la taq tm kit  (TaKaRa)

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa LA Taq DNA Polymerase
    TaKaRa LA Taq DNA Polymerase combines Taq DNA polymerase and a DNA proofreading polymerase with 3 →5 exonuclease activity to enable PCR amplification of very long DNA templates long range PCR This mixture of enzymes allows for long and accurate LA PCR of targets from a variety of templates including genomic DNA LA Taq DNA polymerase is supplied with optimized LA PCR Buffer II with or without Mg2 and dNTPs
    Catalog Number:
    125 Units
    LA Taq DNA polymerase LA Taq products Long range PCR PCR
    Buy from Supplier

    Structured Review

    TaKaRa la taq tm kit
    TaKaRa LA Taq DNA Polymerase combines Taq DNA polymerase and a DNA proofreading polymerase with 3 →5 exonuclease activity to enable PCR amplification of very long DNA templates long range PCR This mixture of enzymes allows for long and accurate LA PCR of targets from a variety of templates including genomic DNA LA Taq DNA polymerase is supplied with optimized LA PCR Buffer II with or without Mg2 and dNTPs taq tm kit/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq tm kit - by Bioz Stars, 2020-02
    90/100 stars

    Related Products / Commonly Used Together

    breakpoint junctions
    long-range pcr


    Related Articles

    Clone Assay:

    Article Title: Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)
    Article Snippet: In order to detect potential polymorphic sites, the PCR products were sequenced both directly and after cloning. .. These primer sets were paired with one another or with DinoSL/Racer3 in the PCR using TAKARA-LA Taq Polymerase.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The pCDNA3.1 directional TOPO vector (45-0158; Invitrogen, Carlsbad, CA) was double digested with Bam HI and Xho I to create cohesive sticky ends and to allow insertion of the fusion products into the vector multiple cloning site, followed by gel purification.

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: Following G418 selection, clones that contained the knock-in were identified by long-range genomic PCR as previously described . .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: An additional IA-2ec (amino acids 26–577) was generated using standard cloning procedures as mentioned above. .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described.


    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M). .. Two correctly targeted ES cell clones were expanded and injected into C57BL/6J blastocysts to generate chimeric mice.

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) was used to amplify the neomycin cassette excised locus with the primer pair NOW1-K2 5′-TGAGTTGACTCCACAGGGAGGTGAGC-3′ and NOW1-H2 5′-CCATCTCGCCAGCCCGTAAGATTC-3′ flanking this site. .. The wild-type (WT) allele is predicted to yield an amplification product of 793 bp and the knock-in (CAG42) allele one of 984 bp, while heterozygous (CAG1/CAG42) mice show products of both sizes ( ).

    Article Title: Copy number gain at Xp22.31 includes complex duplication rearrangements and recurrent triplications
    Article Snippet: Breakpoint junctions of nonrecurrent rearrangements were obtained by long-range PCR with the TAKARA LA Taq TM kit (RR002M for regular buffer or RR02AG for GC buffer I) (TAKARA Bio Inc.) as previously described ( ). .. A two-step mismatch PCR strategy was employed to ensure the specificity and efficiency of amplification ( ).

    Article Title: Mapping the Human miRNA Interactome by CLASH Reveals Frequent Noncanonical Binding
    Article Snippet: .. RNA was then degraded by addition of 2 μl RNase H (New England Biolabs) for 30 min at 37°C. cDNA was amplified using primers P5 and primer PE_miRCat_PCR ( ) and TaKaRa LA Taq polymerase (Takara Bio, RR002M). .. Library Size Selection PCR products were separated on a 3% MetaPhor agarose (Lonza)/TBE gel with SYBRSafe (Life Technologies).

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: .. The CAG repeat was amplified with TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) from DNA from tail biopsies using a 5′-FAM-labeled forward primer 5′-CCCCGCCCGGCGTGCGAGCCGGTGTAT-3′ and the reverse primer 5′-CGGGCTTGCGGCCAGTGG-3′ under the following conditions: 96°C-4′, followed by 38 cycles of 94°C-1′, 60°C-1′ and 72°C-1′ with a final elongation step at 72°C-7′. ..

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described. .. The PCR fragment was double digested and ligated into the pCDNA3.1 directional TOPO vector (45-0158; Invitrogen) using Xba I and Xho I.

