Structured Review

Thermo Fisher m mlv
M Mlv, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m mlv/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
Price from $9.99 to $1999.99
m mlv - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. In reactions without competitor, 2.5 or 1.3 µM recombinant proteins were preincubated for 20 min with 10,000 cpm (approximately 2 ng) of 32 P-labelled multiple cloning site (MCS) RNA of pCS2 and pXT1 plasmids.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Amplification:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX). .. First-strand cDNA (5 μl) were amplified by PCR using the following oligos 5'-CCGCTCGAGCGGGCCGCCATGCCGGTGGCTGAAACCGTTG and 5'-GCTCTAGAGCGGCGGCCATGGCCAGG to amplify M-PMV CA sequences.

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen). .. Each sample was assayed in triplicate and was compared to arbitrary values assigned to a standard curve generated from serial dilutions of placental RNA to obtain relative abundance of amplified product.

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation). .. The cDNA was then amplified by real-time quantitative TaqMan PCR using an ABI Prism 7700 (Applied Biosystems) sequence detection system.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: The reverse transcription reactions were amplified by PCR with primer pairs specific for tRNA3 Lys (5′-ATAGCTCAGTCGGTAGAGCAT [sense] and 5′-GCCGAACAGGGACTTGAT [antisense]) and HIV-1 genomic RNA (5′-CAAGTAGTGTGTGCCCGTCTGTT [sense] and 5′-CGAGAGAGCTCCTCTGGTTCTAC [antisense]). .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Synthesized:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. All cDNA was synthesized from 300ng isolated RNA sample in a total volume of 20μ L and kept at -20°C until ready for use.

Construct:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Paragraph title: Constructs ... Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic).

Real-time Polymerase Chain Reaction:

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen). .. Real time PCR was performed using an ABI Prism 7900 System (Applied Biosystems, Foster City, CA).

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Paragraph title: TaqMan quantitative PCR. ... Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Muscle cell-derived factors inhibit inflammatory stimuli-induced damage in hMSC-derived chondrocytes
Article Snippet: RNA was then transcribed to cDNA using random primers (Invitrogen), MMLV reverse transcriptase kit (Invitrogen), and dNTPs (New England BioLabs; Ipswich, MA) and stored at −20°C until RT-PCR analyses. .. For RT-PCR, cDNA was mixed with gene-specific primers (sequences available upon request) and SYBR Green Supermix (Quanta Biosciences, Inc., Gaithersburg, MD), quantified using BioRad’s iQ5 Real Time PCR Detection System and optical software (Hercules, CA), and normalized against gylceraldehyde-3-phosphate-dehydrogenase (GAPDH).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Paragraph title: Quantitative real-time PCR ... For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Quantitation Assay:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: The amount of viral particles was normalized by quantitation of p27 detected by immunobloting. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. The ‘absolute quantitation by standard curve’ method was used to determine the number of cDNA molecules in each LEAP RNP or RNA sample.

Expressing:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: To study the effects of EGF on B7-H1 mRNA expression, 7.5 × 106 trophoblast cells were plated in 60 mm Petri dishes and treated the following day for up to 48 hours. .. One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen).

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation). .. TaqMan gene expression reagents or SYBR Green Master PCR mix (Applied Biosystems) were used to detect the genes responsible for inflammation.

Western Blot:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: The amount of viral particles was normalized by quantitation of p27 detected by immunobloting. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

RNA Binding Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. Binding reactions were performed in RNA binding buffer (10 mM Tris-HCl (pH 7.4), 10 mM KCl, 1 mM MgCl2 ).

Inhibition:

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: D-Actinomycin treatment For the transcription inhibition with D-Actinomycin, RKO cells transfected with a scrambled or IMP3 specific shRNA were seeded in a density of 2.5 x 105 in 6-well-plates. .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section.

Countercurrent Chromatography:

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen). .. Primers used included B7-H1 (5’-tca atg ccc cat aca aca aa-3’ (Fwd) and 5’-cga agt cat ctg gac aag c-3’ (Rev), and the housekeeping gene β-actin (Applied Biosystems).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. Relative levels of PAP-3 cDNA in the normalized samples were determined by semiquantitative PCR using j699 (5′-CGT GTT GTT ATT AGC TTC GTA TTT CT-3′) and j700 (5′-CAT CCC CCC AGC CTC TAC-3′ for PAP-3′.

