Structured Review

Bio-Rad iproof high fidelity master mix
Iproof High Fidelity Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/iproof high fidelity master mix/product/Bio-Rad
Average 97 stars, based on 34 article reviews
Price from $9.99 to $1999.99
iproof high fidelity master mix - by Bioz Stars, 2020-02
97/100 stars

Images

Related Articles

Clone Assay:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For clonal lines presenting heterozygous genotype where allelic events were unclear the same PCR products were cloned in pGEM-T-Easy vector and 10–12 single bacterial colonies were sequenced and analyzed.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Amplification:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Paragraph title: Bacterial SSU rRNA gene amplification and 454 pyrosequencing ... Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Impact of Host Cell Line Adaptation on Quasispecies Composition and Glycosylation of Influenza A Virus Hemagglutinin
Article Snippet: .. For reverse transcription of the RNA genome segment, the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Mannheim, Germany) and for amplification of the cDNA the iProof High-Fidelity Master Mix (Bio-Rad Laboratories GmbH, München, Germany) was used. .. The sequencing libraries were generated according to Wiley et al. followed by DNA binding to library capture beads and the recovery of single-stranded template DNA (sstDNA) library.

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For the amplification reaction we used the following primers pairs: the forward 5′-CCTGATTCCCTGGATTGTTG-3′ and reverse 5′-CAGGATGGTTCAGCTGGTTT-3′ primers to amplified the KO CK2α sequence; The forward 5′-CGCTCCTCCTCTTGCTTG-3′ and reverse 5′-ACCCATAGGAAGCCCAAAGT-3′ primers to amplified the KO CK2α’ sequence; The forward 5′-GCTTGGAGATGCTTCAGAGG-3′ and reverse 5′-GGCTTTGCACATTACCCAAC-3′ primers to amplified the KO CK2β sequence.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: Paragraph title: DNA extraction and PCR amplification. ... PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. The PCR product was gel-extracted and cloned into pGEM-T Easy (Promega).

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: .. For sequencing of TOPO-cloned PCR fragments a 2.1 kb amplicon (WT size) spanning the cleavage site(s) was generated using iProof High-Fidelity Master Mix and primers 5′-ggctgttgtcatctatgaccttccc-3′ and 5′-tgtaaactgagcttgctcgctcg-3′ with 25 cycles including 72 °C annealing temperature, and 2 min elongation time. .. The PCR reaction products were subcloned into a plasmid directly using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer’s protocol.

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: A phleomycin cassette ( PhleoR ) was amplified from pAN8‐1 using the primers pAN8f and pAN8r, as described previously (Solomon et al ., ). .. The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA). .. The amplification master mix (255 μl) and MQ water was added to 125 ng of the template to a total volume of 500 μl, spread across five wells at a reaction volume of 100 μl.

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

CRISPR:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: sgRNAs for CRISPR-mediated knock-in was transcribed in vitro following the published protocol . .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Paragraph title: CRISPR/Cas9-mediated genome editing ... The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Construct:

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: Paragraph title: Development of the ToxA knockout construct ... The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

Real-time Polymerase Chain Reaction:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Incubation:

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Following A-base addition, adaptors were ligated onto the DNA fragments by an adaptor ligation master mix and each sample was incubated at 16°C for 20 min. Adaptor ligation master mix was made out of 5 μl 10× T4 Ligase Buffer (New England Biolabs, Ipswich, MA, USA), 5 μl adaptor (50 μM), and 2 μl T4 DNA Ligase (2000 U/μl) (New England Biolabs, Ipswich, MA, USA) to each sample. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. Following a 4 h incubation at 37 °C, the sgRNA product was purified and eluted in 15 μL of RNAse-free RNA buffer (10 mM Tris pH 7.0 in DEPC-treated water).

Spectrophotometry:

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: DNA quantification was done using a NanoDrop 2000c spectrophotometer and solutions were stored at −20 °C until amplification by PCR. .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Knock-In:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: sgRNAs for CRISPR-mediated knock-in was transcribed in vitro following the published protocol . .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Western Blot:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The absence of the specific CK2 subunits was verified by western blotting, kinase activity assay and sanger sequence analysis. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Kinase Assay:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: The absence of the specific CK2 subunits was verified by western blotting, kinase activity assay and sanger sequence analysis. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Chloramphenicol Acetyltransferase Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Countercurrent Chromatography:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Electroporation:

