Structured Review

Bio-Rad iproof high fidelity master mix
Iproof High Fidelity Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/iproof high fidelity master mix/product/Bio-Rad
Average 98 stars, based on 15 article reviews
Price from $9.99 to $1999.99
iproof high fidelity master mix - by Bioz Stars, 2019-10
98/100 stars

Images

Related Articles

Clone Assay:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. Deletion constructs Elk-3 (–463/+387), Elk-3 (–163/+387), and Elk-3 (+187/+387) were generated by use of common forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and different reverse (5′-CCC AAA AGA GGA TCC CAA CTC-3′, 5′-CCA TTA GCA GGG CAC GAA C-3′, and 5′-CCA ACT TCC TGC TCT CAC ACA-3′) primers, respectively.

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Nested PCR was performed to determine the numbers of msp2 (FC27 and 3D7) clones. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Centrifugation:

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: After centrifugation at 10,000 rpm for three minutes, DNA containing supernatant was collected. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Amplification:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Subsequently, both the exome- and whole genome-sequencing libraries were PCR-amplified; the whole genome libraries have been described in detail previously [ ]. .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water. .. After PCR amplification, quality assessment of samples was performed using a Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Reverse oligonucleotides also contained 12 unique 8-mer barcodes for multiplexing of up to 12 samples per lane ( ). .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: After adaptor ligation the sample libraries were PCR-amplified for 12 cycles. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA). .. The amplification master mix (255 μl) and MQ water was added to 125 ng of the template to a total volume of 500 μl, spread across five wells at a reaction volume of 100 μl.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Paragraph title: Bacterial SSU rRNA gene amplification and 454 pyrosequencing ... Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: For this purpose genomic DNA of clonal cell lines was extracted using the genomic DNA purification kit (Thermo Fisher). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For the amplification reaction we used the following primers pairs: the forward 5′-CCTGATTCCCTGGATTGTTG-3′ and reverse 5′-CAGGATGGTTCAGCTGGTTT-3′ primers to amplified the KO CK2α sequence; The forward 5′-CGCTCCTCCTCTTGCTTG-3′ and reverse 5′-ACCCATAGGAAGCCCAAAGT-3′ primers to amplified the KO CK2α’ sequence; The forward 5′-GCTTGGAGATGCTTCAGAGG-3′ and reverse 5′-GGCTTTGCACATTACCCAAC-3′ primers to amplified the KO CK2β sequence.

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: Triplicates were run for each reaction and only those yielding the highest efficiency (R2 ≥0.996) were included in the analysis. .. The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency. .. Amplification of 16S rRNA genes from archaea and bacteria was performed with the archaeal primer set 340F and 1000R [ ], giving a 650 bp amplicon product, and the bacterial primer sets 27F and 515R [ , ], yielding a 500 bp amplicon product.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: Paragraph title: DNA extraction and PCR amplification. ... PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Stable Transfection:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. For the Elk-3 silencing experiments, Elk-3 target sequence CGAAGCCATATTTAGACAATA, or a Scr sequence, was cloned into the pMSVC vector (Open Biosystems, GE Dharmacon, Lafayette, CO, USA), and retroviral particles were made in the EcoPack 2-293 cell line (Clontech Laboratories, Mountain View, CA, USA).

Synthesized:

Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
Article Snippet: Components for PCR. iProof High Fidelity Master Mix (Bio-Rad). .. Components for PCR. iProof High Fidelity Master Mix (Bio-Rad).

TA Cloning:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. Deletion constructs Elk-3 (–463/+387), Elk-3 (–163/+387), and Elk-3 (+187/+387) were generated by use of common forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and different reverse (5′-CCC AAA AGA GGA TCC CAA CTC-3′, 5′-CCA TTA GCA GGG CAC GAA C-3′, and 5′-CCA ACT TCC TGC TCT CAC ACA-3′) primers, respectively.

Blocking Assay:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water. .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

SYBR Green Assay:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Reverse oligonucleotides also contained 12 unique 8-mer barcodes for multiplexing of up to 12 samples per lane ( ). .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Modification:

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: Paragraph title: Measuring allele modification frequencies using TIDE, T7 assay and sequencing of TOPO-cloned PCR fragments ... PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′.

Incubation:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. Next, a 100-μL in vitro transcription reaction was performed with 300 ng DNA template and 1000 U of T7 RNA polymerase in buffer containing 40 mM Tris pH 7.9, 20 mM MgCl2 , 5 mM DTT, 2 mM spermidine and 2 mM of each NTP (New England BioLabs).