    DNA Ligation:

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: · Agencourt RNAClean XP Kit (BECKMAN COULTER, cat. no. , 40 ml) · Agencourt AMPure XP Kit (BECKMAN COULTER, cat. no. , 60 ml) · RNase ONE Ribonuclease (Promega, cat. no. M4261, 1000 U) · MPG Streptavidin (TAKARA, cat. no. 6124A, 2 ml) · Quant-iT™ OliGreen® ssDNA Reagent and Kit (Invitrogen, cat. no. ) · SYBR Premix Ex Taq (TAKARA, cat. no. RR041A) · Agilent RNA Pico kit (Agilent, cat. no. 5067-1513) · Agilent DNA1000 kit (Agilent, cat. no. 5067-1504) · DNA Ligation Kit < Mighty Mix > (TAKARA, cat. no. 6023, 1 kit) ▲CRITICAL This kit contains polyethylene glycol, which increases ligation efficiency. .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles.

    Polymerase Chain Reaction:

    Article Title: Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)
    Article Snippet: .. These primer sets were paired with one another or with DinoSL/Racer3 in the PCR using TAKARA-LA Taq Polymerase. .. In order to enhance the chance of success in amplifying long transcripts that contained multiple CUs, long elongation time (8 min) was used in PCR as reported .

    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: .. TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP. .. Mutation positions were identified using Big Dye (Applied Biosystems) terminator cycle sequencing.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The fragments were next gel purified using a QIAquick gel extraction kit (28704; QIAGEN, Valencia, CA) as described.

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M). .. Two correctly targeted ES cell clones were expanded and injected into C57BL/6J blastocysts to generate chimeric mice.

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: Genotyping of the Atxn2 -CAG42-Knock-In Mouse DNA from tail biopsies was isolated and the genotyping PCR was performed. .. TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) was used to amplify the neomycin cassette excised locus with the primer pair NOW1-K2 5′-TGAGTTGACTCCACAGGGAGGTGAGC-3′ and NOW1-H2 5′-CCATCTCGCCAGCCCGTAAGATTC-3′ flanking this site.

    Article Title: Copy number gain at Xp22.31 includes complex duplication rearrangements and recurrent triplications
    Article Snippet: .. Breakpoint junctions of nonrecurrent rearrangements were obtained by long-range PCR with the TAKARA LA Taq TM kit (RR002M for regular buffer or RR02AG for GC buffer I) (TAKARA Bio Inc.) as previously described ( ). ..

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: Restriction enzyme-digested PCR products were self-ligated in reaction conditions favoring intramolecular ligation ( ). .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl.

    Article Title: Mapping the Human miRNA Interactome by CLASH Reveals Frequent Noncanonical Binding
    Article Snippet: Paragraph title: Reverse Transcription and Library Amplification by PCR ... RNA was then degraded by addition of 2 μl RNase H (New England Biolabs) for 30 min at 37°C. cDNA was amplified using primers P5 and primer PE_miRCat_PCR ( ) and TaKaRa LA Taq polymerase (Takara Bio, RR002M).

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution. .. Then, 0.5 μl of the first PCR product was used as template in a nested PCR with internal primer pair sets (M273/M879) using TaKaRa Taq (#R001A; TaKaRa) with 2 × GC buffer I (#9154; TaKaRa) in a total of 10 μl solution.

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: The CAG repeat was amplified with TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) from DNA from tail biopsies using a 5′-FAM-labeled forward primer 5′-CCCCGCCCGGCGTGCGAGCCGGTGTAT-3′ and the reverse primer 5′-CGGGCTTGCGGCCAGTGG-3′ under the following conditions: 96°C-4′, followed by 38 cycles of 94°C-1′, 60°C-1′ and 72°C-1′ with a final elongation step at 72°C-7′. .. Peak Scanner Software 1.0 (Applied Biosystems) was used to determine the exact PCR product size using the GS500 size standard.

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles. .. · Exonuclease I (E. coli ) (NEB, cat. no. M0293S, 3000 U) · MinElute PCR Purification Kit (QIAGEN, cat. no. 28004, 50 columns) · QIAquick Gel Extraction Kit (QIAGEN, cat. no.28704, 50 columns) · Ethanol (99.5) (WAKO, 057-00456, 500 ml) !CAUTION Flammable.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Briefly, the extracellular domain was generated via PCR using the following primer set: forward primer, which contains an Xba I digestion site: CTTAGTCTCTAGACACCATGAGCAGCCGCCCGGGGGGCTGCAGCGCCGTTAGTGCCCACG and reverse primer, which contains an Xho I digestion site: GACTAAGCTCGAGTCACACTGAGCGCATGGGTGAGGTGCTGTGCGCAGTTTGGGGAAGG. .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described.

