illustra blood genomicprep kit  (GE Healthcare)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Blood genomicPrep Mini Spin Kit
    Description:

    Catalog Number:
    28904263
    Price:
    On Request
    Size:
    10
    Buy from Supplier


    Structured Review

    GE Healthcare illustra blood genomicprep kit

    https://www.bioz.com/result/illustra blood genomicprep kit/product/GE Healthcare
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    illustra blood genomicprep kit - by Bioz Stars, 2020-12
    99/100 stars

    Related Products / Commonly Used Together

    genomic dna

    Images

    Related Articles

    DNA Extraction:

    Article Title: Evaluation of canine and feline leishmaniasis by the association of blood culture, immunofluorescent antibody test and polymerase chain reaction
    Article Snippet: .. DNA extraction The DNA was extracted from 300 μL of the stored sediment, subjected to an application of Illustra™ blood genomic Prep Mini Spin Kit (GE Healthcare®), and then stored in sterile DNAse- and RNAse-free microtubes and kept at –20°C. .. Polymerase chain reaction (PCR) The primers LINR4 (5´ GGGGTTGGTGTAAAATAGGG 3′) and LIN19 (5′ CAGAACGCCCCTACCCG 3′) were used as described by Ikonomopoulos et al. [ ].

    Article Title: Study of the polymorphism rs3025058 of the MMP-3 gene and risk of pelvic organ prolapse in Brazilian women
    Article Snippet: .. DNA extraction was conducted from the leukocyte phase using the commercial kit, Illustra blood genomicPrep mini spin (GE Healthcare). ..

    Mutagenesis:

    Article Title: Screening of CYP1B1 and LTBP2 genes in Saudi families with primary congenital glaucoma: Genotype-phenotype correlation
    Article Snippet: .. CYP1B1 and LTBP2 mutation screening DNA was extracted using the illustra blood genomicPrep Mini Spin Kit from GE Healthcare (Buckinhamshire, UK), and stored at −20 °C in aliquots until required. .. The coding exons of CYP1B1 were amplified using the primers listed in .

    Isolation:

    Article Title: Apolipoprotein B and angiotensin-converting enzyme polymorphisms and aerobic interval training: randomized controlled trial in coronary artery disease patients
    Article Snippet: .. Genotyping Genomic DNA was isolated from EDTA-treated peripheral blood leukocyte cells using Illustra blood genomicPrep Mini Spin kit (GE HealthCare, USA) according to the manufacturer's instructions. .. Polymorphisms of the ApoB gene were determined by real-time PCR (ABI 7500 fast, Applied Biosystems, USA), using the TaqMan Universal PCR Master Mix (Applied Biosystems, USA), genomic DNA template (20 ng), and specific TaqMan probe assay [APOB : rs1042031 (−12669C > T; assay ID: C___7615381_20) and rs693 (−7673G > A; assay ID: C___7615420_20)].

    Purification:

    Article Title: A survey of Babesia spp. and Hepatozoon spp. in wild canids in Israel
    Article Snippet: .. DNA was extracted from blood and spleen samples with a commercial purification kit (Illustra Blood GenomicPrep Mini Spin Kit; GE Healthcare, Buckinghamshire, UK), according to the manufacturer’s instructions and a series of polymerase chain reaction (PCR) assays was run to identify Babesia spp. and Hepatozoon spp. infections. .. DNA from the blood of a laboratory-bred piroplasmid-free dog and from a dog naturally infected with Babesia vogeli and a dog naturally infected with Hepatozoon canis were used as negative and positive controls, respectively, and run with each reaction.

    other:

    Article Title: Evidence of Antibodies to Spotted Fever Group Rickettsiae in Small Mammals and Quail from Mississippi
    Article Snippet: Small mammal blood samples were extracted using GE Healthcare's Illustra blood genomicPrep Mini Spin kit (GE Healthcare, Piscataway, NJ).

    Polymerase Chain Reaction:

    Article Title: A survey of Babesia spp. and Hepatozoon spp. in wild canids in Israel
    Article Snippet: .. DNA was extracted from blood and spleen samples with a commercial purification kit (Illustra Blood GenomicPrep Mini Spin Kit; GE Healthcare, Buckinghamshire, UK), according to the manufacturer’s instructions and a series of polymerase chain reaction (PCR) assays was run to identify Babesia spp. and Hepatozoon spp. infections. .. DNA from the blood of a laboratory-bred piroplasmid-free dog and from a dog naturally infected with Babesia vogeli and a dog naturally infected with Hepatozoon canis were used as negative and positive controls, respectively, and run with each reaction.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    GE Healthcare illustra blood genomicprep mini spin kit
    Illustra Blood Genomicprep Mini Spin Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 99/100, based on 39 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/illustra blood genomicprep mini spin kit/product/GE Healthcare
    Average 99 stars, based on 39 article reviews
    Price from $9.99 to $1999.99
    illustra blood genomicprep mini spin kit - by Bioz Stars, 2020-12
    99/100 stars
      Buy from Supplier

    Image Search Results