la taq polymerase solution  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    TaKaRa LA Taq DNA Polymerase with GC Buffer
    Description:
    TaKaRa LA Taq DNA Polymerase with GC Buffer has the Takara LA Taq DNA Polymerase blend for long and accurate PCR paired with GC optimized buffers to power through difficult to amplify GC rich sequences including genomic DNA The GC optimized Buffers I and II are specifically designed to amplify GC rich DNA templates up to 73 GC content or templates with a significant amount of secondary structure
    Catalog Number:
    rr02ag
    Price:
    None
    Size:
    125 Units
    Category:
    LA Taq DNA polymerase with GC buffers GC rich PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa la taq polymerase solution
    TaKaRa LA Taq DNA Polymerase with GC Buffer has the Takara LA Taq DNA Polymerase blend for long and accurate PCR paired with GC optimized buffers to power through difficult to amplify GC rich sequences including genomic DNA The GC optimized Buffers I and II are specifically designed to amplify GC rich DNA templates up to 73 GC content or templates with a significant amount of secondary structure
    https://www.bioz.com/result/la taq polymerase solution/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq polymerase solution - by Bioz Stars, 2020-07
    95/100 stars

    Related Products / Commonly Used Together

    dntp mix
    pcr
    la taq buffer
    template dna
    primer solutions

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Loss of genes related to Nucleotide Excision Repair (NER) and implications for reductive genome evolution in symbionts of deep-sea vesicomyid clams
    Article Snippet: .. For the PCR, 25 μl of the reaction mixture contained 80 ng of template DNA, 2.5 μl of 10× LA Taq buffer (TaKaRa), 2.5 μl of dNTP mix (TaKaRa), 5 μl each of the 1 pmol/μl forward and reverse primer solutions, 0.13 μl of LA Taq polymerase solution (TaKaRa) and 8.87 μl of pure water was used. .. The gene fragments were amplified with an ABI 9700 Thermal cycler using a protocol; 96°C for 2 min and 30 cycles of 96°C for 20 s, 56°C for 15 s and 72°C for 2 or 5 or 7 min, followed by extension at 72°C for 10 min. After amplification, 2 μl of the reaction product mixture was applied to 1% agarose electrophoresis gel and stained with an ethidium bromide solution to visualize the reaction products.

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

    Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
    Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

    Article Title: Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas
    Article Snippet: .. Then the no bands or weak bands primers were used in the second round PCR reaction using TAKaRa LA Taq polymerase with GC buffer (Code No.: RR02AG, TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. SSRs were amplified on Heijingang Thermal Cycler (Eastwin, Beijing, China).

    Nested PCR:

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl. ..

    Genomic Sequencing:

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

    Amplification:

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: .. To detect correct targeting at the 5′ end of ROSA26, we amplified ∼1.5 kb genomic DNA fragment using primers: Rosa3 ( CCACTGACCGCACGGGGATTC ) and Rosa4 ( TCAATGGGCGGGGGTCGTT ), and LA Taq with GC buffer I (Takara, Cat No. RR02AG). .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
    Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

    Variant Assay:

    Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
    Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    TaKaRa la taq pcr solution
    La Taq Pcr Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq pcr solution/product/TaKaRa
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq pcr solution - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    95
    TaKaRa la taq polymerase solution
    La Taq Polymerase Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq polymerase solution/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq polymerase solution - by Bioz Stars, 2020-07
    95/100 stars
      Buy from Supplier

    99
    TaKaRa single tube pcr kit
    Single Tube Pcr Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/single tube pcr kit/product/TaKaRa
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    single tube pcr kit - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results