    Article Title: Germline PRKACA amplification causes variable phenotypes that may depend on the extent of the genomic defect: molecular mechanisms and clinical presentations
    Article Snippet: .. TaKaRa LA Taq (Clontech, #RR002A) was used for the PCR amplifications. .. Sanger sequencing was performed for the PCR products, and the DNA sequences were compared to the reference genome (hg19) in order to precisely map the breakpoint junctions.


    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Paragraph title: Generation of IA-2 fusion construct ... Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described. .. The PCR fragment was double digested and ligated into the pCDNA3.1 directional TOPO vector (45-0158; Invitrogen) using Xba I and Xho I.


    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).


    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The fragments were next gel purified using a QIAquick gel extraction kit (28704; QIAGEN, Valencia, CA) as described.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described. .. The PCR fragment was double digested and ligated into the pCDNA3.1 directional TOPO vector (45-0158; Invitrogen) using Xba I and Xho I.

    Activity Assay:

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: If other enzymes have to be used, select RT devoid of RNAseH activity. .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles.


    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: Following G418 selection, clones that contained the knock-in were identified by long-range genomic PCR as previously described . .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) was used to amplify the neomycin cassette excised locus with the primer pair NOW1-K2 5′-TGAGTTGACTCCACAGGGAGGTGAGC-3′ and NOW1-H2 5′-CCATCTCGCCAGCCCGTAAGATTC-3′ flanking this site. .. The wild-type (WT) allele is predicted to yield an amplification product of 793 bp and the knock-in (CAG42) allele one of 984 bp, while heterozygous (CAG1/CAG42) mice show products of both sizes ( ).

    Derivative Assay:

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Gel Purification:

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. Fragments were next double digested with the following restriction nucleotides to create cohesive sticky ends: fragment 1 with Bam HI (R-0136S; New England BioLabs, Ispwich, MA) and Ear I (R-0528S; New England BioLabs) and fragment 2 with Xho I (R-0146S; New England BioLabs) and EarI , followed by gel purification.

    Inverse PCR:

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: Similarly, the second round of inverse PCR used primers INP-NS-F2 (5′-CTCAGGGCTCCACATACATGG-3′) and INP-VP-R2 (5′-CCTGGTCCCAGGTACTTGTAGCC-3′). .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl.


    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: Restriction enzyme-digested PCR products were self-ligated in reaction conditions favoring intramolecular ligation ( ). .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl.

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: · Agencourt RNAClean XP Kit (BECKMAN COULTER, cat. no. , 40 ml) · Agencourt AMPure XP Kit (BECKMAN COULTER, cat. no. , 60 ml) · RNase ONE Ribonuclease (Promega, cat. no. M4261, 1000 U) · MPG Streptavidin (TAKARA, cat. no. 6124A, 2 ml) · Quant-iT™ OliGreen® ssDNA Reagent and Kit (Invitrogen, cat. no. ) · SYBR Premix Ex Taq (TAKARA, cat. no. RR041A) · Agilent RNA Pico kit (Agilent, cat. no. 5067-1513) · Agilent DNA1000 kit (Agilent, cat. no. 5067-1504) · DNA Ligation Kit < Mighty Mix > (TAKARA, cat. no. 6023, 1 kit) ▲CRITICAL This kit contains polyethylene glycol, which increases ligation efficiency. .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles.


    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: Strain 4932 was generated and identified as described in the work of Fong et al. with the following changes: Genomic DNA from a cdc13hph tagged strain was used as the starting template. .. TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: .. Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The fragments were next gel purified using a QIAquick gel extraction kit (28704; QIAGEN, Valencia, CA) as described.

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: The primer sets were designed to amplify the junctional region generated by recombination. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Briefly, the extracellular domain was generated via PCR using the following primer set: forward primer, which contains an Xba I digestion site: CTTAGTCTCTAGACACCATGAGCAGCCGCCCGGGGGGCTGCAGCGCCGTTAGTGCCCACG and reverse primer, which contains an Xho I digestion site: GACTAAGCTCGAGTCACACTGAGCGCATGGGTGAGGTGCTGTGCGCAGTTTGGGGAAGG. .. The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described.

    DNA Sequencing:

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Transmission Assay:

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M). .. Germline transmission was verified by PCR as previously described .