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Following A-base addition, adaptors were ligated onto the DNA fragments by an adaptor ligation master mix and each sample was incubated at 16°C for 20 min. Adaptor ligation master mix was made out of 5 μl 10× T4 Ligase Buffer (New England Biolabs, Ipswich, MA, USA), 5 μl adaptor (50 μM), and 2 μl T4 DNA Ligase (2000 U/μl) (New England Biolabs, Ipswich, MA, USA) to each sample. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. Next, a 100-μL in vitro transcription reaction was set using 300 ng DNA template and 1000 units of T7 RNA polymerase in buffer containing (in millimolar): 40 Tris pH 7.9, 20 MgCl2 , 5 DTT, 2 spermidine, and 2 each NTP (New England Biolabs).

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Discs of the same size (half of the dried blood blot) were cut out and incubated overnight in 1 ml of 0.5% saponin in phosphate buffered saline (PBS) at 4°C. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Knock-In:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: sgRNAs for CRISPR-mediated knock-in was transcribed in vitro following the published protocol . .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Western Blot:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The absence of the specific CK2 subunits was verified by western blotting, kinase activity assay and sanger sequence analysis. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Kinase Assay:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The absence of the specific CK2 subunits was verified by western blotting, kinase activity assay and sanger sequence analysis. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Activated Clotting Time Assay:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The following sequence was used as the DNA template to transcribe sgRNAs in vitro: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTTAAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene specific ∼20-nt protospacer sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA scaffold region. .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: sgRNAs were prepared following methods by Lin et al. ( ) with some modifications. sgRNAs were obtained by in vitro transcription of a DNA template of the following sequence: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene-specific ∼20-nt sgRNA sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA constant region. .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Derivative Assay:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: The Elk-3 gene, including the promoter region, was isolated from a bacteriophage artificial chromosome library, derived from mouse spleen genomic DNA (RPCI22.HYB; BACPAC Resources Center, Oakland, CA, USA). .. Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories).

Hybridization:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water. .. After PCR amplification, quality assessment of samples was performed using a Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Countercurrent Chromatography:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Electroporation:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Paragraph title: Preparation and electroporation of Cas9/sgRNA RNP ... For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Transfection:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. For the Elk-3 silencing experiments, Elk-3 target sequence CGAAGCCATATTTAGACAATA, or a Scr sequence, was cloned into the pMSVC vector (Open Biosystems, GE Dharmacon, Lafayette, CO, USA), and retroviral particles were made in the EcoPack 2-293 cell line (Clontech Laboratories, Mountain View, CA, USA).

Ligation:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: The adaptor ligation master mix was made out of 5 μl 10× T4 Ligase Buffer (New England Biolabs, Ipswich, MA, USA), 5 μl adaptor (50 μM), and 2 μl T4 DNA Ligase (2000 U/μl) (New England Biolabs, Ipswich, MA, USA) for each sample. .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: After adaptor ligation the sample libraries were PCR-amplified for 12 cycles. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: A total of 100 ng genomic DNA was used as input in the capture reaction with the diluted phosphorylated smMIP pool. .. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Infection:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. For the Elk-3 silencing experiments, Elk-3 target sequence CGAAGCCATATTTAGACAATA, or a Scr sequence, was cloned into the pMSVC vector (Open Biosystems, GE Dharmacon, Lafayette, CO, USA), and retroviral particles were made in the EcoPack 2-293 cell line (Clontech Laboratories, Mountain View, CA, USA).

Generated:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: For TIDE and T7 assays, genomic DNA was extracted from cells 3 d after nucleofection (if not otherwise indicated) using QuickExtract DNA Extraction Solution (Epicentre, Madison, WI, USA) following manufacturer’s instructions. .. PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′. .. For T7 assays, PCR amplicons were purified and 200 ng was denatured and re-annealed in a thermocycler and digested with T7 Endonuclease I (New England Biolabs, Waltham, MA, USA) according to manufacturer’s protocol.

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Polymerase Chain Reaction:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Subsequently, both the exome- and whole genome-sequencing libraries were PCR-amplified; the whole genome libraries have been described in detail previously [ ]. .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. The PCR product was purified and eluted in 12 μL of RNAse-free DNA buffer (2 mM Tris pH 8.0 in DEPC-treated water).

