Structured Review

Kapa Biosystems kapa long range hotstart dna polymerase
Kapa Long Range Hotstart Dna Polymerase, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 85/100, based on 1180 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kapa long range hotstart dna polymerase/product/Kapa Biosystems
Average 85 stars, based on 1180 article reviews
Price from $9.99 to $1999.99
kapa long range hotstart dna polymerase - by Bioz Stars, 2020-08
85/100 stars

Images

Related Articles

Amplification:

Article Title: Molecular transitions in early progenitors during human cord blood hematopoiesis
Article Snippet: .. Reverse transcription was performed on the STAMPs in a pooled fashion using Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific #EP0752), followed by exonuclease I cleavage to remove primers not bound to mRNAs. cDNAs were then amplified through PCR using KAPA HiFi HotStart ReadyMix (Kapa Biosystems #KK2602) by collecting 5,000 STAMPs per PCR reaction, and later fragmented and prepared into paired‐end sequencing libraries with the Nextera XT DNA sample prep kit (Illumina) using custom Read 1 primers (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC, IDT). .. Libraries were quantified using Qubit and BioAnalyzer High Sensitivity Chip (Agilent) and sequenced on the Illumina HiSeq 2500 machine.

Article Title: Unprecedented Diversity of Lactococcal Group 936 Bacteriophages Revealed by Amplicon Sequencing of the Portal Protein Gene
Article Snippet: .. The portal protein gene fragment was amplified by PCR using the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) and annealing at 55 °C with primers Portal-471F (5′-GCTGGAACAAGGTAAATTGCGT-3′) and Portal-931R (5′-AGTCAATTAATTCTTTCAAAGTTGCAA-3′). .. Forward (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and reverse (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) Illumina adapter overhangs were added to the 5′ ends of the primers to enable Nextera XT DNA indexing of the PCR products.

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: .. IP and input DNA were purified by the MinElute reaction Cleanup kit, and amplified by PCR using the KAPA HiFi HotStart ReadyMix PCR kit (KAPA Biosystems) with the following program: 45 s at 98°C for initial denaturation, 15 s at 98°C, 30 s at 65°C, 30 s at 72°C for four cycles, followed by 1 min at 72°C for final extension. .. Removal of excess adaptors and selection of 300 bp bands was done using 2% E-Gel SizeSelect Agarose Gels (Invitrogen).

Sample Prep:

Article Title: Molecular transitions in early progenitors during human cord blood hematopoiesis
Article Snippet: .. Reverse transcription was performed on the STAMPs in a pooled fashion using Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific #EP0752), followed by exonuclease I cleavage to remove primers not bound to mRNAs. cDNAs were then amplified through PCR using KAPA HiFi HotStart ReadyMix (Kapa Biosystems #KK2602) by collecting 5,000 STAMPs per PCR reaction, and later fragmented and prepared into paired‐end sequencing libraries with the Nextera XT DNA sample prep kit (Illumina) using custom Read 1 primers (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC, IDT). .. Libraries were quantified using Qubit and BioAnalyzer High Sensitivity Chip (Agilent) and sequenced on the Illumina HiSeq 2500 machine.

Purification:

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: .. IP and input DNA were purified by the MinElute reaction Cleanup kit, and amplified by PCR using the KAPA HiFi HotStart ReadyMix PCR kit (KAPA Biosystems) with the following program: 45 s at 98°C for initial denaturation, 15 s at 98°C, 30 s at 65°C, 30 s at 72°C for four cycles, followed by 1 min at 72°C for final extension. .. Removal of excess adaptors and selection of 300 bp bands was done using 2% E-Gel SizeSelect Agarose Gels (Invitrogen).

Polymerase Chain Reaction:

Article Title: Molecular transitions in early progenitors during human cord blood hematopoiesis
Article Snippet: .. Reverse transcription was performed on the STAMPs in a pooled fashion using Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific #EP0752), followed by exonuclease I cleavage to remove primers not bound to mRNAs. cDNAs were then amplified through PCR using KAPA HiFi HotStart ReadyMix (Kapa Biosystems #KK2602) by collecting 5,000 STAMPs per PCR reaction, and later fragmented and prepared into paired‐end sequencing libraries with the Nextera XT DNA sample prep kit (Illumina) using custom Read 1 primers (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC, IDT). .. Libraries were quantified using Qubit and BioAnalyzer High Sensitivity Chip (Agilent) and sequenced on the Illumina HiSeq 2500 machine.

Article Title: Unprecedented Diversity of Lactococcal Group 936 Bacteriophages Revealed by Amplicon Sequencing of the Portal Protein Gene
Article Snippet: .. The portal protein gene fragment was amplified by PCR using the Kapa HiFi PCR kit (Kapa Biosystems, Wilmington, MA, USA) and annealing at 55 °C with primers Portal-471F (5′-GCTGGAACAAGGTAAATTGCGT-3′) and Portal-931R (5′-AGTCAATTAATTCTTTCAAAGTTGCAA-3′). .. Forward (5′-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and reverse (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) Illumina adapter overhangs were added to the 5′ ends of the primers to enable Nextera XT DNA indexing of the PCR products.