    Article Title: Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)
    Article Snippet: Primer set Rbc5H-Rbc3H was used in PCR to obtain the CU spacer sequence. .. These primer sets were paired with one another or with DinoSL/Racer3 in the PCR using TAKARA-LA Taq Polymerase.

    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP. .. Mutation positions were identified using Big Dye (Applied Biosystems) terminator cycle sequencing.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: The N-terminal fragment or fragment 1 was generated using the following primers: forward primer Fragment 1 (Frg1f) consisting of extra base pairs followed by a Bam HI restriction site and the IA-2 complimentary sequence, Frg1f, CTTAGTCGGATCCCACCATGAGCAGCCGCCCGGGGGGCTG and reverse primer Fragment 1 (Frg1r), an IA-2 complementary sequence that contains an Ear I site, Frg1r, CTTGGAG-GCAGTTCTGC-TGAAGAGGGCAGG. .. Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described. .. Plasmids containing proper insert size were then sequence verified at the University of Michigan Sequencing Core using overlapping primer sets.

    Article Title: Germline PRKACA amplification causes variable phenotypes that may depend on the extent of the genomic defect: molecular mechanisms and clinical presentations
    Article Snippet: TaKaRa LA Taq (Clontech, #RR002A) was used for the PCR amplifications. .. Sanger sequencing was performed for the PCR products, and the DNA sequences were compared to the reference genome (hg19) in order to precisely map the breakpoint junctions.


    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M). .. Two correctly targeted ES cell clones were expanded and injected into C57BL/6J blastocysts to generate chimeric mice.

    DNA Extraction:

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: For detection of targeted insertion of transgene at blastocysts, genomic DNA from a single blastocyst was isolated using the PicoPure DNA extraction kit (#KIT0103; Arcturus, Mountain View, CA) according to manufacturer’s instructions with the exception that an embryo was lysed in 10 μl of lysis buffer in a 0.2-mL microtube at 65°C for 3 h and 1 μl lysate was used for nested PCR. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.


    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: Detection of targeted transgene insertion Correct insertion of donor vectors into the Rosa26 locus was assessed by observing under a fluorescence microscope and/or PCR-based genotyping. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.


    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP. .. Mutation positions were identified using Big Dye (Applied Biosystems) terminator cycle sequencing.


    Article Title: Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)
    Article Snippet: Paragraph title: Isolation of Pdrbc cDNAs and analysis of tandem repeats ... These primer sets were paired with one another or with DinoSL/Racer3 in the PCR using TAKARA-LA Taq Polymerase.

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: Genotyping of the Atxn2 -CAG42-Knock-In Mouse DNA from tail biopsies was isolated and the genotyping PCR was performed. .. TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) was used to amplify the neomycin cassette excised locus with the primer pair NOW1-K2 5′-TGAGTTGACTCCACAGGGAGGTGAGC-3′ and NOW1-H2 5′-CCATCTCGCCAGCCCGTAAGATTC-3′ flanking this site.

    Article Title: Mapping the Human miRNA Interactome by CLASH Reveals Frequent Noncanonical Binding
    Article Snippet: Reverse Transcription and Library Amplification by PCR Whole isolated RNA was reverse transcribed with Superscript III Reverse Transcriptase (Life Technologies) according to manufacturer instructions, using miRCat-33 primer (IDT) at 50°C. .. RNA was then degraded by addition of 2 μl RNase H (New England Biolabs) for 30 min at 37°C. cDNA was amplified using primers P5 and primer PE_miRCat_PCR ( ) and TaKaRa LA Taq polymerase (Takara Bio, RR002M).

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: For detection of targeted insertion of transgene at blastocysts, genomic DNA from a single blastocyst was isolated using the PicoPure DNA extraction kit (#KIT0103; Arcturus, Mountain View, CA) according to manufacturer’s instructions with the exception that an embryo was lysed in 10 μl of lysis buffer in a 0.2-mL microtube at 65°C for 3 h and 1 μl lysate was used for nested PCR. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.


    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP. .. Cells were grown to mid exponential growth (∼5×106 cells/ml) in rich media at 25°C and 30°C and photographed using a Zeiss Axioplan microscope.

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: Detection of targeted transgene insertion Correct insertion of donor vectors into the Rosa26 locus was assessed by observing under a fluorescence microscope and/or PCR-based genotyping. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.

    Mouse Assay:

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M). .. Two correctly targeted ES cell clones were expanded and injected into C57BL/6J blastocysts to generate chimeric mice.