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents. .. The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: After adaptor ligation the sample libraries were PCR-amplified for 12 cycles. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: IFN-gamma and TNF associated with severe falciparum malaria infection in Saudi pregnant women
Article Snippet: Five μl of DNA samples were used to detect the P. falciparum malaria parasite using a polymerase chain reaction (PCR), targeting for msp2 (FC27) clone as described in details below. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: For TIDE and T7 assays, genomic DNA was extracted from cells 3 d after nucleofection (if not otherwise indicated) using QuickExtract DNA Extraction Solution (Epicentre, Madison, WI, USA) following manufacturer’s instructions. .. PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′. .. For T7 assays, PCR amplicons were purified and 200 ng was denatured and re-annealed in a thermocycler and digested with T7 Endonuclease I (New England Biolabs, Waltham, MA, USA) according to manufacturer’s protocol.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: Paragraph title: PCR and gel electrophoresis ... The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The following PCR program was used: denaturation at 98°C for 30 s, 30 cycles of 10 s at 98°C, 30 s at 58°C, and 40 s at 72°C and a final extension at 72°C for 7 min. PCR product concentrations were measured by Qubit® fluorometer using Qubit® dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and checked by gel electrophoresis (1% agarose gel).

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: For this purpose genomic DNA of clonal cell lines was extracted using the genomic DNA purification kit (Thermo Fisher). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For the amplification reaction we used the following primers pairs: the forward 5′-CCTGATTCCCTGGATTGTTG-3′ and reverse 5′-CAGGATGGTTCAGCTGGTTT-3′ primers to amplified the KO CK2α sequence; The forward 5′-CGCTCCTCCTCTTGCTTG-3′ and reverse 5′-ACCCATAGGAAGCCCAAAGT-3′ primers to amplified the KO CK2α’ sequence; The forward 5′-GCTTGGAGATGCTTCAGAGG-3′ and reverse 5′-GGCTTTGCACATTACCCAAC-3′ primers to amplified the KO CK2β sequence.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: A total of 100 ng genomic DNA was used as input in the capture reaction with the diluted phosphorylated smMIP pool. .. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
Article Snippet: Exonuclease III ( E. coli ). .. Components for PCR. iProof High Fidelity Master Mix (Bio-Rad). .. SYBR® Green I nucleic acid gel stain (Invitrogen).

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. The thermocycler setting consisted of: 95 °C for 30 s; 30 cycles of 95 °C for 15 s, 57 °C for 15 s, and 72 °C for 15 s; and 72 °C for 30 s. The PCR product was purified on DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions and eluted in 12 μL of RNase-free DNA buffer (2 mM Tris pH 8.0 in DEPC-treated H2 O).

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. Deletion constructs Elk-3 (–463/+387), Elk-3 (–163/+387), and Elk-3 (+187/+387) were generated by use of common forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and different reverse (5′-CCC AAA AGA GGA TCC CAA CTC-3′, 5′-CCA TTA GCA GGG CAC GAA C-3′, and 5′-CCA ACT TCC TGC TCT CAC ACA-3′) primers, respectively.

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs. .. A primer pair corresponding to the outer conserved region of the polymorphic repetitive block 3 of msp2 was used to amplify 2.5 μl of DNA extracted from filter paper.

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: Paragraph title: 16S rRNA gene PCR amplification ... The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: DNA quantification was done using a NanoDrop 2000c spectrophotometer and solutions were stored at −20 °C until amplification by PCR. .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. Bacterial and archaeal 16S rRNA amplification was carried out with the bacterial primer set 27F and 515R , giving an around 500 bp amplicon product; and the archaeal primer set 340F and 1000R , yielding an around 650 bp amplicon product.

Article Title: Trans genomic capture and sequencing of primate exomes reveals new targets of positive selection
Article Snippet: All cleanup steps were performed with 1.8× AmpureXP beads as directed by Agencourt. .. The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp). .. The PCR conditions were 2 min at 96°C, 16 cycles of 20 sec at 96°C, 30 sec at 65°C, and 45 sec at 72°C, followed by a final 5 min at 72°C.