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Paragraph title: Preparation and electroporation of Cas9/sgRNA RNP ... For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Sequencing:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Impact of Host Cell Line Adaptation on Quasispecies Composition and Glycosylation of Influenza A Virus Hemagglutinin
Article Snippet: Paragraph title: Pyrosequencing and sequence assembly ... For reverse transcription of the RNA genome segment, the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Mannheim, Germany) and for amplification of the cDNA the iProof High-Fidelity Master Mix (Bio-Rad Laboratories GmbH, München, Germany) was used.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The following sequence was used as the DNA template to transcribe sgRNAs in vitro: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTTAAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene specific ∼20-nt protospacer sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA scaffold region. .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. The purified libraries were prepared for sequencing on a NextSeq 500 instrument (Illumina, San Diego, CA) according to the manufacturer’s protocol (300 cycles Mid Output sequencing kit, v2), resulting in 2 × 150 bp paired-end reads.

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Sanger sequencing was performed on PCR products amplified from genomic DNA spanning the crispr RNA target. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: .. For sequencing of TOPO-cloned PCR fragments a 2.1 kb amplicon (WT size) spanning the cleavage site(s) was generated using iProof High-Fidelity Master Mix and primers 5′-ggctgttgtcatctatgaccttccc-3′ and 5′-tgtaaactgagcttgctcgctcg-3′ with 25 cycles including 72 °C annealing temperature, and 2 min elongation time. .. The PCR reaction products were subcloned into a plasmid directly using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer’s protocol.

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: Incorporated into the 5′ regions of the PtrToxA3′f and PtrToxA5′r primers were 25 bp and 23 bp of sequence homologous to the 3′ and 5′ ends of the phleomycin fragment. .. The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Paragraph title: Whole-genome sequencing library preparation of DTCs ... Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Paragraph title: Deep sequencing of mutation sites ... Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Preparation and electroporation of Cas9/sgRNA RNP All synthetic nuclei acid reagents were purchased from Integrated DNA Technologies (IDT). sgRNAs and Cas9/sgRNA RNP complexes were prepared using the following procedure . sgRNAs were obtained by in vitro transcribing DNA templates containing a T7 promoter (TAATACGACTCACTATAG), the gene-specific 20-nt sgRNA sequence and a common sgRNA scaffold region. .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Ligation:

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: .. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: After adaptor ligation the sample libraries were PCR-amplified for 12 cycles. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Generated:

Article Title: Impact of Host Cell Line Adaptation on Quasispecies Composition and Glycosylation of Influenza A Virus Hemagglutinin
Article Snippet: For reverse transcription of the RNA genome segment, the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Mannheim, Germany) and for amplification of the cDNA the iProof High-Fidelity Master Mix (Bio-Rad Laboratories GmbH, München, Germany) was used. .. The sequencing libraries were generated according to Wiley et al. followed by DNA binding to library capture beads and the recovery of single-stranded template DNA (sstDNA) library.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: .. For sequencing of TOPO-cloned PCR fragments a 2.1 kb amplicon (WT size) spanning the cleavage site(s) was generated using iProof High-Fidelity Master Mix and primers 5′-ggctgttgtcatctatgaccttccc-3′ and 5′-tgtaaactgagcttgctcgctcg-3′ with 25 cycles including 72 °C annealing temperature, and 2 min elongation time. .. The PCR reaction products were subcloned into a plasmid directly using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer’s protocol.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Impact of Host Cell Line Adaptation on Quasispecies Composition and Glycosylation of Influenza A Virus Hemagglutinin
Article Snippet: RT-PCR was conducted as described by Höper et al. . .. For reverse transcription of the RNA genome segment, the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Mannheim, Germany) and for amplification of the cDNA the iProof High-Fidelity Master Mix (Bio-Rad Laboratories GmbH, München, Germany) was used.

Binding Assay:

Article Title: Impact of Host Cell Line Adaptation on Quasispecies Composition and Glycosylation of Influenza A Virus Hemagglutinin
Article Snippet: For reverse transcription of the RNA genome segment, the Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Mannheim, Germany) and for amplification of the cDNA the iProof High-Fidelity Master Mix (Bio-Rad Laboratories GmbH, München, Germany) was used. .. The sequencing libraries were generated according to Wiley et al. followed by DNA binding to library capture beads and the recovery of single-stranded template DNA (sstDNA) library.

Cellular Antioxidant Activity Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The forward primer is a combination of the 454 fusion adapter B sequence and universal bacterial primer 8F, 5′-CCT ATC CCC TGT GTG CCT TGG CAG TCT CAG CAA CAG CT A GAG TTT GAT CCT GG-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

DNA Extraction:

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: Paragraph title: DNA extraction and PCR amplification. ... PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency.

