m mlv rt  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    M MLV Reverse Transcriptase 200 U µL
    Description:
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    Catalog Number:
    28025013
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher m mlv rt
    Biochemical identification of a basal L1 RNP complex. A. L1 RNPs contain ORF1p, ORF2p, L1 RNA, and L1 reverse transcriptase activity: RNP pellets were obtained from untransfected HeLa cells, or from HeLa cells transfected with wild-type (pAD2TE1) and reverse transcriptase deficient (pAD135) L1 constructs. As in Figure 2 , tagged ORF1p and ORF2p were detected using anti-T7 (αT7) and anti-TAP (αTAP) respectively. Ribosomal S6 protein was detected using an anti-S6 (αS6) antibody and was used as an RNP loading control. Reverse transcriptase activity was detected using the <t>LEAP</t> assay as described previously [17] . Reactions without template (No Template) or RNPs (No RNP/RNA) were used as negative controls. Top panel: LEAP reactions (LEAP-L1). Middle panel: L1 RT-PCR reactions conducted with <t>M-MLV</t> reverse transcriptase control for the presence of L1 RNA in RNPs (M-MLV-L1). Bottom panel: GAPDH RT-PCR reactions conducted with M-MLV reverse transcriptase assess RNP RNA quality and serve as a RT-PCR internal control (M-MLV-GAPDH). B. Flow chart of the L1 RNP immunoprecipitation reaction: Whole cell extracts were prepared from HeLa cells transfected with either pDK101 or pES2TE1. Immunoprecipitation reactions were conducted by incubating the resultant lysates with agarose beads fused to an anti-FLAG M2 antibody. The elution of ORF2p from the beads was performed by FLAG peptide competition. Western blotting and LEAP assays were performed on aliquots of the whole cell extracts or the elution fractions to detect the L1-encoded proteins and L1-specific reverse transcriptase activity, respectively. C. Co-immunoprecipitation of ORF1p and ORF2p: Whole cell extract (input) and immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells were subjected to western blotting to identify ORF2p (αHA; top panel), ORF1p (αT7 middle panel) or tubulin (αTubulin, bottom panel). The femto ECL substrate (Pierce) was used to detect ORF1p and ORF2p. D. A basal L1 RNP complex contains L1 RNA and retains L1 reverse transcriptase specific activity: LEAP was performed on whole cell extracts (input) or immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells. Reactions conducted without template (No Template) or without RNPs (No RNP) were used as negative controls. As in Figure 2 , colored cartoons of the constructs are indicated in panels A, C and D. Molecular weight/DNA size markers (Invitrogen) are indicated at the left of the images. All constructs contain the mneoI retrotransposition indicator cassette.
    M MLV Reverse Transcriptase is a recombinant DNA polymerase that synthesizes a complementary DNA strand from single stranded RNA DNA or an RNA DNA hybrid Compared to AMV RT Moloney Murine Leukemia Virus Reverse Transcriptase M MLV RT lacks DNA endonuclease activity and has a lower RNase H activity Features of this enzyme • Thermostability optimal activity at 37°C• Size of cDNA M MLV can be used to synthesize first strand cDNA up to 7 kb• Applications synthesis of first strand cDNA primer extension sequencing dsDNA cDNA libraries and RT PCRSourcePurified from E coli expressing the pol gene of M MLV on a plasmidPerformance and quality testingSDS PAGE purity endodeoxyribonuclease exodeoxyribonuclease and ribonuclease assays and yield and length of cDNA productUnit definitionOne unit of M MLV RT is the amount of enzyme required to incorporate 1 nmole of deoxyribonucleotide into acid precipitable material in 10 min at 37°C using poly A oligo dT 25 as template primer Unit reaction conditions50 mM Tris HCl pH 8 3 40 mM KCl 6 mM MgCl2 1 mM DTT 0 5 mM 3H dTTP 0 1 mM poly A 0 1 mM oligo dT 25 0 1 mg mL BSA and enzyme in 50 µL for 10 min at 37°C
    https://www.bioz.com/result/m mlv rt/product/Thermo Fisher
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    m mlv rt - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Characterization of LINE-1 Ribonucleoprotein Particles"

