kpni xbai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    New England Biolabs kpni xbai
    Kpni Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni xbai/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kpni xbai - by Bioz Stars, 2020-04
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: .. Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Ampicillin (Sigma Aldrich, USA) was used to select E . coli containing the pChlamy_3 plasmid, which was subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones.

    Electroporation:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. C . reinhardtii was transformed by electroporation following manufacturer’s instructions (GeneArt Chlamydomonas Engineering Kit, Life Technologies) and individual colonies grown on TAP-Agar-Hygromycin plates (10 μg/mL) (Sigma Aldrich, USA) at 23°C.

    Isolation:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Ampicillin (Sigma Aldrich, USA) was used to select E . coli containing the pChlamy_3 plasmid, which was subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones.

    Quantitative RT-PCR:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Colonies were picked and grown at 23°C in 100 ml TAP growth media (Invitrogen, USA) with constant orbital agitation. qRT-PCR was performed to identify clones with the highest level of uNLP expression, which were then selected for downstream assays (pChlamy universal FWD: CACTTTCAGCGACAAACGAG, nlp-15b REV: CTACTAGTCGAGGCCGGTA; Mi-nlp-9f REV: GAACGGGCGGATGAAGTAG).

    Expressing:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Colonies were picked and grown at 23°C in 100 ml TAP growth media (Invitrogen, USA) with constant orbital agitation. qRT-PCR was performed to identify clones with the highest level of uNLP expression, which were then selected for downstream assays (pChlamy universal FWD: CACTTTCAGCGACAAACGAG, nlp-15b REV: CTACTAGTCGAGGCCGGTA; Mi-nlp-9f REV: GAACGGGCGGATGAAGTAG).

    Transformation Assay:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: .. Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Ampicillin (Sigma Aldrich, USA) was used to select E . coli containing the pChlamy_3 plasmid, which was subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones.

    Plasmid Preparation:

    Article Title: Nematode neuropeptides as transgenic nematicides
    Article Snippet: .. Transformation of C . reinhardtii uNLP secretion inserts, and vector pChlamy_3 were digested using KpnI/XbaI (New England Biolabs, USA), ligated using T4 ligase (New England Biolabs, USA), and cloned into Escherichia coli One Shot TOP10 chemically competent cells (Life Technologies, USA) following manufacturer’s instructions. .. Ampicillin (Sigma Aldrich, USA) was used to select E . coli containing the pChlamy_3 plasmid, which was subsequently extracted using the High Pure Plasmid Isolation Kit (Roche) and sequenced (Eurofins Genomics, UK) to identify correct clones.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs kpni xbai restriction sites
    Kpni Xbai Restriction Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni xbai restriction sites/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kpni xbai restriction sites - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    New England Biolabs kpni xbai
    Kpni Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni xbai/product/New England Biolabs
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kpni xbai - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    86
    New England Biolabs kpni xbai digested pat28
    Kpni Xbai Digested Pat28, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kpni xbai digested pat28/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kpni xbai digested pat28 - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results