Nucleic Acid Electrophoresis:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The following PCR program was used: denaturation at 98°C for 30 s, 30 cycles of 10 s at 98°C, 30 s at 58°C, and 40 s at 72°C and a final extension at 72°C for 7 min. PCR product concentrations were measured by Qubit® fluorometer using Qubit® dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and checked by gel electrophoresis (1% agarose gel).

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: Paragraph title: PCR and gel electrophoresis ... The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Fluorescence:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Forty-eight hours post-transfection, cells were pelleted in PBS and sorted in 96-well plates using fluorescence-activated cell sorting (FACS) with a FACSAria II cell sorter (BD BioSciences). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Mutagenesis:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Paragraph title: Deep sequencing of mutation sites ... Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Multiplexing:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Reverse oligonucleotides also contained 12 unique 8-mer barcodes for multiplexing of up to 12 samples per lane ( ). .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green.

Purification:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The band containing pooled PCR products was excised and purified using NucleoSpin Extract II kit (Macherey-Nagel, Düren, Germany).

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA). .. After each step described above, samples were column cleaned using the QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA).

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Amplicons were purified using Ampure beads (Agencourt) and directly sequenced on an Illumina HiSeq 2000 using 100 bp paired-end reads.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. The PCR product was purified and eluted in 12 μL of RNAse-free DNA buffer (2 mM Tris pH 8.0 in DEPC-treated water).

Polymerase Chain Reaction:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The following PCR program was used: denaturation at 98°C for 30 s, 30 cycles of 10 s at 98°C, 30 s at 58°C, and 40 s at 72°C and a final extension at 72°C for 7 min. PCR product concentrations were measured by Qubit® fluorometer using Qubit® dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and checked by gel electrophoresis (1% agarose gel).

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents. .. The PCR product was then purified using DNA Clean and Concentrator-5 columns (Zymo Research) following the manufacturer’s instructions.

Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
Article Snippet: .. Prepare a PCR master mix by combining 12.5 μL of 2 × iProof High Fidelity Master Mix, 0.125 μL of 100 μM universal MIP barcode forward primer, and 6.25 μL of nuclease-free water. .. Add 18.75 μL of RT-PCR master mix to each well.

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: .. After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad). .. PCR reactions of the different samples were pooled, and purified with 0.8 x volume of Agencourt Ampure XP Beads (Beckman Coulter, Brea, CA).

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad). .. For the amplification reaction we used the following primers pairs: the forward 5′-CCTGATTCCCTGGATTGTTG-3′ and reverse 5′-CAGGATGGTTCAGCTGGTTT-3′ primers to amplified the KO CK2α sequence; The forward 5′-CGCTCCTCCTCTTGCTTG-3′ and reverse 5′-ACCCATAGGAAGCCCAAAGT-3′ primers to amplified the KO CK2α’ sequence; The forward 5′-GCTTGGAGATGCTTCAGAGG-3′ and reverse 5′-GGCTTTGCACATTACCCAAC-3′ primers to amplified the KO CK2β sequence.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: .. PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. Bacterial and archaeal 16S rRNA amplification was carried out with the bacterial primer set 27F and 515R , giving an around 500 bp amplicon product; and the archaeal primer set 340F and 1000R , yielding an around 650 bp amplicon product.

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: Paragraph title: PCR and gel electrophoresis ... The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Article Title: Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells
Article Snippet: .. For sequencing of TOPO-cloned PCR fragments a 2.1 kb amplicon (WT size) spanning the cleavage site(s) was generated using iProof High-Fidelity Master Mix and primers 5′-ggctgttgtcatctatgaccttccc-3′ and 5′-tgtaaactgagcttgctcgctcg-3′ with 25 cycles including 72 °C annealing temperature, and 2 min elongation time. .. The PCR reaction products were subcloned into a plasmid directly using the Zero Blunt TOPO PCR Cloning Kit (Life Technologies) according to the manufacturer’s protocol.

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: .. The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min. .. The fusion PCR product (5624 bp) was gel extracted and resuspended in sterile water.