    Article Title: Characterization of LINE-1 Ribonucleoprotein Particles

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1001150

    Biochemical identification of a basal L1 RNP complex. A. L1 RNPs contain ORF1p, ORF2p, L1 RNA, and L1 reverse transcriptase activity: RNP pellets were obtained from untransfected HeLa cells, or from HeLa cells transfected with wild-type (pAD2TE1) and reverse transcriptase deficient (pAD135) L1 constructs. As in Figure 2 , tagged ORF1p and ORF2p were detected using anti-T7 (αT7) and anti-TAP (αTAP) respectively. Ribosomal S6 protein was detected using an anti-S6 (αS6) antibody and was used as an RNP loading control. Reverse transcriptase activity was detected using the LEAP assay as described previously [17] . Reactions without template (No Template) or RNPs (No RNP/RNA) were used as negative controls. Top panel: LEAP reactions (LEAP-L1). Middle panel: L1 RT-PCR reactions conducted with M-MLV reverse transcriptase control for the presence of L1 RNA in RNPs (M-MLV-L1). Bottom panel: GAPDH RT-PCR reactions conducted with M-MLV reverse transcriptase assess RNP RNA quality and serve as a RT-PCR internal control (M-MLV-GAPDH). B. Flow chart of the L1 RNP immunoprecipitation reaction: Whole cell extracts were prepared from HeLa cells transfected with either pDK101 or pES2TE1. Immunoprecipitation reactions were conducted by incubating the resultant lysates with agarose beads fused to an anti-FLAG M2 antibody. The elution of ORF2p from the beads was performed by FLAG peptide competition. Western blotting and LEAP assays were performed on aliquots of the whole cell extracts or the elution fractions to detect the L1-encoded proteins and L1-specific reverse transcriptase activity, respectively. C. Co-immunoprecipitation of ORF1p and ORF2p: Whole cell extract (input) and immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells were subjected to western blotting to identify ORF2p (αHA; top panel), ORF1p (αT7 middle panel) or tubulin (αTubulin, bottom panel). The femto ECL substrate (Pierce) was used to detect ORF1p and ORF2p. D. A basal L1 RNP complex contains L1 RNA and retains L1 reverse transcriptase specific activity: LEAP was performed on whole cell extracts (input) or immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells. Reactions conducted without template (No Template) or without RNPs (No RNP) were used as negative controls. As in Figure 2 , colored cartoons of the constructs are indicated in panels A, C and D. Molecular weight/DNA size markers (Invitrogen) are indicated at the left of the images. All constructs contain the mneoI retrotransposition indicator cassette.
    Figure Legend Snippet: Biochemical identification of a basal L1 RNP complex. A. L1 RNPs contain ORF1p, ORF2p, L1 RNA, and L1 reverse transcriptase activity: RNP pellets were obtained from untransfected HeLa cells, or from HeLa cells transfected with wild-type (pAD2TE1) and reverse transcriptase deficient (pAD135) L1 constructs. As in Figure 2 , tagged ORF1p and ORF2p were detected using anti-T7 (αT7) and anti-TAP (αTAP) respectively. Ribosomal S6 protein was detected using an anti-S6 (αS6) antibody and was used as an RNP loading control. Reverse transcriptase activity was detected using the LEAP assay as described previously [17] . Reactions without template (No Template) or RNPs (No RNP/RNA) were used as negative controls. Top panel: LEAP reactions (LEAP-L1). Middle panel: L1 RT-PCR reactions conducted with M-MLV reverse transcriptase control for the presence of L1 RNA in RNPs (M-MLV-L1). Bottom panel: GAPDH RT-PCR reactions conducted with M-MLV reverse transcriptase assess RNP RNA quality and serve as a RT-PCR internal control (M-MLV-GAPDH). B. Flow chart of the L1 RNP immunoprecipitation reaction: Whole cell extracts were prepared from HeLa cells transfected with either pDK101 or pES2TE1. Immunoprecipitation reactions were conducted by incubating the resultant lysates with agarose beads fused to an anti-FLAG M2 antibody. The elution of ORF2p from the beads was performed by FLAG peptide competition. Western blotting and LEAP assays were performed on aliquots of the whole cell extracts or the elution fractions to detect the L1-encoded proteins and L1-specific reverse transcriptase activity, respectively. C. Co-immunoprecipitation of ORF1p and ORF2p: Whole cell extract (input) and immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells were subjected to western blotting to identify ORF2p (αHA; top panel), ORF1p (αT7 middle panel) or tubulin (αTubulin, bottom panel). The femto ECL substrate (Pierce) was used to detect ORF1p and ORF2p. D. A basal L1 RNP complex contains L1 RNA and retains L1 reverse transcriptase specific activity: LEAP was performed on whole cell extracts (input) or immunoprecipitated (elution) products from pDK101 or pES2TE1 transfected cells. Reactions conducted without template (No Template) or without RNPs (No RNP) were used as negative controls. As in Figure 2 , colored cartoons of the constructs are indicated in panels A, C and D. Molecular weight/DNA size markers (Invitrogen) are indicated at the left of the images. All constructs contain the mneoI retrotransposition indicator cassette.