Article Title: Genetic Variation in the von Willebrand Factor Gene in Swedish von Willebrand Disease Patients
Article Snippet: .. PCR was performed using KAPA Taq HotStart DNA PCR kit (KAPA Biosystems, Cape Town, South Africa). .. The primary PCR products were purified with ExoSAP-IT PCR Product Cleanup (Affymetrix, Santa Clara, California, United States), unincorporated dye terminators removed by BigDye XTerminator Purification Kit and sequence data assembled and compared using SeqScape (Applied Biosystems).

Article Title: Dendritic Cells Actively Limit Interleukin-10 Production Under Inflammatory Conditions via DC-SCRIPT and Dual-Specificity Phosphatase 4
Article Snippet: .. IP and input DNA were purified by the MinElute reaction Cleanup kit, and amplified by PCR using the KAPA HiFi HotStart ReadyMix PCR kit (KAPA Biosystems) with the following program: 45 s at 98°C for initial denaturation, 15 s at 98°C, 30 s at 65°C, 30 s at 72°C for four cycles, followed by 1 min at 72°C for final extension. .. Removal of excess adaptors and selection of 300 bp bands was done using 2% E-Gel SizeSelect Agarose Gels (Invitrogen).

other:

Article Title: The Impact of DNA Extraction Methods on Stool Bacterial and Fungal Microbiota Community Recovery
Article Snippet: Briefly, PCR was performed with 2 × KAPA HiFi HotStart ReadyMix (Kapa Biosystems, Inc., United States) under the following conditions: initial denaturation at 95°C for 15 min, followed by 30 cycles consisting of denaturation at 95°C for 40 s, annealing at 55°C for 45 s and extension at 72°C for 60 s, with a final extension step at 72°C for 5 min. From each reaction, 5 μl were analyzed by 2% agarose gel electrophoresis.

Article Title: Adult porcine genome-wide DNA methylation patterns support pigs as a biomedical model
Article Snippet: The adaptor–ligated double-stranded cDNA was amplified by PCR for 10 cycles with the Kapa HiFi polymerase (Kapa Biosystems, Woburn, MA, USA) to reduce the likeliness of multiple identical reads due to preferential amplification.

Article Title: Degenerate PCR Primers to Reveal the Diversity of Giant Viruses in Coastal Waters
Article Snippet: PCR was performed for cycles of 30 s at 94 °C, 30 s at 52 °C, and 30 s at 72 °C with a final elongation step of 4 min at 72 °C using KAPA HiFi HotStart Readymix (KAPA BIOSYSTEMS, Wilmington, MA, USA).

Article Title: Impact of Leptospermone, a Natural β-Triketone Herbicide, on the Fungal Composition and Diversity of Two Arable Soils
Article Snippet: A PCR was performed in 25 μL reaction volume with the following concentrations: DNA 30 ng, 300 μM dNTPs, 0.4 μM of both primers (fITS7, rITS4), 1× Kapa Hifi HotStart ReadyMix containing 2.5 mM MgCl2 and 0.5 unit of Kapa Hifi HotStart DNA polymerase (KapaBiosystems, United States).

Sequencing:

Article Title: Molecular transitions in early progenitors during human cord blood hematopoiesis
Article Snippet: .. Reverse transcription was performed on the STAMPs in a pooled fashion using Maxima H Minus Reverse Transcriptase (Thermo Fisher Scientific #EP0752), followed by exonuclease I cleavage to remove primers not bound to mRNAs. cDNAs were then amplified through PCR using KAPA HiFi HotStart ReadyMix (Kapa Biosystems #KK2602) by collecting 5,000 STAMPs per PCR reaction, and later fragmented and prepared into paired‐end sequencing libraries with the Nextera XT DNA sample prep kit (Illumina) using custom Read 1 primers (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC, IDT). .. Libraries were quantified using Qubit and BioAnalyzer High Sensitivity Chip (Agilent) and sequenced on the Illumina HiSeq 2500 machine.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Kapa Biosystems kapa long range hotstart pcr kit
    Kapa Long Range Hotstart Pcr Kit, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kapa long range hotstart pcr kit/product/Kapa Biosystems
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    kapa long range hotstart pcr kit - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Kapa Biosystems kapa polymerase kapa long range hotstart pcr kit kapa biosystems
    Kapa Polymerase Kapa Long Range Hotstart Pcr Kit Kapa Biosystems, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kapa polymerase kapa long range hotstart pcr kit kapa biosystems/product/Kapa Biosystems
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kapa polymerase kapa long range hotstart pcr kit kapa biosystems - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results