Transfection:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: RNA extraction and RT-PCR Medium from transfected COS-1 cells were clarified and virus was pelleted through a 20% sucrose cushion at 207,570 × g in an SW41 rotor for 2 hours at 4°C and resuspended in 30 μl of PBS. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: D-Actinomycin treatment For the transcription inhibition with D-Actinomycin, RKO cells transfected with a scrambled or IMP3 specific shRNA were seeded in a density of 2.5 x 105 in 6-well-plates. .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section.

Reverse Transcription Polymerase Chain Reaction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Paragraph title: RNA extraction and RT-PCR ... 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: The human TPO cDNA (1109 bp) was amplified by RT–PCR using as template total RNA extracted from human peripheral blood leukocytes. .. Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic).

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: Paragraph title: RNA Extraction and RT-PCR ... One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
Article Snippet: Paragraph title: One-step RT-PCR (quantitative real-time) ... M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments.

Article Title: Muscle cell-derived factors inhibit inflammatory stimuli-induced damage in hMSC-derived chondrocytes
Article Snippet: .. RNA was then transcribed to cDNA using random primers (Invitrogen), MMLV reverse transcriptase kit (Invitrogen), and dNTPs (New England BioLabs; Ipswich, MA) and stored at −20°C until RT-PCR analyses. .. For RT-PCR, cDNA was mixed with gene-specific primers (sequences available upon request) and SYBR Green Supermix (Quanta Biosciences, Inc., Gaithersburg, MD), quantified using BioRad’s iQ5 Real Time PCR Detection System and optical software (Hercules, CA), and normalized against gylceraldehyde-3-phosphate-dehydrogenase (GAPDH).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: Paragraph title: PCR and RT-PCR analysis. ... Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Generated:

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen). .. Each sample was assayed in triplicate and was compared to arbitrary values assigned to a standard curve generated from serial dilutions of placental RNA to obtain relative abundance of amplified product.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Polymerase Chain Reaction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX). .. First-strand cDNA (5 μl) were amplified by PCR using the following oligos 5'-CCGCTCGAGCGGGCCGCCATGCCGGTGGCTGAAACCGTTG and 5'-GCTCTAGAGCGGCGGCCATGGCCAGG to amplify M-PMV CA sequences.

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation). .. The cDNA was then amplified by real-time quantitative TaqMan PCR using an ABI Prism 7700 (Applied Biosystems) sequence detection system.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. Firstly, the RNA was transcribed into first cDNA, using 10μ m oligonucleotide dT primer; 10mM dNTP and DEPC-treated water were combined together and preserved at 65°C for 10 minutes with extended temperature of 4°C in the conventional PCR.

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. Relative levels of PAP-3 cDNA in the normalized samples were determined by semiquantitative PCR using j699 (5′-CGT GTT GTT ATT AGC TTC GTA TTT CT-3′) and j700 (5′-CAT CCC CCC AGC CTC TAC-3′ for PAP-3′.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min. ..

Sequencing:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. To study the strength of splice sites on the splicing efficiency of the 116 nt sequence, we used an overlap extension system ( ) to mutagenize the 5′-splice site towards consensus with primer 5′C-for, tccgaggacaggtaagtatcctgat and 5′C-rev, atcaggatacttacctgtcctcgga and the 3′ splice site, which was improved partially with primers 3′I-for, acgagctcccttgtttaaacaggacttct and 3′I-rev, tccgaggacaggtaagtatcctgat or fully with primers 3′C-for, agtcctcacactgaacgttttttttttcaggacttct and 3′C-rev, agaagtcctgaaaaaaaaaacgttcagtgtgaggact, respectively.

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation). .. The cDNA was then amplified by real-time quantitative TaqMan PCR using an ABI Prism 7700 (Applied Biosystems) sequence detection system.

Recombinant:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: .. Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. Binding reactions were performed in RNA binding buffer (10 mM Tris-HCl (pH 7.4), 10 mM KCl, 1 mM MgCl2 ).