Cellular Antioxidant Activity Assay:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The forward primer is a combination of the 454 fusion adapter B sequence and universal bacterial primer 8F, 5′-CCT ATC CCC TGT GTG CCT TGG CAG TCT CAG CAA CAG CT A GAG TTT GAT CCT GG-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

DNA Extraction:

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: For TIDE and T7 assays, genomic DNA was extracted from cells 3 d after nucleofection (if not otherwise indicated) using QuickExtract DNA Extraction Solution (Epicentre, Madison, WI, USA) following manufacturer’s instructions. .. PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: Paragraph title: DNA extraction and PCR amplification. ... PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Nucleic Acid Electrophoresis:

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: Paragraph title: PCR and gel electrophoresis ... The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Mutagenesis:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Paragraph title: Deep sequencing of mutation sites ... Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad).

Isolation:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: The Elk-3 gene, including the promoter region, was isolated from a bacteriophage artificial chromosome library, derived from mouse spleen genomic DNA (RPCI22.HYB; BACPAC Resources Center, Oakland, CA, USA). .. Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories).

Size-exclusion Chromatography:

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs. .. A primer pair corresponding to the outer conserved region of the polymorphic repetitive block 3 of msp2 was used to amplify 2.5 μl of DNA extracted from filter paper.

Article Title: Trans genomic capture and sequencing of primate exomes reveals new targets of positive selection
Article Snippet: Genomic DNA from each sample (3 μg) was sheared (Covaris AFA) in 85 μL of elution buffer (Buffer EB, 10 mM Tris-Cl at pH 8.5; QIAGEN) using the settings: duty cycle 10%, intensity 5, and cycle/burst 200 for 600 sec. Fragmented DNA ends were repaired for 30 min at 20°C with 5 μL of End Repair Enzyme Mix and 1× End Repair Reaction Buffer in a total volume of 100 μL (NEBNext End Repair Module; New England Biolabs) and eluted in 45 μL of water after cleanup. .. The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp).

Multiplexing:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Reverse oligonucleotides also contained 12 unique 8-mer barcodes for multiplexing of up to 12 samples per lane ( ). .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Purification:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA). .. The amplification master mix (255 μl) and MQ water was added to 125 ng of the template to a total volume of 500 μl, spread across five wells at a reaction volume of 100 μl.

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′. .. PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′.

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Trans genomic capture and sequencing of primate exomes reveals new targets of positive selection
Article Snippet: The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp). .. The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp).

Sequencing:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Paragraph title: Library preparation and sequencing of DTCs and primary tumors with matched blood ... Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Preparation and electroporation of Cas9/sgRNA RNP All synthetic nuclei acid reagents were purchased from Integrated DNA Technologies (IDT). sgRNAs and Cas9/sgRNA RNP complexes were prepared using the following procedure . sgRNAs were obtained by in vitro transcribing DNA templates containing a T7 promoter (TAATACGACTCACTATAG), the gene-specific 20-nt sgRNA sequence and a common sgRNA scaffold region. .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Paragraph title: Deep sequencing of mutation sites ... Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The following sequence was used as the DNA template to transcribe sgRNAs in vitro: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTTAAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene specific ∼20-nt protospacer sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA scaffold region. .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Paragraph title: Whole-genome sequencing library preparation of DTCs ... Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: Paragraph title: Measuring allele modification frequencies using TIDE, T7 assay and sequencing of TOPO-cloned PCR fragments ... PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. Plasmids were recovered from E . coli cultures using the GenEluteTM HP plasmid Miniprep Kit (Sigma) and digested with EcoR I (NEB) to confirm the PCR insert size.

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. Plasmids were recovered from E . coli cultures using the GenEluteTM HP plasmid Miniprep Kit (Sigma) and digested with EcoR I (NEB) to confirm the PCR insert size.

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Sanger sequencing was performed on PCR products amplified from genomic DNA spanning the crispr RNA target. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: sgRNAs were prepared following methods by Lin et al. ( ) with some modifications. sgRNAs were obtained by in vitro transcription of a DNA template of the following sequence: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene-specific ∼20-nt sgRNA sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA constant region. .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. Deletion constructs Elk-3 (–463/+387), Elk-3 (–163/+387), and Elk-3 (+187/+387) were generated by use of common forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and different reverse (5′-CCC AAA AGA GGA TCC CAA CTC-3′, 5′-CCA TTA GCA GGG CAC GAA C-3′, and 5′-CCA ACT TCC TGC TCT CAC ACA-3′) primers, respectively.

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency. .. Amplification of 16S rRNA genes from archaea and bacteria was performed with the archaeal primer set 340F and 1000R [ ], giving a 650 bp amplicon product, and the bacterial primer sets 27F and 515R [ , ], yielding a 500 bp amplicon product.