    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) was used to amplify the neomycin cassette excised locus with the primer pair NOW1-K2 5′-TGAGTTGACTCCACAGGGAGGTGAGC-3′ and NOW1-H2 5′-CCATCTCGCCAGCCCGTAAGATTC-3′ flanking this site. .. The wild-type (WT) allele is predicted to yield an amplification product of 793 bp and the knock-in (CAG42) allele one of 984 bp, while heterozygous (CAG1/CAG42) mice show products of both sizes ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Duplication in the Microtubule-Actin Cross-linking Factor 1 gene causes a novel neuromuscular condition
    Article Snippet: Paragraph title: RT-PCR ... 1 μl template of cDNA from the proband's sample and from a control sample was used to amplify a constant part of MACF1 (NM_012090.4) (Fwd primer located at the exon 81-82 boundary: 5′ CTGTGGAGCGGCAGCACAAGT 3′; Rev primer located at the exon 87–88 boundary: 5′ CTGCCTCCGCTGCGGGATTT 3′) and the endogenous control GAPDH (Fwd primer: 5′ AAGGCTGGGGCTCATTTGCA 3′; Rev primer: 5′ GTGGTCATGAGTCCTTCCAC 3′) using LA Taq (Takara, cat.# RR002A).

    Gel Extraction:

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The fragments were next gel purified using a QIAquick gel extraction kit (28704; QIAGEN, Valencia, CA) as described.

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles. .. · Exonuclease I (E. coli ) (NEB, cat. no. M0293S, 3000 U) · MinElute PCR Purification Kit (QIAGEN, cat. no. 28004, 50 columns) · QIAquick Gel Extraction Kit (QIAGEN, cat. no.28704, 50 columns) · Ethanol (99.5) (WAKO, 057-00456, 500 ml) !CAUTION Flammable.

    Nested PCR:

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl. ..

    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: For detection of targeted insertion of transgene at blastocysts, genomic DNA from a single blastocyst was isolated using the PicoPure DNA extraction kit (#KIT0103; Arcturus, Mountain View, CA) according to manufacturer’s instructions with the exception that an embryo was lysed in 10 μl of lysis buffer in a 0.2-mL microtube at 65°C for 3 h and 1 μl lysate was used for nested PCR. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.


    Article Title: Tandem Repeats, High Copy Number and Remarkable Diel Expression Rhythm of Form II RuBisCO in Prorocentrum donghaiense (Dinophyceae)
    Article Snippet: PCR was carried out using the touch-down protocol mentioned above and the PCR product was purified, cloned, and sequenced. .. These primer sets were paired with one another or with DinoSL/Racer3 in the PCR using TAKARA-LA Taq Polymerase.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The fragments were next gel purified using a QIAquick gel extraction kit (28704; QIAGEN, Valencia, CA) as described.

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: Transgenesis pROSA26-ZtTA was linearized by AgeI digestion and purified by phenol/chloroform extraction. .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: · RNeasy kit (QIAGEN, cat. no. 74104) · Poly(A)Purist mRNA Purification Kits (Ambion, cat. no. AM1916) · PrimeScript Reverse Transcriptase (TAKARA, cat. no. 2680A, 10000 U) ▲CRITICAL Reverse transcribed cDNA yields are best with this enzyme. .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles.

    Plasmid Preparation:

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: Fragments 1 and 2 were both PCR generated from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher, Pittsburgh, PA) as described. .. The pCDNA3.1 directional TOPO vector (45-0158; Invitrogen, Carlsbad, CA) was double digested with Bam HI and Xho I to create cohesive sticky ends and to allow insertion of the fusion products into the vector multiple cloning site, followed by gel purification.

    Article Title: Humoral Autoimmunity against the Extracellular Domain of the Neuroendocrine Autoantigen IA-2 Heightens the Risk of Type 1 Diabetes
    Article Snippet: The extracellular construct was amplified from full-length IA-2 cDNA using TaKaRa LA Taq (RR002A; Fisher) as described. .. The PCR fragment was double digested and ligated into the pCDNA3.1 directional TOPO vector (45-0158; Invitrogen) using Xba I and Xho I.


