in fusion hd cloning plus ce kit  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    In Fusion HD Cloning Plus CE
    Description:
    In Fusion HD Cloning Plus products enable directional seamless cloning of any PCR fragment or multiple fragments into any linearized vector in a single 15 minute reaction No additional treatment of the PCR fragment such as restriction digestion ligation phosphorylation or blunt end polishing is required The efficiency of In Fusion HD Cloning Plus is over 95 providing confidence in your clones and enabling you to scale up for high throughput workflows
    Catalog Number:
    638919
    Price:
    None
    Size:
    96 Rxns
    Category:
    In Fusion HD Cloning Plus In Fusion Cloning Cloning
    Buy from Supplier


    Structured Review

    TaKaRa in fusion hd cloning plus ce kit
    In Fusion HD Cloning Plus products enable directional seamless cloning of any PCR fragment or multiple fragments into any linearized vector in a single 15 minute reaction No additional treatment of the PCR fragment such as restriction digestion ligation phosphorylation or blunt end polishing is required The efficiency of In Fusion HD Cloning Plus is over 95 providing confidence in your clones and enabling you to scale up for high throughput workflows
    https://www.bioz.com/result/in fusion hd cloning plus ce kit/product/TaKaRa
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    in fusion hd cloning plus ce kit - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: .. Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The four constructs were examined by sequencing before transformation in Agrobacterium tumefaciens strain C58C1.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. UFD2-HA was then sub-cloned into YCplac111 vector (Agilent Technologies) as a Sma I fragment.

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: .. The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: .. Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA. .. The plasmids were transfected into MCF-7 cells using the Transfection reagent X-Fect kit (Clontech, CA, USA.

    Article Title: Abscisic acid controlled sex before transpiration in vascular plants
    Article Snippet: .. These three fragments were then cloned into pFF19 ( ) between the 35S promoter and poly(A)+ addition site, using the In-Fusion HD Cloning Plus CE kit (Clontech). ..

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone. .. The pGP-CMV-jGCaMP7f plasmid was a gift from Douglas Kim (Addgene plasmid # 104483) ( ).

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: .. Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. The PCR products were treated with Cloning Enhancer (Clontech) and subjected to InFusion cloning reactions with the linearized pattB-Gal4-hsp70 vector.

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: .. The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ). .. Chemically competent BL21 E. coli cells harboring the pAC-85b plasmid were prepared and transformed with the pTHIO plasmids harboring the CsPSY genes and the pAtPSY plasmid harboring the PSY of Arabidopsis used as a positive control.

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Amplification:

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. GAL4AD UFD2 fusion was obtained by PCR amplification of UFD2 gene lacking the ATG codon (oligonucleotides 8 and 9, supplementary material Table S3 ) and subsequent cloning into the pGADT7-Rec vector (Clontech Laboratories, Inc.), previously linearized with Sma I. Sequence integrity of UFD2 constructions was confirmed by sequencing with the oligonucleotides listed in supplementary material Table S3 (oligonucleotides 5 to 7).

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: .. The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: A fragment (∼770 bp) upstream of ATG in the Chrm2 gene that contains RE1 binding sites was amplified using paired primers: GCG AAG CTT GGC CAG AGC TAC CTC TTC TGC AA and GCG CCA TGG TTT GTG TTC AGT AGT CAA GTG GCC A. .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing.

    Positive Control:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ). .. Chemically competent BL21 E. coli cells harboring the pAC-85b plasmid were prepared and transformed with the pTHIO plasmids harboring the CsPSY genes and the pAtPSY plasmid harboring the PSY of Arabidopsis used as a positive control.

    Construct:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The four constructs were examined by sequencing before transformation in Agrobacterium tumefaciens strain C58C1.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone. .. The pGP-CMV-jGCaMP7f plasmid was a gift from Douglas Kim (Addgene plasmid # 104483) ( ).

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. We transformed the DNA constructs into Stellar competent cells (Clontech) and validated clones by Sanger sequencing .

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Luciferase:

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Paragraph title: In-vivo promoter luciferase assays ... Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT.

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: After digestion with HindIII and NcoI, the sequence was ligated to pGL3 luciferase reporter vectors (E1751, Promega, Madison, WI) to generate a proM2::Luc (WT version) vector. .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing.

    Expressing:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The transient expression of the CsPSY genes has been performed by agroinfiltration of Nicotiana benthamiana leaves as previously described ( ).

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Transformation Assay:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The four constructs were examined by sequencing before transformation in Agrobacterium tumefaciens strain C58C1.