Isolation:

Article Title: Muscle cell-derived factors inhibit inflammatory stimuli-induced damage in hMSC-derived chondrocytes
Article Snippet: Total RNA was isolated from scaffolds using the RNeasy Mini kit (Qiagen; Valencia, CA) as per the manufacturer’s protocol. .. RNA was then transcribed to cDNA using random primers (Invitrogen), MMLV reverse transcriptase kit (Invitrogen), and dNTPs (New England BioLabs; Ipswich, MA) and stored at −20°C until RT-PCR analyses.

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: .. Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. Firstly, the RNA was transcribed into first cDNA, using 10μ m oligonucleotide dT primer; 10mM dNTP and DEPC-treated water were combined together and preserved at 65°C for 10 minutes with extended temperature of 4°C in the conventional PCR.

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Similarly, fat body and haemocyte RNA samples were isolated from naive and bacteria-challenged M. sexta larvae. .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: An iNTT system for the large-scale screening of differentially expressed, nuclear-targeted proteins: cold-treatment-induced nucleoproteins in Rye (Secale cereale L.)
Article Snippet: .. Poly(A) + RNA was prepared from the isolated total RNA using the Oligotex™-dT30 (Super) mRNA Purification Kit (Takara, Japan). cDNA libraries were then prepared using a cDNA Library Construction Kit (Takara, Japan) with the following modifications: 5 μg poly(A) + RNA was used to synthesize first-strand cDNA using the Oligo (dT)18 Anchor Primer and M-MLV reverse transcriptase, and second-strand synthesis was performed using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). ..

Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †
Article Snippet: Supernatant containing 60 ng of p24 Ag was treated with TriPure reagent (Roche Diagnostics), 0.5 pg of in vitro-synthesized HIV-1 RNA was added, and total virion RNA was isolated according to the manufacturer’s recommendations. .. Total viral RNA was annealed to an oligonucleotide (5′-GACTGCGAATCGTTCTAG-3′, antisense) complementary to sequences in the gag open reading frame at 75°C for 10 min and placed on ice, and cDNA was made by using the supplied buffers, 0.2 mM dNTPs, and M-MLV RT (Life Technologies) at 37°C for 60 min. Each cDNA reaction was assayed by PCR for the internal control (IC) cDNA (reverse transcribed from IC RNA) by using a 32 P-labeled oligonucleotide specific for pGem4z sequences (5′-GGGAGACAAGCTTGCATGCCTG, sense) and an unlabeled HIV-1-specific oligonucleotide (5′-GCAGTGGGTTCCCTAGTTAGC, antisense) for 25 cycles at 93°C for 1 min and 65°C for 2 min.

Labeling:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen). .. In competition assays, unlabeled competitor nucleic acids were preincubated for 10 min with recombinant proteins before addition of labeled RNA.

Purification:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Purified RNA was treated with 1 U of Rnase-free Dnase I (New England Biolabs, Inc., Berverly, MA) for 30 min at 37°C, followed by inactivation at 70°C for 30 min. Purified RNA from equivalent amounts of virus was diluted 1:1,000 followed by 2-fold serial dilutions. .. 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: RNA samples were extracted from various tissues of M. sexta at different developmental stages (see legend for details), using Micro-to-Midi Total RNA purification system (Invitrogen Life Technologies, Carlsbad, CA). .. First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: An iNTT system for the large-scale screening of differentially expressed, nuclear-targeted proteins: cold-treatment-induced nucleoproteins in Rye (Secale cereale L.)
Article Snippet: .. Poly(A) + RNA was prepared from the isolated total RNA using the Oligotex™-dT30 (Super) mRNA Purification Kit (Takara, Japan). cDNA libraries were then prepared using a cDNA Library Construction Kit (Takara, Japan) with the following modifications: 5 μg poly(A) + RNA was used to synthesize first-strand cDNA using the Oligo (dT)18 Anchor Primer and M-MLV reverse transcriptase, and second-strand synthesis was performed using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). ..