Construct:

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Paragraph title: Plasmid constructs and gene-silencing reagents ... Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories).

CRISPR:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: sgRNAs for CRISPR-mediated knock-in was transcribed in vitro following the published protocol . .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Paragraph title: CRISPR/Cas9-mediated genome editing ... The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Nested PCR:

Article Title: IFN-gamma and TNF associated with severe falciparum malaria infection in Saudi pregnant women
Article Snippet: Nested PCR was performed to determine the numbers of msp2 (FC27) clone. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Nested PCR was performed to determine the numbers of msp2 (FC27 and 3D7) clones. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Chloramphenicol Acetyltransferase Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Plasmid Preparation:

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. PCR products were separated by agarose gel electrophoresis, and appropriate bands were cut-out and sequenced to determine the genotype and whether one or both alleles had been mutated.

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: Paragraph title: Plasmid constructs and gene-silencing reagents ... Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories).

Software:

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′. .. PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′.

Real-time Polymerase Chain Reaction:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Reverse oligonucleotides also contained 12 unique 8-mer barcodes for multiplexing of up to 12 samples per lane ( ). .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Multiplex Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency. .. Amplification of 16S rRNA genes from archaea and bacteria was performed with the archaeal primer set 340F and 1000R [ ], giving a 650 bp amplicon product, and the bacterial primer sets 27F and 515R [ , ], yielding a 500 bp amplicon product.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. Bacterial and archaeal 16S rRNA amplification was carried out with the bacterial primer set 27F and 515R , giving an around 500 bp amplicon product; and the archaeal primer set 340F and 1000R , yielding an around 650 bp amplicon product.

Selection:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Size selection (150–350 bp) of exome library fragments was then performed using an E-Gel® electrophoresis system with a 2% agarose gel (Thermo Fisher Scientific, MA, USA). .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Agarose Gel Electrophoresis:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Size selection (150–350 bp) of exome library fragments was then performed using an E-Gel® electrophoresis system with a 2% agarose gel (Thermo Fisher Scientific, MA, USA). .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The following PCR program was used: denaturation at 98°C for 30 s, 30 cycles of 10 s at 98°C, 30 s at 58°C, and 40 s at 72°C and a final extension at 72°C for 7 min. PCR product concentrations were measured by Qubit® fluorometer using Qubit® dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and checked by gel electrophoresis (1% agarose gel).

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For the amplification reaction we used the following primers pairs: the forward 5′-CCTGATTCCCTGGATTGTTG-3′ and reverse 5′-CAGGATGGTTCAGCTGGTTT-3′ primers to amplified the KO CK2α sequence; The forward 5′-CGCTCCTCCTCTTGCTTG-3′ and reverse 5′-ACCCATAGGAAGCCCAAAGT-3′ primers to amplified the KO CK2α’ sequence; The forward 5′-GCTTGGAGATGCTTCAGAGG-3′ and reverse 5′-GGCTTTGCACATTACCCAAC-3′ primers to amplified the KO CK2β sequence.

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency. .. The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

In Vitro:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Preparation and electroporation of Cas9/sgRNA RNP All synthetic nuclei acid reagents were purchased from Integrated DNA Technologies (IDT). sgRNAs and Cas9/sgRNA RNP complexes were prepared using the following procedure . sgRNAs were obtained by in vitro transcribing DNA templates containing a T7 promoter (TAATACGACTCACTATAG), the gene-specific 20-nt sgRNA sequence and a common sgRNA scaffold region. .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: Paragraph title: sgRNA in vitro transcription ... For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: Paragraph title: sgRNA in Vitro Transcription. ... For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Electrophoresis:

Article Title: Tracing the origin of disseminated tumor cells in breast cancer using single-cell sequencing
Article Snippet: Size selection (150–350 bp) of exome library fragments was then performed using an E-Gel® electrophoresis system with a 2% agarose gel (Thermo Fisher Scientific, MA, USA). .. Exome libraries were amplified using an amplification master mix consisting of 1.5 μl universal primer, 1.5 μl index primer, 125 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA), and 72.5 μl MQ water.

Next-Generation Sequencing:

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: Paragraph title: Next generation sequencing with single-molecule molecular inversion probes ... After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad).