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. Then, pThio-CCD4b1 was transformed into Escherichia coli BL21 (Tuner DE3, Novagen) cells harbouring pGro7, a plasmid encoding the groES–groEL–chaperone system under the control of an arabinose-inducible promoter ( ; TAKARA BIO INC.).

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. We transformed the DNA constructs into Stellar competent cells (Clontech) and validated clones by Sanger sequencing .

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: The E. coli cells transformed with pAC-85b could not synthesize any carotenoid, which resulted in white bacterial colonies. .. The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ).

    Over Expression:

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: Paragraph title: Overexpression of lncRNAs ... Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA.

    Countercurrent Chromatography:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Transfection:

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA. .. The plasmids were transfected into MCF-7 cells using the Transfection reagent X-Fect kit (Clontech, CA, USA.

    Ligation:

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: .. Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA. .. The plasmids were transfected into MCF-7 cells using the Transfection reagent X-Fect kit (Clontech, CA, USA.

    Cell Culture:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ). .. The overnight cultures were used to inoculate 50 mL 2× YT and cultured at 30°C until an optical density of 0.8 at 600 nm (OD600 ) was reached.

    Generated:

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. UFD2-HA was then sub-cloned into YCplac111 vector (Agilent Technologies) as a Sma I fragment.

    DNA Sequencing:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Polymerase Chain Reaction:

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: UFD2 deletions were confirmed by PCR using genomic DNA and UFD2 specific oligonucleotides ( supplementary material Table S3 , oligonucleotides 3 and 4). .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA .

    Article Title: Abscisic acid controlled sex before transpiration in vascular plants
    Article Snippet: 35S::hpGAIA1 was made by amplifying two 300-bp PCR GAIA1 fragments from cDNA, using primer pairs listed in , and by amplifying the Ricinus communis Catalase Intron 1 from the 35S:irint ( ). .. These three fragments were then cloned into pFF19 ( ) between the 35S promoter and poly(A)+ addition site, using the In-Fusion HD Cloning Plus CE kit (Clontech).

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. The PCR products were treated with Cloning Enhancer (Clontech) and subjected to InFusion cloning reactions with the linearized pattB-Gal4-hsp70 vector.

    Injection:

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Binding Assay:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Cellular Antioxidant Activity Assay:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: A fragment (∼770 bp) upstream of ATG in the Chrm2 gene that contains RE1 binding sites was amplified using paired primers: GCG AAG CTT GGC CAG AGC TAC CTC TTC TGC AA and GCG CCA TGG TTT GTG TTC AGT AGT CAA GTG GCC A. .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing.

    In Vivo:

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Paragraph title: In-vivo promoter luciferase assays ... Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT.

    Fluorescence:

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Mutagenesis:

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: To generate the yap8ufd2 double mutant, the UFD2 gene was disrupted in the yap8 mutant strain using the oligonucleotides 1 and 2 ( supplementary material Table S3 ) and the microhomology PCR method ( ). .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA .

    Purification:

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Transient expression, visible as jGCaMP7f or tdTomato fluorescence, was used to select injected embryos that were then raised to adulthood.

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: .. The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Article Title: Abscisic acid controlled sex before transpiration in vascular plants
    Article Snippet: Eight-day-old Hn-n (wild-type) gametophytes grown on media containing ACE were bombarded using a PDS 100 Helium System (BioRad), as described by Rutherford et al. , with one exception: 1.3 mM tungsten M-20 microcarriers (BioRad) were coated with plasmids purified using a NucleoBond Xtra Midi Plus kit (Macherey-Nagel). .. These three fragments were then cloned into pFF19 ( ) between the 35S promoter and poly(A)+ addition site, using the In-Fusion HD Cloning Plus CE kit (Clontech).

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone. .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage.

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. Purified constructs were subjected to PhiC31 transformation – in the Drosophila strain of genotype y w P [int , y + ]; P [attP2, y + ] where the attP2 landing site is located at 68A4 on the 3rd chromosome, by Model System Injections (Durham, NC).

    Sequencing:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The four constructs were examined by sequencing before transformation in Agrobacterium tumefaciens strain C58C1.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone. .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage.

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. GAL4AD UFD2 fusion was obtained by PCR amplification of UFD2 gene lacking the ATG codon (oligonucleotides 8 and 9, supplementary material Table S3 ) and subsequent cloning into the pGADT7-Rec vector (Clontech Laboratories, Inc.), previously linearized with Sma I. Sequence integrity of UFD2 constructions was confirmed by sequencing with the oligonucleotides listed in supplementary material Table S3 (oligonucleotides 5 to 7).