    Article Title: ATXN2-CAG42 Sequesters PABPC1 into Insolubility and Induces FBXW8 in Cerebellum of Old Ataxic Knock-In Mice
    Article Snippet: The CAG repeat was amplified with TaKaRa LA Taq-Polymerase (Takara Bio Inc., Japan) from DNA from tail biopsies using a 5′-FAM-labeled forward primer 5′-CCCCGCCCGGCGTGCGAGCCGGTGTAT-3′ and the reverse primer 5′-CGGGCTTGCGGCCAGTGG-3′ under the following conditions: 96°C-4′, followed by 38 cycles of 94°C-1′, 60°C-1′ and 72°C-1′ with a final elongation step at 72°C-7′. .. Peak Scanner Software 1.0 (Applied Biosystems) was used to determine the exact PCR product size using the GS500 size standard.


    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: Following G418 selection, clones that contained the knock-in were identified by long-range genomic PCR as previously described . .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Agarose Gel Electrophoresis:

    Article Title: Rapid and efficient human mutation detection using a bench-top next-generation DNA sequencer
    Article Snippet: .. For DNA sequencing we designed 39 amplicons (range: 233 – 606bp; median: 360bp) that were amplified using one of two methods: (1) Thermo-Start PCR Master Mix (AB-0938/15/DC/B): 1μM of each primer (forward and reverse, primer sequences are available upon request), 25μl of 2×Thermo-Start PCR Master Mix, 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 95°C for 15 min, 35 cycles of 95°C for 20 s, 60°C for 30 s, and 72°C for 1 min followed by 72°C for 5 min; (2) TaKaRa LA Taq (RR002M): 1μM of each primer (forward and reverse, primer sequences are available upon request), 5μl of 10×LA PCR Buffer II (Mg2+ plus), 8μl of dNTP mixture (2.5 mM each), 0.5μl TaKaRa LA Taq (5 units/μl), 50ng of DNA, and sterilized distilled water up to 50μl for PCR amplification at the following conditions: 94°C for 1 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 30 s followed by 72°C for 10 min. PCR products were visualized on a 2.0% agarose gel by electrophoresis and purified with QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA). .. Subsequently, all amplicons derived from an individual's DNA sample were pooled in a length-weighted equi-volume ratio (3μl for 200-250bp products, 3.5μl for 251-300bp products, 4μl for 301-350bp products, 4.5μl for 351-400bp products, 5μl for 401-500bp products, and 6μl for 550-600bp products).

    Transgenic Assay:

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: Gene targeting in mouse R1 ES cells was performed by the Stanford Transgenic Facility. .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).


    Article Title: A Structural Systems Biology Approach for Quantifying the Systemic Consequences of Missense Mutations in Proteins
    Article Snippet: TaKaRa LA-Taq polymerase (Takara Bio) was used for the first round of PCR and Z-Taq (Takara Bio) for the mutagenic PCR reaction that was supplemented with 10XdGTP. .. Cell lengths upon mitosis, by unbiased sampling of 30 septated cells, were measured using ImageJ.


    Article Title: One-step generation of multiple transgenic mouse lines using an improved Pronuclear Injection-based Targeted Transgenesis (i-PITT)
    Article Snippet: For detection of targeted insertion of transgene at blastocysts, genomic DNA from a single blastocyst was isolated using the PicoPure DNA extraction kit (#KIT0103; Arcturus, Mountain View, CA) according to manufacturer’s instructions with the exception that an embryo was lysed in 10 μl of lysis buffer in a 0.2-mL microtube at 65°C for 3 h and 1 μl lysate was used for nested PCR. .. The first round of PCR reaction with the outer primer pair sets (M022/M338 for pBER and pBDR insertion, and “M022/M026” for pBGV and pBGW insertion) was performed using TaKaRa LA-Taq (#RR002A; TaKaRa) in a total of 10 μl solution.


    Article Title: 5' end-centered expression profiling using Cap-analysis gene expression (CAGE) and next-generation sequencing
    Article Snippet: Handle using appropriate safety measures such as the use of safety goggles, gloves, mask and fume hood. .. · T4 DNA ligase (NEB, cat. no. M0202S, 20000 U) · TaKaRa LA Taq (TAKARA, cat. no. RR002A, 125 U) · Antarctic Phosphatase (NEB, cat. no. M0289L, 5000 U) · Eco P15I (NEB, cat. no. R0646S, 500 U) · Sinefungin (Calbiochem-Novabiochem international, cat. no. 567051, 2 mg) · Phusion™ High-Fidelity DNA Polymerase (FINNZYMES, cat. no. F-530S, 100 U) ▲CRITICAL This DNA polymerase shows better yield than Taq DNA polymerase, allowing a lower number of PCR cycles.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa la taq tm kit
    La Taq Tm Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more taq tm kit/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq tm kit - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results