    Techniques Used: Activity Assay, Transfection, Construct, Reverse Transcription Polymerase Chain Reaction, Flow Cytometry, Immunoprecipitation, Western Blot, Molecular Weight

    TAP tagged ORF2p and RT activity detection in RNP preparation. A. Schematic representation of the amino acid mutation positions in L1 sequence: The names of plasmids containing L1s with mutations in the ORF1p coiled-coil domain (CC-LZ), the ORF1p RNA recognition motif (RRM), and the ORF1p carboxyl-terminal (CTD) domain are indicated below the schematic. The names of plasmids containing mutations in the ORF2p endonuclease domain (EN), reverse transcriptase domain (RT) or cysteine-rich domain (C) also are shown. pADL/R is a double mutant that contains a putative leucine zipper mutation and a carboxyl-terminal domain mutation in ORF1p. pADL/C is a double mutant that contains a putative leucine zipper mutation in ORF1p and a C-domain mutation in ORF2p. The flags indicate the epitope tag present on ORF1 and ORF2. B. Detection of ORF1p and ORF2p from mutant L1 constructs: RNPs from HeLa cells transfected with a RC-L1 (pAD2TE1) or the indicated mutant L1 constructs (see Figure 4A ) were analyzed by western blotting [16] . Tagged L1 proteins were detected as in Figure 3 ; ORF2p (top panel), ORF1p (middle panel). Ribosomal S6 protein detection was used as a loading control (bottom panel). Molecular weight markers (Invitrogen) are indicated at the left of the image. C. L1 RT activity of RNP fractions detected by LEAP: An aliquot from each of the indicated RNP preparations noted above was used to perform LEAP assays (see Figure 3 ) [17] . RNPs from pAD2TE1 served as a positive control. RNPs from untransfected HeLa cells or pAD135 (D 702 A; RT mutant) transfected cells served as negative controls. Reactions without RNPs (No RNP/RNA) or template (No Template) also were used as negative controls. Top panel: LEAP reactions (LEAP-L1). Middle panel: L1 RT-PCR reactions conducted with M-MLV reverse transcriptase control for the presence of L1 RNA in the RNP fractions (M-MLV-L1). Bottom panel: GAPDH RT-PCR reactions conducted with M-MLV reverse transcriptase assess RNP RNA quality and serve as a RT-PCR internal control (M-MLV-GAPDH). DNA size markers (Invitrogen) are indicated at the left of the image. All constructs in panel B and C contain the mneoI retrotransposition indicator cassette.
    Figure Legend Snippet: TAP tagged ORF2p and RT activity detection in RNP preparation. A. Schematic representation of the amino acid mutation positions in L1 sequence: The names of plasmids containing L1s with mutations in the ORF1p coiled-coil domain (CC-LZ), the ORF1p RNA recognition motif (RRM), and the ORF1p carboxyl-terminal (CTD) domain are indicated below the schematic. The names of plasmids containing mutations in the ORF2p endonuclease domain (EN), reverse transcriptase domain (RT) or cysteine-rich domain (C) also are shown. pADL/R is a double mutant that contains a putative leucine zipper mutation and a carboxyl-terminal domain mutation in ORF1p. pADL/C is a double mutant that contains a putative leucine zipper mutation in ORF1p and a C-domain mutation in ORF2p. The flags indicate the epitope tag present on ORF1 and ORF2. B. Detection of ORF1p and ORF2p from mutant L1 constructs: RNPs from HeLa cells transfected with a RC-L1 (pAD2TE1) or the indicated mutant L1 constructs (see Figure 4A ) were analyzed by western blotting [16] . Tagged L1 proteins were detected as in Figure 3 ; ORF2p (top panel), ORF1p (middle panel). Ribosomal S6 protein detection was used as a loading control (bottom panel). Molecular weight markers (Invitrogen) are indicated at the left of the image. C. L1 RT activity of RNP fractions detected by LEAP: An aliquot from each of the indicated RNP preparations noted above was used to perform LEAP assays (see Figure 3 ) [17] . RNPs from pAD2TE1 served as a positive control. RNPs from untransfected HeLa cells or pAD135 (D 702 A; RT mutant) transfected cells served as negative controls. Reactions without RNPs (No RNP/RNA) or template (No Template) also were used as negative controls. Top panel: LEAP reactions (LEAP-L1). Middle panel: L1 RT-PCR reactions conducted with M-MLV reverse transcriptase control for the presence of L1 RNA in the RNP fractions (M-MLV-L1). Bottom panel: GAPDH RT-PCR reactions conducted with M-MLV reverse transcriptase assess RNP RNA quality and serve as a RT-PCR internal control (M-MLV-GAPDH). DNA size markers (Invitrogen) are indicated at the left of the image. All constructs in panel B and C contain the mneoI retrotransposition indicator cassette.