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: .. The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone. .. The pGP-CMV-jGCaMP7f plasmid was a gift from Douglas Kim (Addgene plasmid # 104483) ( ).

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT. .. We transformed the DNA constructs into Stellar competent cells (Clontech) and validated clones by Sanger sequencing .

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: After digestion with HindIII and NcoI, the sequence was ligated to pGL3 luciferase reporter vectors (E1751, Promega, Madison, WI) to generate a proM2::Luc (WT version) vector. .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing.

    IA:

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: Their sequences were synthetized as gBlocks (Integrated DNA technologies, IA, USA), designed to share 15 bp of homology at their ends with the vector digested with the restriction enzyme EcoRI (New England Biolabs, MA, USA. .. Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA.

    Activated Clotting Time Assay:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Plasmid Preparation:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: .. Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. The four constructs were examined by sequencing before transformation in Agrobacterium tumefaciens strain C58C1.

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: The pGP-CMV-jGCaMP7f plasmid was a gift from Douglas Kim (Addgene plasmid # 104483) ( ). .. As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage.

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. UFD2-HA was then sub-cloned into YCplac111 vector (Agilent Technologies) as a Sma I fragment.

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: .. The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech). .. The resulting expression plasmid, namely pThio-CCD4b1 , was sequenced to confirm the correct assembly and lack of sequence errors.

    Article Title: Transcriptome profile of the early stages of breast cancer tumoral spheroids
    Article Snippet: .. Ligation of the vector-gblocks was carried out using the In-Fusion HD Cloning Plus CE kit (Clontech, CA, USA. .. The plasmids were transfected into MCF-7 cells using the Transfection reagent X-Fect kit (Clontech, CA, USA.

    Article Title: Abscisic acid controlled sex before transpiration in vascular plants
    Article Snippet: Gametophytes were bombarded with a 35S::DsRed2 plasmid (described in ref. ) or cobombarded with the 35S::DsRed2 plasmid plus the hairpin-forming GAIA1 mRNA plasmid (called 35S::hpGAIA1). .. These three fragments were then cloned into pFF19 ( ) between the 35S promoter and poly(A)+ addition site, using the In-Fusion HD Cloning Plus CE kit (Clontech).

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: The pT1UciMP plasmid was a gift from Harold Burgess (Addgene plasmid # 62215) ( ). .. The cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: CoChR_fw, CTCAGCGTAAAGCCACCATGCTGGGAAACG CoChR_rev, TACTACCGGTGCCGCCACTGT CoChR_tdT_fw, ACAGTGGCGGCACCGGTAGTA tdT_rev, CTAGTCTCGAGATCTCCATGTTTACTTATACAGCTCATCCATGCC To generate the UAS:jGCaMP7f DNA construct used for creating the Tg(UAS:jGCaMP7f)u341Tg line, the coding sequence of the genetically encoded calcium indicator jGCaMP7f (from pGP-CMV-jGCaMP7f ) was cloned into the pT1UciMP UAS Tol1 backbone.

    Article Title: Regulation of Drosophila Lifespan by bellwether Promoter Alleles
    Article Snippet: In-vivo promoter luciferase assays We excised the 521 bp blw -promoter inserts from the pGL3-basic vector with Kpn1 and BglII and ligated them into the pattB-Gal4-synaptobrevin-hsp70 vector (Addgene; Plasmid #46107) after excision of the synaptobrevin promoter with BamH1 and EcoR1 . .. Since the inserts and plasmids contained incompatible ends, cloning was achieved using the In-Fusion® HD Cloning Plus CE kit (Clontech) with the following primers to amplify the blw -promoter inserts: blw -InFusion-F, 5′-TTATGCTAGCGGATCTGGCGGCGTCCACATATA and blw -InFusion-R, 5′- CTTCATGTTGGAATTACTGTTCGCCGCAGAAGT.

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: .. The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ). .. Chemically competent BL21 E. coli cells harboring the pAC-85b plasmid were prepared and transformed with the pTHIO plasmids harboring the CsPSY genes and the pAtPSY plasmid harboring the PSY of Arabidopsis used as a positive control.

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Functional Assay:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Paragraph title: Plasmids and Functional Complementation ... The CsPSY genes were cloned separately into the Eco RI site of the pBAD-Thio vector (Invitrogen ) by recombination using an In-Fusion® HD Cloning Plus CE kit (Clontech, see text footnote1 ) and specific primers ( ).