Article Title: IFN-gamma and TNF associated with severe falciparum malaria infection in Saudi pregnant women
Article Snippet: Parasite genotype Five μl of DNA samples were used to detect the P. falciparum malaria parasite using a polymerase chain reaction (PCR), targeting for msp2 (FC27) clone as described in details below. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Article Title: Next-Generation Sequencing of Disseminated Tumor Cells
Article Snippet: After adaptor ligation the sample libraries were PCR-amplified for 12 cycles. .. Amplification master mix consisted of 2.5 μl universal primer, 2.5 μl index primer, and 250 μl 2× iProof High-Fidelity Master Mix (Bio-Rad Laboratories, Hercules, CA, USA).

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer. .. The PCR product was purified and eluted in 12 μL of RNAse-free DNA buffer (2 mM Tris pH 8.0 in DEPC-treated water).

FACS:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Forty-eight hours post-transfection, cells were pelleted in PBS and sorted in 96-well plates using fluorescence-activated cell sorting (FACS) with a FACSAria II cell sorter (BD BioSciences). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Staining:

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

Nested PCR:

Article Title: IFN-gamma and TNF associated with severe falciparum malaria infection in Saudi pregnant women
Article Snippet: Nested PCR was performed to determine the numbers of msp2 (FC27) clone. .. Amplifications were done in 10 μl reaction mixture containing DNA template, iProof™ High-Fidelity Master Mix (BIO-RAD Laboratories, Hercules, CA) and 500 nM of primer pairs.

Activated Clotting Time Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The following sequence was used as the DNA template to transcribe sgRNAs in vitro: 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTTAAG AGC TAT GCT GGA AAC AGC ATA GCA AGT TTA AAT AAG GCT AGT CCG TTA TCA ACT TGA AAA AGT GGC ACC GAG TCG GTG CTT TTT TT-3′ containing a T7 promoter (TAATACGACTCACTATAG), a gene specific ∼20-nt protospacer sequence starting with a G for optimal T7 transcription (GNNNNNNNNNNNNNNNNNNN), and a common sgRNA scaffold region. .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Plasmid Preparation:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: Cells were co-transfected with 1 μg of sgRNA plasmid and Lipofectamine 3000 according to manufacturing instructions. .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ]. .. Plasmids were recovered from E . coli cultures using the GenEluteTM HP plasmid Miniprep Kit (Sigma) and digested with EcoR I (NEB) to confirm the PCR insert size.

SYBR Green Assay:

Article Title: De novo germline and postzygotic mutations in AKT3, PIK3R2 and PIK3CA cause a spectrum of related megalencephaly syndromes
Article Snippet: .. Amplification was carried out in a MiniOpticon Real-time PCR system (Bio-Rad) using the iProof High-Fidelity Master Mix (Bio-Rad), 50 ng of genomic DNA, and SYBR Green. .. Samples were removed from the PCR machine before fluorescence began to plateau.

Multiplex Assay:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: The reverse primer is a combination of the 454 fusion adapter A sequence including a unique 8 nt multiplex barcode, represented by Ns, and universal bacterial primer 515 R, 5′-CCA TCT CAT CCC TGC GTG TCT CCG ACT CAG NNN NNN NN T TAC CGC GGC TGC T-3′. .. Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL.

Article Title: First insight into the faecal microbiota of the high Arctic muskoxen (Ovibos moschatus)
Article Snippet: PCR amplifications for Bacteria and Archaea were performed in an Eppendorf Mastercycler Gradient in 25 µl reaction volumes, with 12.5 µl of iProof High-Fidelity Master Mix (BioRad), 1 µl of each primer (400 nM), 1 µl of the corresponding DNA template and 1.25 µl DMSO to increase PCR efficiency. .. The reverse primer included an 8 nt Multiplex Identifier (MID) ( ) for sample identification in downstream analysis.

Agarose Gel Electrophoresis:

Article Title: Resistant starch diet induces change in the swine microbiome and a predominance of beneficial bacterial populations
Article Snippet: Each PCR reaction consisted of 25 μl iProof High-Fidelity Master Mix (BioRad, Hercules, CA, USA), 0.2 mM forward primer, 0.2 mM reverse primer, 400 ng template DNA, and sterile water to a total volume of 50 uL. .. The following PCR program was used: denaturation at 98°C for 30 s, 30 cycles of 10 s at 98°C, 30 s at 58°C, and 40 s at 72°C and a final extension at 72°C for 7 min. PCR product concentrations were measured by Qubit® fluorometer using Qubit® dsDNA BR Assay Kit (Invitrogen, Eugene, OR, USA) and checked by gel electrophoresis (1% agarose gel).

