long range pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher long range pcr kit
    Long Range Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr kit/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2020-09
    90/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Helicase-like transcription factor (Hltf) gene-deletion promotes oxidative phosphorylation (OXPHOS) in colorectal tumors of AOM/DSS-treated mice
    Article Snippet: .. Applied Biosystems TaqMan® MGB (minor groove binder) probes with a 5´ reporter (FAM or VIC) and a 3´ nonfluorescent quencher (MGB-NFQ), Invitrogen™ TRIzol™ Reagent (15596026), Invitrogen SuperScript™ Vilo™ cDNA Synthesis Kit (11754050), and SequalPrep™ Long PCR Kit with dNTPs (A10498) were purchased from ThermoFisher Scientific (Waltham, MA). .. Midland Certified Reagent Company (Midland, TX) synthesized the PCR primers.

    Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation
    Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the SequalPrep™ Long PCR Kit (Invitrogen). .. In addition, long-range PCR was performed to generate CYP2B6 and CYP2B7P1 gene fusion-specific amplicons of 18 kb and 11 kb spanning exons 1–5 and exons 4–9, respectively, which were used as templates for exon and exon-intron junction sequencing using primers listed in .

    Article Title: OCA2 splice site variant in German Spitz dogs with oculocutaneous albinism
    Article Snippet: .. Long-range PCR A long-range PCR to was performed using the primer pair GGCAAACTTGGGAGTGGTAA (Chr3:31,659,781–31,659,762) and CCCCCTCAAATAAACCATGA (Chr3:32,346,375–32,346,356) and the SequalPrep™ Long PCR kit (Invitrogen). .. The PCR fragments were analyzed using FragmentAnalyzer™ (Advanced Analytical).

    Article Title: An Application of NGS for WDR36 Gene in Taiwanese Patients with Juvenile-Onset Open-Angle Glaucoma
    Article Snippet: .. Cycling profile of long range PCR was conducted as follows: one cycle at 94℃ for 2 min, followed by 10 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min, followed by 30 cycles at 94℃ for 10 s, at 55℃ for 30 s, and at 68℃ for 14 min (+20 s every cycle), followed by a final extension step at 72℃ for 5 min, according to SequalPrepTM Long PCR Kit protocol (Invitrogen, USA). .. According to the manufacturer's instructions, PCR products were cleaned up using AMPure Reagent beads (Agencourt, Beverly, MA).

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Article Title: Hybridization capture of larch (Larix Mill) chloroplast genomes from sedimentary ancient DNA reveals past changes of Siberian forests
    Article Snippet: .. PCR amplification was conducted using the SequalPrep™ Long PCR Kit (Invitrogen), according to the manufacturer’s cycling protocol instructions, and with specific annealing temperatures for each primer pair (see , Table S2). .. The PCR products were pooled in equimolar ratios in a volume of 130 µL and sonicated using a Covaris M220 Focused-ultrasonicator (Covaris, Woburn, MA) to a target peak of 350 bp with settings of peak incident power 50 W, duty factor 20%, cycles per burst 200, treatment time 70 seconds.

    Article Title: Large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in Vietnam
    Article Snippet: .. A SequalPrep long PCR kit (Life Technology) was used according to the manufacturer's instruction instead of GoTaq DNA polymerase to amplify fragments > 2 kb. .. Sequences were imported into sse ( ) for alignment and calculation of sequence divergence values from reference sequences of known EV types.

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Sequencing:

    Article Title: Multi-ethnic Cytochrome-P450 Copy Number Profiling: Novel Pharmacogenetic Alleles and Mechanism of Copy Number Variation Formation
    Article Snippet: .. CYP2B6 and CYP2E1 Sequence Analyses The breakpoint regions (~3 kb) of the CYP2B6 /2B7P1 fusion alleles (CYP2B6*29 and *30 ) were assessed by breakpoint-spanning PCR using overlapping primers ( ) and the SequalPrep™ Long PCR Kit (Invitrogen). .. In addition, long-range PCR was performed to generate CYP2B6 and CYP2B7P1 gene fusion-specific amplicons of 18 kb and 11 kb spanning exons 1–5 and exons 4–9, respectively, which were used as templates for exon and exon-intron junction sequencing using primers listed in .

    Amplification:

    Article Title: Hybridization capture of larch (Larix Mill) chloroplast genomes from sedimentary ancient DNA reveals past changes of Siberian forests
    Article Snippet: .. PCR amplification was conducted using the SequalPrep™ Long PCR Kit (Invitrogen), according to the manufacturer’s cycling protocol instructions, and with specific annealing temperatures for each primer pair (see , Table S2). .. The PCR products were pooled in equimolar ratios in a volume of 130 µL and sonicated using a Covaris M220 Focused-ultrasonicator (Covaris, Woburn, MA) to a target peak of 350 bp with settings of peak incident power 50 W, duty factor 20%, cycles per burst 200, treatment time 70 seconds.

    Article Title: A higher throughput assay for quantification of melphalan-induced DNA damage in peripheral blood mononuclear cells
    Article Snippet: .. LA Taq DNA Polymerase (TaKaRa, Japan), Ex Taq Hot Start Version Kit (TaKaRa, Japan), and SequalPrep Long PCR Kit (Life Technologies, USA) failed to generate major products specific for the 6.8 kb target amplicon. .. This may be due to predicted G-quadruplex structures adjacent to the annealing site of the sense primer , ; G-quadruplexes can affect the proof-reading fidelity of long-range PCR DNA polymerases .

    Size-exclusion Chromatography:

    Article Title: Conditional Disruption of Hepatic Carbamoyl Phosphate Synthetase 1 in Mice Results in Hyperammonemia without Orotic Aciduria and Can be Corrected by Liver-Directed Gene Therapy
    Article Snippet: .. Approximately 50ng of DNA was tested by long range PCR across the 5′ arm as well as the 3′ distal loxP using Invitrogen SequalPrep long PCR Kit following manufacturer’s protocol with the following thermal cycling: 94°C for 2min; 10 cycles of 94°C for 15 sec, 65°C for 15 sec (↓1C/cycle), 68°C for 10 min; 25 cycles of 94°C for 15 sec, 55°C for 30 sec, 68°C for 10 min (+20 sec/cycle), hold at 4°C. .. 5′ long range PCR included a genomic forward primer TTTCAGCTTTTAAGGGACTAGCGTGC paired with a cassette reverse primer GGTGGTGTGGGAAAGGGTTCGAAG for an expected 6,007bp targeted band.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher extensor long range pcr polymerase blend kits and master mixes
    Extensor Long Range Pcr Polymerase Blend Kits And Master Mixes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/extensor long range pcr polymerase blend kits and master mixes/product/Thermo Fisher
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    extensor long range pcr polymerase blend kits and master mixes - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    88
    Thermo Fisher hi fidelity extensor long range pcr enzyme kit
    Hi Fidelity Extensor Long Range Pcr Enzyme Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi fidelity extensor long range pcr enzyme kit/product/Thermo Fisher
    Average 88 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    hi fidelity extensor long range pcr enzyme kit - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    89
    Thermo Fisher long range pcr kit
    Long Range Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/long range pcr kit/product/Thermo Fisher
    Average 89 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    long range pcr kit - by Bioz Stars, 2020-09
    89/100 stars
      Buy from Supplier

    Image Search Results