Transgenic Assay:

Article Title: The Use of a Dexamethasone-inducible System to Synchronize Xa21 Expression to Study Rice Immunity
Article Snippet: .. Kitaake) Transgenic rice seeds containing pTA7002::Myc::Xa21 ( ) Transgenic rice seeds containing Ubi::Myc::Xa21 ( ) Xanthomonas oryzae pv. oryzae ( Xoo ; Philippines race 6, strain PXO99Az) Dexamethasone (Sigma-Aldrich, catalog number: D1756) Dimethyl sulfoxide (DMSO) (Thermo Fisher Scientific, catalog number: D128-1) Tween-20 (Bio-Rad Laboratories, catalog number: 170-6531) Sterile H2 O (Milli-Q) TRIzol (Life Technologies, Invitrogen™ , catalog number: 15596-026) M-MLV reverse transcriptase (Life Technologies, Invitrogen™ , catalog number: 28025-013) SsoFastEvaGreenSupermix (Bio-Rad Laboratories, catalog number: 172-5203) Peptone sucrose agar (PSA) solid media containing 20 μg/ml cephalexin (MP Biomedicals, catalog number: 02150585) (see Recipes) Dexamethasone (see Recipes) Greenhouse rice growing conditions (see Recipes) Walk-in growth chamber rice growing conditions (see Recipes) .. Spray bottle (550 ml) (any supplier) for dexamethasone foliar spray 1.5 ml Eppendorf tube (any supplier) Surgical scissors (sharp/sharp, straight, 5 ½ inch or similar) for Xoo clipping inoculation 5 ½ inch square disposable pots Supertub (24 inch x 36 inch x 8 inch) (Mac Court Products, model: ST3608 or similar) Scale suitable for measurements down to 0.0001 g (any manufacturer) Spectrophotometer suitable for taking optical density measurements at 600 nm (any manufacturer) Growth chamber (14 h light and 10 h dark photoperiod with 28 °C temperature) (any manufacturer) for rice seed germination Incubation chamber (28 °C) (any manufacturer) for Xoo preparation Greenhouse capable of temperature and humidity control for growing rice plants Walk-in growth chamber (conviron or equivalent) for Xoo inoculation and dexamethasone treatment qPCR machine (Bio-Rad Laboratories, model: CFX96 Real-Time PCR)

Filter-binding Assay:

Article Title: Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles
Article Snippet: Paragraph title: Filter binding assay ... Recombinant proteins used were bovine serum albumin (Fraction V, Sigma), His-Gadd45a and M-MLV-reverse transcriptase (Invitrogen).

Quantitative RT-PCR:

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section. .. For analysis, we defined the level of a specific mRNA in the DMSO-treated control cells (diluent control) in both the scrambled shRNA- and shIMP3-transduced cells as 1.

cDNA Library Assay:

Article Title: An iNTT system for the large-scale screening of differentially expressed, nuclear-targeted proteins: cold-treatment-induced nucleoproteins in Rye (Secale cereale L.)
Article Snippet: .. Poly(A) + RNA was prepared from the isolated total RNA using the Oligotex™-dT30 (Super) mRNA Purification Kit (Takara, Japan). cDNA libraries were then prepared using a cDNA Library Construction Kit (Takara, Japan) with the following modifications: 5 μg poly(A) + RNA was used to synthesize first-strand cDNA using the Oligo (dT)18 Anchor Primer and M-MLV reverse transcriptase, and second-strand synthesis was performed using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). ..

Plasmid Preparation:

Article Title: Splicing of constitutive upstream introns is essential for the recognition of intra-exonic suboptimal splice sites in the thrombopoietin gene
Article Snippet: Poly(dT) cDNA was synthesized using MMLV reverse transcriptase (Gibco BRL) and was amplified with the above mentioned oligos for 35 cycles (30 s at 94°C, 30 s at 62°C, 1 min at 72°C), using 2 U of Taq DNA polymerase (Roche Diagnostic). .. Both the TPO gene and the TPO cDNA were digested with Kpn I and Not I restriction enzymes and ligated into pcDNA 3 eukaryotic expression vector (Invitrogen) Kpn I/ Not I cut, generating the parental constructs TPO gene and TPO cDNA.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. .. A standard curve was generated using dilutions of a L1 LEAP product cloned into a plasmid, and a best fit line (log(molecules) versus average Ct value) for these standards was generated by linear regression.