Spectrophotometry:

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: DNA quantification was done using a NanoDrop 2000c spectrophotometer and solutions were stored at −20 °C until amplification by PCR. .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Article Title: Trans genomic capture and sequencing of primate exomes reveals new targets of positive selection
Article Snippet: The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp). .. The adapter-ligated fragments were PCR-amplified in four reactions per sample, each in a total volume of 40 μL (10 μL of adapter-ligated fragments, 1× iProof High Fidelity Master Mix [Bio-Rad], and 0.625 μM both SLXA_Pair_For_Amp and SLXA_Pair_Rev_Amp).

Concentration Assay:

Article Title: Characterization of the cecum microbiome from wild and captive rock ptarmigans indigenous to Arctic Norway
Article Snippet: The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency. .. The 16SrRNA gene for archaea and bacteria was amplified in an Eppendorf Mastercycler Gradient (Eppendorf AG, Hamburg, Germany) with a 25 μL reaction volume containing 12.5 μl of iProof High-Fidelity Master Mix (BioRad), 1 μl of each primer (400 nM), 1 μl of DNA template, and 1.25 μl of dimethyl sulfoxide (DMSO) to increase reaction efficiency.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

DNA Purification:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: For this purpose genomic DNA of clonal cell lines was extracted using the genomic DNA purification kit (Thermo Fisher). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

CTG Assay:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: A scalable strategy for high-throughput GFP tagging of endogenous human proteins
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template a 100-μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents supplemented with 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Article Title: Elk-3 is a KLF4-regulated gene that modulates the phagocytosis of bacteria by macrophages
Article Snippet: The Elk-3 gene, including the promoter region, was isolated from a bacteriophage artificial chromosome library, derived from mouse spleen genomic DNA (RPCI22.HYB; BACPAC Resources Center, Oakland, CA, USA). .. Forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and reverse (5′-CGA AAA CTA CTG GTC AGA AAG-3′) primers were used to amplify region 93310772-93311934 of chromosome 10 and designated this promoter region as Elk-3 (–775/+387) by iProof High-Fidelity Master Mix (Bio-Rad Laboratories). .. Deletion constructs Elk-3 (–463/+387), Elk-3 (–163/+387), and Elk-3 (+187/+387) were generated by use of common forward (5′-GGG AGT CTT CTT GGG GAG A-3′) and different reverse (5′-CCC AAA AGA GGA TCC CAA CTC-3′, 5′-CCA TTA GCA GGG CAC GAA C-3′, and 5′-CCA ACT TCC TGC TCT CAC ACA-3′) primers, respectively.

Staining:

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: PCR amplicons spanning the sgRNA genomic target sites were generated using the iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) with the following primer pairs: IL2RG _fw: 5′-TCACACAGCACATATTTGCCACACCCTCTG-3′; IL2RG _RV: 5′-TGCCCACATGATTGTAATGGCCAGTGG-3′; HBB _fw: 5′-CCAACTCCT AAGCCAGTGCCAGAAGAG-3′; HBB _rv: 5′-AGTCAGTGCCTATCAGAAAC CCAAGAG-3′; CCR5 _fw: 5′-GCACAGGGTGGAACAAGATGG-3′; CCR5_rv: 5′-CACCACCCCAAAGGTGACCGT-3′. .. For T7 assays, PCR amplicons were purified and 200 ng was denatured and re-annealed in a thermocycler and digested with T7 Endonuclease I (New England Biolabs, Waltham, MA, USA) according to manufacturer’s protocol.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Multiplicity of Plasmodium falciparum infection in asymptomatic children in Senegal: relation to transmission, age and erythrocyte variants
Article Snippet: Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs. .. One microliter of PCR product was reamplified in a pair of reactions using primers specific for FC27 and IC/3D7 allelic types of msp2 , using following program: 30 sec at 98°C; 25 cycles of 98°C/10 sec, 61°C/20 sec, 72°C/10 sec; and a final extension for five minutes.

Variant Assay:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Sequencing reads were aligned to hg19 using BWA .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Bio-Rad iproof high fidelity master mix
    Iproof High Fidelity Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iproof high fidelity master mix/product/Bio-Rad
    Average 98 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    iproof high fidelity master mix - by Bioz Stars, 2019-10
    98/100 stars
      Buy from Supplier

    80
    Bio-Rad iproof high fidelity dna polymerase master mix
    Iproof High Fidelity Dna Polymerase Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iproof high fidelity dna polymerase master mix/product/Bio-Rad
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    iproof high fidelity dna polymerase master mix - by Bioz Stars, 2019-10
    80/100 stars
      Buy from Supplier

    Image Search Results