la taq polymerase  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87

    Structured Review

    Millipore la taq polymerase
    La Taq Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq polymerase/product/Millipore
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    la taq polymerase - by Bioz Stars, 2020-04
    87/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: Paragraph title: PCR amplification, cloning, and nucleotide sequencing ... [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: Paragraph title: Cloning and overexpression ... The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing.

    Centrifugation:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. The cells were then incubated for 5 h in the presence of 50 μg ml−1 isopropyl-β-d -thiogalactopyranoside, harvested by centrifugation and stored at −20°C.

    Amplification:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: Paragraph title: PCR amplification, cloning, and nucleotide sequencing ... [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: .. The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Using the NdeI and Bg1II sites, the fragment bearing the target gene was ligated into pET-11a (Novagen).

    Synthesized:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: Using this sequence information, we synthesized two primers for amplification of the ttha1150 gene by PCR. .. The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing.

    Isolation:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: PCR amplification, cloning, and nucleotide sequencing DNA was isolated from uncultured PBMC of HIV-1 infected individuals according to a modified procedure described before [ ]. .. [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Polymerase Chain Reaction:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: Paragraph title: PCR amplification, cloning, and nucleotide sequencing ... [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: .. The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Using the NdeI and Bg1II sites, the fragment bearing the target gene was ligated into pET-11a (Novagen).

    TA Cloning:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: .. The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Using the NdeI and Bg1II sites, the fragment bearing the target gene was ligated into pET-11a (Novagen).

    Infection:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: The HIV-1 env gp41 gene from infected patients' PBMC DNA was amplified using the following primers: Gp41-6 (+) (AGTAAAAATTGAACCATT AGGAGTAGCA, 7678 to 7705, sense), Gp41-7 (-) (CTTTCCCTTACAGCAGGCCATCCAATCAC, 8815 to 8836, anti-sense) as outer primers, and Gp41-8 (+) (CAAGGCAAAGAGAAGAGTGGTT-GCA, 7711 to 7734, sense), Gp41-9 (-) (TACTTTTTGACCACTTGCCACCCAT, 8786 to 8811, anti-sense) as inner primers based on NL4-3 sequence [ ]. .. [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Sequencing:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: Paragraph title: PCR amplification, cloning, and nucleotide sequencing ... [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: .. The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Using the NdeI and Bg1II sites, the fragment bearing the target gene was ligated into pET-11a (Novagen).

    Incubation:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. The cells were then incubated for 5 h in the presence of 50 μg ml−1 isopropyl-β-d -thiogalactopyranoside, harvested by centrifugation and stored at −20°C.

    Positron Emission Tomography:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Using the NdeI and Bg1II sites, the fragment bearing the target gene was ligated into pET-11a (Novagen).

    Cell Culture:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Escherichia coli Rosetta(DE3) cells transformed with the resulting plasmid were cultured at 37°C to 1 × 108 cells/ml in 1.5 l LB medium containing 50 μg ml−1 ampicillin.

    Modification:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: PCRs were performed according to the modified procedure described by Ahmad et al . .. [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol.

    Transformation Assay:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Escherichia coli Rosetta(DE3) cells transformed with the resulting plasmid were cultured at 37°C to 1 × 108 cells/ml in 1.5 l LB medium containing 50 μg ml−1 ampicillin.

    Over Expression:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: Paragraph title: Cloning and overexpression ... The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing.

    Nested PCR:

    Article Title: Characterization of HIV-1 envelope gp41 genetic diversity and functional domains following perinatal transmission
    Article Snippet: [ ] using 2.5 U of TaKaRa LA Taq polymerase (Chemicon International) in accordance to manufacturer's protocol. .. After the first round of PCR, 4 to 8 μl of the above- described amplified product was used for nested PCR, using the inner primers and the same concentrations of other ingredients at 94°C for 30 s, 55°C for 45 s and 72°C for 1 min for 35 cycles, with 8 min of additional polymerization time in the last cycle.

    Plasmid Preparation:

    Article Title: Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3?-5? exonuclease activity
    Article Snippet: The gene fragment amplified by PCR using LA Taq polymerase was ligated into the pT7Blue T-vector (Novagen, WI, USA) by TA cloning and confirmed by sequencing. .. Escherichia coli Rosetta(DE3) cells transformed with the resulting plasmid were cultured at 37°C to 1 × 108 cells/ml in 1.5 l LB medium containing 50 μg ml−1 ampicillin.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore pcr master mix
    Pcr Master Mix, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Millipore
    Average 99 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Millipore ex taq polymerase
    Ex Taq Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq polymerase/product/Millipore
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    ex taq polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results