    Techniques Used: Activity Assay, Mutagenesis, Sequencing, Construct, Transfection, Western Blot, Molecular Weight, Positive Control, Reverse Transcription Polymerase Chain Reaction

    2) Product Images from "The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging"

    Article Title: The pp24 phosphoprotein of Mason-Pfizer monkey virus contributes to viral genome packaging

    Journal: Retrovirology

    doi: 10.1186/1742-4690-2-68

    RT-PCR analysis of genome packaging in wild-type M-PMV and ΔKKPKR virions. Purified RNA from equivalent amounts of virus was diluted 1:1,000 (lane 3) followed by 2-fold serial dilutions to 1:96,000 (lane 9). First-strand cDNA synthesis was carried out using M-MLV RT and followed by PCR using oligos that amplify M-PMV CA sequences. Relative viral RNA packaging efficiencies were estimated by determining the end-point dilution in which viral PCR products could be detected by Ethidium bromide staining. U, untransfected (lane 1); C, RNA control – no reverse transcriptase added to RT-PCR reaction (lane 2).
    Figure Legend Snippet: RT-PCR analysis of genome packaging in wild-type M-PMV and ΔKKPKR virions. Purified RNA from equivalent amounts of virus was diluted 1:1,000 (lane 3) followed by 2-fold serial dilutions to 1:96,000 (lane 9). First-strand cDNA synthesis was carried out using M-MLV RT and followed by PCR using oligos that amplify M-PMV CA sequences. Relative viral RNA packaging efficiencies were estimated by determining the end-point dilution in which viral PCR products could be detected by Ethidium bromide staining. U, untransfected (lane 1); C, RNA control – no reverse transcriptase added to RT-PCR reaction (lane 2).

