Coverage of 102 Genotypes
    Article Snippet: The PCR products were visualized by agarose gel electrophoresis, and amplicons of correct size were gel purified using the PureLink Quick Gel Extraction Kit (Invitrogen, Carlsbad, Calif, USA). .. For each DNA sample, 12 transformant colonies were selected for PCR insert amplification using M13 forward-reverse primers followed by sequencing on the ABI 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, Calif, USA).