Article Title: An iNTT system for the large-scale screening of differentially expressed, nuclear-targeted proteins: cold-treatment-induced nucleoproteins in Rye (Secale cereale L.)
Article Snippet: Poly(A) + RNA was prepared from the isolated total RNA using the Oligotex™-dT30 (Super) mRNA Purification Kit (Takara, Japan). cDNA libraries were then prepared using a cDNA Library Construction Kit (Takara, Japan) with the following modifications: 5 μg poly(A) + RNA was used to synthesize first-strand cDNA using the Oligo (dT)18 Anchor Primer and M-MLV reverse transcriptase, and second-strand synthesis was performed using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA). .. The purified cDNA was ligated to pre-digested pLexAD plasmid DNA using T4 DNA ligase.

Software:

Article Title: Muscle cell-derived factors inhibit inflammatory stimuli-induced damage in hMSC-derived chondrocytes
Article Snippet: RNA was then transcribed to cDNA using random primers (Invitrogen), MMLV reverse transcriptase kit (Invitrogen), and dNTPs (New England BioLabs; Ipswich, MA) and stored at −20°C until RT-PCR analyses. .. For RT-PCR, cDNA was mixed with gene-specific primers (sequences available upon request) and SYBR Green Supermix (Quanta Biosciences, Inc., Gaithersburg, MD), quantified using BioRad’s iQ5 Real Time PCR Detection System and optical software (Hercules, CA), and normalized against gylceraldehyde-3-phosphate-dehydrogenase (GAPDH).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. After electrophoretic separation on a 1.3% agarose gel, intensities of the PCR products were quantified and compared using Digital Science 1D Gel Analysis Software (Kodak, Rochester, NY).

SYBR Green Assay:

Article Title: TLR3 absence confers increased survival with improved macrophage activity against pneumonia
Article Snippet: Total RNA was prepared from whole-lung lysates and reverse-transcribed into cDNA using M-MLV reverse transcriptase (Life Technologies Corporation). .. TaqMan gene expression reagents or SYBR Green Master PCR mix (Applied Biosystems) were used to detect the genes responsible for inflammation.

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: Quantitative real-time PCR Quantitative PCR was performed on LEAP cDNA samples or M-MLV RT-PCR products using the 7300 Real Time PCR system (Applied Biosystems). .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles.

Article Title: Muscle cell-derived factors inhibit inflammatory stimuli-induced damage in hMSC-derived chondrocytes
Article Snippet: RNA was then transcribed to cDNA using random primers (Invitrogen), MMLV reverse transcriptase kit (Invitrogen), and dNTPs (New England BioLabs; Ipswich, MA) and stored at −20°C until RT-PCR analyses. .. For RT-PCR, cDNA was mixed with gene-specific primers (sequences available upon request) and SYBR Green Supermix (Quanta Biosciences, Inc., Gaithersburg, MD), quantified using BioRad’s iQ5 Real Time PCR Detection System and optical software (Hercules, CA), and normalized against gylceraldehyde-3-phosphate-dehydrogenase (GAPDH).

Article Title: Characterization of LINE-1 Ribonucleoprotein Particles
Article Snippet: .. For analysis, 1 µL of LEAP or M-MLV RT products was added to 19 µL of master mix (1X SYBR Green PCR Master Mix (Applied Biosystems), 500 nM L1 3′ end primer, and 500 nM L1 Reverse primer), and amplified in a standard Q-PCR run of 45 cycles. ..

RNA Extraction:

Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging
Article Snippet: Paragraph title: RNA extraction and RT-PCR ... 5 μl of diluted RNA was used for first-strand cDNA synthesis as per manufacturers suggestions for M-MLV RT (Invitrogen) using 500 ng of oligo (dT)12–18 (Ambion, Austin, TX).

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: Paragraph title: RNA Extraction and RT-PCR ... One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen).

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: Paragraph title: RNA extraction and RT-PCR analysis ... First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment.

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section. .. For analysis, we defined the level of a specific mRNA in the DMSO-treated control cells (diluent control) in both the scrambled shRNA- and shIMP3-transduced cells as 1.