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, Polymerase Chain Reaction, Staining

    3) Product Images from "Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †"

    Article Title: Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription †

    Journal: Journal of Virology

    doi:

    Analysis of genomic RNA packaging. (A) Supernatants containing wild-type virus (lanes 10 to 12), Δ tat virus (lanes 1 to 3), or Δ tat virus complemented with wild-type tat (lanes 7 to 9) or [E2G, D5G, E9G] (lanes 4 to 6) or mock complemented (lanes 13 to 16) were pelleted through 20% sucrose and suspended in PBS-BSA buffer. An IC RNA was added to purified virus that contained 100 ng of p24 Ag, and both RNAs were copurified. cDNA reactions were performed in either the presence or absence of M-MLV with a first-strand primer that annealed to sequences located downstream from the Gag initiating methionine shown in panel C. The cDNA was serially diluted in fivefold increments and assayed by PCR for HIV-1 DNA with primers indicated in panel C. PCRs were performed on HIV-1 DNA present at 0, 10 1 , 10 2 , 10 3 , and 10 4 copies (lanes 16 to 20). (B) The RNA recovery and cDNA synthesis were similar for each cDNA reaction corresponding to Δ tat (lanes 1 and 2), Δ tat plus [E2G, D5G, E9G] (lanes 3 and 4), Δ tat plus wild-type tat (lanes 5 and 6), wild-type virus (lanes 7 and 8), and mock virus (lanes 9 and 10). IC RNA was reverse transcribed in either the presence (lanes 1, 3, 5, 7, and 9) or absence (lanes 2, 4, 6, 8, and 10) of M-MLV and detected by PCR with the primers shown in panel C (dotted lines). IC plasmid DNA standards present at 20, 100, 300, and 1,000 copies are shown (lanes 11 to 14). (C) Model showing HIV-1 RNA and IC RNA. An internal deletion from +80 to +151 in IC RNA allows detection of IC cDNA from HIV-1 cDNA by PCR with the indicated primers. Solid arrow, first-strand cDNA primer; dotted arrows, PCR primers; dotted line, pGem4Z RNA; solid line, HIV-1 RNA.
    Figure Legend Snippet: Analysis of genomic RNA packaging. (A) Supernatants containing wild-type virus (lanes 10 to 12), Δ tat virus (lanes 1 to 3), or Δ tat virus complemented with wild-type tat (lanes 7 to 9) or [E2G, D5G, E9G] (lanes 4 to 6) or mock complemented (lanes 13 to 16) were pelleted through 20% sucrose and suspended in PBS-BSA buffer. An IC RNA was added to purified virus that contained 100 ng of p24 Ag, and both RNAs were copurified. cDNA reactions were performed in either the presence or absence of M-MLV with a first-strand primer that annealed to sequences located downstream from the Gag initiating methionine shown in panel C. The cDNA was serially diluted in fivefold increments and assayed by PCR for HIV-1 DNA with primers indicated in panel C. PCRs were performed on HIV-1 DNA present at 0, 10 1 , 10 2 , 10 3 , and 10 4 copies (lanes 16 to 20). (B) The RNA recovery and cDNA synthesis were similar for each cDNA reaction corresponding to Δ tat (lanes 1 and 2), Δ tat plus [E2G, D5G, E9G] (lanes 3 and 4), Δ tat plus wild-type tat (lanes 5 and 6), wild-type virus (lanes 7 and 8), and mock virus (lanes 9 and 10). IC RNA was reverse transcribed in either the presence (lanes 1, 3, 5, 7, and 9) or absence (lanes 2, 4, 6, 8, and 10) of M-MLV and detected by PCR with the primers shown in panel C (dotted lines). IC plasmid DNA standards present at 20, 100, 300, and 1,000 copies are shown (lanes 11 to 14). (C) Model showing HIV-1 RNA and IC RNA. An internal deletion from +80 to +151 in IC RNA allows detection of IC cDNA from HIV-1 cDNA by PCR with the indicated primers. Solid arrow, first-strand cDNA primer; dotted arrows, PCR primers; dotted line, pGem4Z RNA; solid line, HIV-1 RNA.