    In Vitro:

    Article Title: Pretectal neurons control hunting behaviour
    Article Snippet: As above, the cloning was achieved using the In-Fusion HD Cloning Plus CE kit (Clontech) with the following primers: UAS_jGCaMP7_fw, CGTAAAGCCACCATGGGTTCTCATC UAS_jGCaMP7_rev, CTCGAGATCTCCATGTTTACTTCGCTGTCATCATTTGTACAAAC To generate the Tg(UAS:jGCaMP7f) and the Tg(UAS:CoChR-tdTomato) lines, purified UAS:jGCaMP7f or UAS:CoChR-tdTomato DNA constructs (35 ng/µl) were co-injected with Tol1 transposase mRNA (80 ng/µl) into Tg(KalTA4u508) zebrafish embryos at the early one-cell stage. .. Tol1 transposase mRNA was prepared by in vitro transcription from NotI-linearised pCS2-Tol1.zf1 plasmid using the SP6 transcription mMessage mMachine kit (Life Technologies).

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: Paragraph title: Cloning Citrus CCD4b1 for in vitro assays ... The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech).

    Laser-Scanning Microscopy:

    Article Title: The Specialized Roles in Carotenogenesis and Apocarotenogenesis of the Phytoene Synthase Gene Family in Saffron
    Article Snippet: Cellular Localization The C-termini of CsPSY1a, CsPSY1a, CsPSY2, and CsPSY3 were fused to the N terminus of eGFP in the pBI-eGFP vector ( ) using an In-Fusion® HD Cloning Plus CE kit (Clontech ) and specific primers ( ). .. After 5–7 days postinfection, the leaves were analyzed using a confocal laser scanning microscope as previously reported ( ).

    DNA Purification:

    Article Title: A novel carotenoid cleavage activity involved in the biosynthesis of Citrus fruit-specific apocarotenoid pigments
    Article Snippet: The resulting amplicon was gel purified using the UltraClean DNA purification kit (MO BIO Laboratories). .. The purified CCD4b1 was subsequently amplified using the primers MJ301 (F-5′-CGCCCTTGGCGAATTCGCACCCATACAATCTTTAATGGG-3′) and MJ300 (F-5′-TACCCTCGAGGAATTCCGGGAATTCGATTTCATAAACTC-3′) and a high-fidelity polymerase (KAPA HiFi DNA Polymerase, KapaBiosystems) in order to clone this gene in-frame with the thioredoxin gene into the pBAD-Thio vector (Invitrogen) by recombination using the In-Fusion® HD Cloning Plus CE kit (Clontech).

    CTG Assay:

    Article Title: RE1-silencing transcription factor controls the acute-to-chronic neuropathic pain transition and Chrm2 receptor gene expression in primary sensory neurons
    Article Snippet: .. The vector for proM2-del-Luc (RE1-deleted version) was obtained by deleting the RE1 binding site from vector proM2 Δ RE1::Luc using the In-Fusion HD Cloning Plus kit (638916, Clontech Laboratories, Inc., Mountain View, CA) and the paired primers TAT ACT GTT CCC TGT CTG ACC AGG C and A GGG AAC AGT ATA ta TTC TCA AAA GGA AGA AAT CTG ATG TGT T. All constructs were confirmed by DNA sequencing. .. A luciferase reporter assay was carried out using the Luc-Pair Duo-Luciferase Assay Kit 2.0 (LF001, GeneCopoeia, Rockville, MD).

    Homologous Recombination:

    Article Title: E4-Ubiquitin ligase Ufd2 stabilizes Yap8 and modulates arsenic stress responses independent of the U-box motif
    Article Snippet: .. HA-tagged UFD2 was generated by homologous recombination into the pRS416 vector (Agilent Technologies, Santa Clara, CA, USA) previously linearized with Sma I (Fermentas™ Thermo Fisher Scientific Inc., Rockford, IL, USA), using the In-Fusion® HD Cloning Plus CE kit (Clontech Laboratories, Inc., Mountain View, CA, USA) and oligonucleotides indicated in supplementary material Table S3 (oligonucleotides 10 to 13) to generate pRS416-UFD2-HA . .. UFD2-HA was then sub-cloned into YCplac111 vector (Agilent Technologies) as a Sma I fragment.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa in fusion hd cloning plus ce kit
    In Fusion Hd Cloning Plus Ce Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in fusion hd cloning plus ce kit/product/TaKaRa
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    in fusion hd cloning plus ce kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa in fusion cloning reactions
    In Fusion Cloning Reactions, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/in fusion cloning reactions/product/TaKaRa
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    in fusion cloning reactions - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results