Article Title: An iNTT system for the large-scale screening of differentially expressed, nuclear-targeted proteins: cold-treatment-induced nucleoproteins in Rye (Secale cereale L.)
Article Snippet: Therefore, leaves were harvested before (baseline control) and after 5 h of cold treatment, immediately frozen in liquid nitrogen and stored at −80 °C for future RNA extraction. .. Poly(A) + RNA was prepared from the isolated total RNA using the Oligotex™-dT30 (Super) mRNA Purification Kit (Takara, Japan). cDNA libraries were then prepared using a cDNA Library Construction Kit (Takara, Japan) with the following modifications: 5 μg poly(A) + RNA was used to synthesize first-strand cDNA using the Oligo (dT)18 Anchor Primer and M-MLV reverse transcriptase, and second-strand synthesis was performed using the SuperScript® Double-Stranded cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, USA).

shRNA:

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: D-Actinomycin treatment For the transcription inhibition with D-Actinomycin, RKO cells transfected with a scrambled or IMP3 specific shRNA were seeded in a density of 2.5 x 105 in 6-well-plates. .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section.

Agarose Gel Electrophoresis:

Article Title: Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains
Article Snippet: First-strand cDNA synthesis was performed using 2–4 µg RNA, 10 pmol oligo(dT)17 , and 200 U MMLV reverse transcriptase (Invitrogen Life Technologies) at 37 °C for 1 h. M. sexta ribosomal protein S3 transcripts were used as an internal standard to control the template amount in a preliminary PCR experiment. .. After electrophoretic separation on a 1.3% agarose gel, intensities of the PCR products were quantified and compared using Digital Science 1D Gel Analysis Software (Kodak, Rochester, NY).

Incubation:

Article Title: Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells
Article Snippet: Complementary DNA (cDNA) Synthesis The intact RNA was reverse transcriptase at once after isolation using Invitrogen reagent M-MLV. .. The transcription mixture of 0.1M DTT, 50,000U M-mlv, and 5x-strand buffer was then incubated at 37°C for 50 minutes, at 70°C for 5 minutes and extended temperature of 4°C.

Article Title: The RNA binding protein IMP3 facilitates tumor immune escape by downregulating the stress-induced ligands ULPB2 and MICB
Article Snippet: .. After 16 hr incubation, medium was removed, and cells were harvested following the manufacturers’ protocol for RNA extraction (Zymo Research, CA, USA). cDNA was prepared using M-MLV reverse transcriptase (Invitrogen, CA, USA) according to manufacturer’s protocol. qRT-PCR was performed as mentioned in the corresponding section. .. For analysis, we defined the level of a specific mRNA in the DMSO-treated control cells (diluent control) in both the scrambled shRNA- and shIMP3-transduced cells as 1.

Spectrophotometry:

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: Total RNA was pretreated with DNase I (Sigma) and quantified by spectrophotometry. .. One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen).

Concentration Assay:

Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
Article Snippet: M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments. .. The copies of each gene of interest were quantitated by extrapolation to standard curves containing from ~101 to ~108 copies of the appropriate RNA standard (prepared as described above) in 100-fold dilutions, where each concentration of RNA standard was performed in triplicate as a singleplex reaction.

CTG Assay:

Article Title: Differentiation-induced Posttranscriptional Control of B7-H1 in Human Trophoblast Cells
Article Snippet: One μg RNA was reverse transcribed using MMLV reverse transcriptase and oligo dT primers (Invitrogen). .. Primers used included B7-H1 (5’-tca atg ccc cat aca aca aa-3’ (Fwd) and 5’-cga agt cat ctg gac aag c-3’ (Rev), and the housekeeping gene β-actin (Applied Biosystems).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher m mlv reverse transcriptase
    M Mlv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1520 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m mlv reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 1520 article reviews
    Price from $9.99 to $1999.99
    m mlv reverse transcriptase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher m mulv reverse transcriptases
    M Mulv Reverse Transcriptases, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m mulv reverse transcriptases/product/Thermo Fisher
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    m mulv reverse transcriptases - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    87
    Thermo Fisher moloney murine leukemia virus m mulv reverse transcriptase kit
    Moloney Murine Leukemia Virus M Mulv Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/moloney murine leukemia virus m mulv reverse transcriptase kit/product/Thermo Fisher
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    moloney murine leukemia virus m mulv reverse transcriptase kit - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    99
    Thermo Fisher m mlv kit
    M Mlv Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m mlv kit/product/Thermo Fisher
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    m mlv kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results