    Techniques Used: Purification, Polymerase Chain Reaction, Plasmid Preparation

    RT-PCR analysis of wild-type and mutant tat genes. Total RNA was obtained from uninfected 293 cells (lanes 1), 293 cells stably transfected with HIV-1 wild-type (lanes 2) or HIV-1 Δ tat (lanes 3), and 293 cells containing both HIV-1 Δ tat and wild type tat (lanes 4) or the mutated tat genes corresponding to [E2G, D5G, E9G], P3L, P[6, 10]L, P[10, 14]L, C27S, K41A, and K/R[50-57]G (lanes 5 to 11, respectively). Primers specific for plasmid-derived tat mRNA or cellular β-actin mRNA were annealed to RNA obtained from each of the 293 cell lines, and a reverse transcription reaction was performed in the presence (A and B) or absence (C and D) of M-MLV RT. PCR was performed on each cDNA reaction mixture to detect either the tat (A and C) or β-actin (B and D) gene. PCR products were resolved on a 1.5% agarose gel. Molecular mass markers are shown for each gel (lanes M). PCRs with a plasmid containing the tat gene (panel A, lanes 12 and 13) (equivalent to 0.1 and 0.5 pg) or serially diluted β-globin cDNA (panel B, lanes 12 and 13) are shown.
    Figure Legend Snippet: RT-PCR analysis of wild-type and mutant tat genes. Total RNA was obtained from uninfected 293 cells (lanes 1), 293 cells stably transfected with HIV-1 wild-type (lanes 2) or HIV-1 Δ tat (lanes 3), and 293 cells containing both HIV-1 Δ tat and wild type tat (lanes 4) or the mutated tat genes corresponding to [E2G, D5G, E9G], P3L, P[6, 10]L, P[10, 14]L, C27S, K41A, and K/R[50-57]G (lanes 5 to 11, respectively). Primers specific for plasmid-derived tat mRNA or cellular β-actin mRNA were annealed to RNA obtained from each of the 293 cell lines, and a reverse transcription reaction was performed in the presence (A and B) or absence (C and D) of M-MLV RT. PCR was performed on each cDNA reaction mixture to detect either the tat (A and C) or β-actin (B and D) gene. PCR products were resolved on a 1.5% agarose gel. Molecular mass markers are shown for each gel (lanes M). PCRs with a plasmid containing the tat gene (panel A, lanes 12 and 13) (equivalent to 0.1 and 0.5 pg) or serially diluted β-globin cDNA (panel B, lanes 12 and 13) are shown.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Stable Transfection, Transfection, Plasmid Preparation, Derivative Assay, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Synthesized:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Isolation:

    Article Title: Both U2 snRNA and U12 snRNA are required for accurate splicing of exon 5 of the rat calcitonin/CGRP gene
    Article Snippet: .. Total RNA was isolated using Trizol (Invitrogen) and analyzed for splice products using reverse transcriptase–PCR. cDNAs were transcribed from RNA by Thermoscript reverse transcriptase (Invitrogen) using random hexamers as primers. .. PCR reactions were performed using 30 amplification cycles, the PCR products were extracted, separated by electrophoresis on 1.5% agarose gels, and visualized by ethidium bromide staining and under UV light.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Digital PCR:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Polymerase Chain Reaction:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Article Title: Transcriptional corepressor SHP recruits SIRT1 histone deacetylase to inhibit LRH-1 transactivation
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of CYP7A1 and SHP were analyzed by reverse transcriptase PCR (RT–PCR) or quantitative real-time PCR (qPCR) as indicated.

    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.