Article Title: Genomic distribution of a novel Pyrenophora tritici-repentis ToxA insertion element
Article Snippet: PCR products were visualized by gel electrophoresis on 1.5% agarose gel and stained using SYBR safe DNA Gel stain (Life Technologies, Carlsbad, CA, USA). .. The 1630 bp region containing the ORF of the ToxA gene was amplified with ToxA1630F 5’ ACCATAGGCGACCGAGTAGA 3’ and ToxA1630R 5’ GATGGCGCCCGTGATAAATG 3’ using iProof High-Fidelity Master Mix (Bio-Rad, Hercules, CA, USA) as described in Moffat et al., 2014 [ ].

In Vitro:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: Paragraph title: sgRNA in vitro transcription ... For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: Preparation and electroporation of Cas9/sgRNA RNP All synthetic nuclei acid reagents were purchased from Integrated DNA Technologies (IDT). sgRNAs and Cas9/sgRNA RNP complexes were prepared using the following procedure . sgRNAs were obtained by in vitro transcribing DNA templates containing a T7 promoter (TAATACGACTCACTATAG), the gene-specific 20-nt sgRNA sequence and a common sgRNA scaffold region. .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Next-Generation Sequencing:

Article Title: Identification of novel GNAS mutations in intramuscular myxoma using next-generation sequencing with single-molecule tagged molecular inversion probes
Article Snippet: Paragraph title: Next generation sequencing with single-molecule molecular inversion probes ... After extension, ligation and exonuclease treatment, PCR reactions were performed with barcoded reverse primers and iProof high-fidelity master-mix (Biorad).

Knock-Out:

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: Paragraph title: Development of the ToxA knockout construct ... The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

Concentration Assay:

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: Fragments were gel extracted using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and equimolar amounts were combined as template for a single fusion PCR using primers PtrToxA5′f and PtrToxA3′r at a final concentration of 50 μ m . .. The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

DNA Purification:

Article Title: Generation and quantitative proteomics analysis of CK2α/α’(−/−) cells
Article Snippet: For this purpose genomic DNA of clonal cell lines was extracted using the genomic DNA purification kit (Thermo Fisher). .. The obtained DNA, after spectrophotometric quantification was amplified by PCR using iProof High-Fidelity Master Mix (Bio-Rad).

CTG Assay:

Article Title: Efficient labeling and imaging of protein-coding genes in living cells using CRISPR-Tag
Article Snippet: The DNA template was generated by overlapping PCR using a set of four primers: three primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG GNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100 μL PCR was set using iProof High-Fidelity Master Mix (Bio-Rad) reagents.

Article Title: Improved split fluorescent proteins for endogenous protein labeling
Article Snippet: DNA templates were generated by overlapping PCR using a set of 4 primers: 3 primers common to all reactions (forward primer T25: 5′-TAA TAC GAC TCA CTA TAG-3′; reverse primer BS7: 5′-AAA AAA AGC ACC GAC TCG GTG C-3′ and reverse primer ML611: 5′-AAA AAA AGC ACC GAC TCG GTG CCA CTT TTT CAA GTT GAT AAC GGA CTA GCC TTA TTT AAA CTT GCT ATG CTG TTT CCA GCA TAG CTC TTA AAC-3′) and one gene-specific primer (forward primer 5′-TAA TAC GAC TCA CTA TAG NNN NNN NNN NNN NNN NNN NNG TTT AAG AGC TAT GCT GGA A-3′). .. For each template, a 100-μL PCR was performed with iProof High-Fidelity Master Mix (BioRad) reagents with the addition of 1 μM T25, 1 μM BS7, 20 nM ML611, and 20 nM gene-specific primer.

Gel Extraction:

Article Title: Generation of a ToxA knockout strain of the wheat tan spot pathogen Pyrenophora tritici‐repentis
Article Snippet: Fragments were gel extracted using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and equimolar amounts were combined as template for a single fusion PCR using primers PtrToxA5′f and PtrToxA3′r at a final concentration of 50 μ m . .. The fusion PCR was performed using iProof High‐Fidelity Master Mix (Bio‐Rad, Hercules, CA, USA) with the following cycling conditions: 98 °C/30 s; (98 °C/5 s, 67 °C/30 s, 72 °C/5 min) × 35; 72 °C/5 min.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Bio-Rad iproof high fidelity master mix
    Iproof High Fidelity Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 97/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/iproof high fidelity master mix/product/Bio-Rad
    Average 97 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    iproof high fidelity master mix - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    Image Search Results