    Article Title: Nucleocytosolic Depletion of the Energy Metabolite Acetyl-Coenzyme A Stimulates Autophagy and Prolongs Lifespan
    Article Snippet: .. Quantitative Reverse-Transcriptase PCR Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method with 18S rRNA as an internal standard was performed on an ABI StepOnePlus using SYBR Select Master Mix (Life Tech, Invitrogen) ΔΔCt-method. .. Drosophila Lifespan Analyses and Brain Immunofluorescence UAS-RNAi lines for acetyl-CoA Synthetase (P{TRiP.HMS02314}attP2) and EGFP (P{VALIUM20-EGFP.shRNA.1}attP2) serving as a background-matched control were obtained from Bloomington Drosophila Stock Center.

    Article Title: Orphan Nuclear Receptor Err? Induces C-Reactive Protein Gene Expression through Induction of ER-Bound Bzip Transmembrane Transcription Factor CREBH
    Article Snippet: .. Reverse Transcriptase PCR and Quantitative Real-time PCR Analyses Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ERRγ, CREBH, CRP, and PGC1α were analyzed by reverse transcription PCR (RT–PCR) or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Transcriptional cross talk between orphan nuclear receptor ERR? and transmembrane transcription factor ATF6? coordinates endoplasmic reticulum stress response
    Article Snippet: .. Reverse transcriptase PCR and quantitative real-time PCR analysis Total RNA was isolated using the TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The mRNAs of ATF6α and PGC1α were analyzed by RT-PCR or quantitative real-time RT-PCR (qPCR) as indicated.

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Incubation:

    Article Title: Double strand RNA delivery system for plant-sap-feeding insects
    Article Snippet: .. Reverse transcriptase PCR was used to generate cDNA, 200 ng of total RNA was incubated with a 0.5 mM deoxynucleoside triphosphate mixture, 0.65 μM each oligo(dT)16 (Life Technologies), and random hexamers (Life Technologies) at 65°C for 5 min. A cDNA synthesis mixture containing 10 mM dithiothreitol (DTT), 100 units of Superscript Reverse Transcriptase III (Life Technologies), and 2 units of SUPERase™ In RNase inhibitor (Life Technologies) was then added to the total RNA mixture, which was incubated at 25°C for 5 min, 50°C for 50 min. .. The reaction was terminated by incubation at 70°C for 15 min and the resulting cDNA was stored at -20°C.

    Sequencing:

    Article Title: Expression and activity of eIF6 trigger Malignant Pleural Mesothelioma growth in vivo
    Article Snippet: .. Target mRNA quantification by quantitative reverse-transcriptase PCR using ΔΔCt-method using Taqman Universal PCR Master Mix (4304437; Life Technologies) was performed on an ABIPRISM 7900HT Sequence Detection System (Applied Biosystems). .. Cell proliferation, cell cycle and cell death analysis Proliferation rate of MPM cells was analysed by MTT test: briefly, cells were plated in 96 wells plates at different concentrations, and assayed after 24, 48 and 72 hours.

    Software:

    Article Title: Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant
    Article Snippet: .. cDNA was synthesized as described in “Reverse transcriptase PCR and quantitative real-time PCR.” Absolute quantification was performed using a QuantStudio 3D digital PCR system (Thermo Fisher Scientific) and analyzed with QuantStudio 3D AnalysisSuite cloud software (Thermo Fisher Scientific). .. The sequences of primers and probes were as follows: p62 full-length Left, CCCACAGGGCTGAAGGAA; p62 full-length Right, CATCTGGGAGAGGGACTCAATC; p62 full-length Probe, CCCACCAGAGGCTGA; p62 variant Left, CGATGACTGGACACATTTGTCTTC; p62 variant Right, TCTGGGAGAGGGACTCAATCA; and p62 full-length Probe, CCATCACAGAGGCTG.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher m mlv rt reagent kit
    M Mlv Rt Reagent Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 70 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m mlv rt reagent kit/product/Thermo Fisher
    Average 99 stars, based on 70 article reviews
    Price from $9.99 to $1999.99
    m mlv rt reagent kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    91
    Thermo Fisher m mlv rtase
    M Mlv Rtase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/m mlv rtase/product/Thermo Fisher
    Average 91 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    m mlv rtase - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    Image Search Results