hotstar taq polymerase buffer  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Qiagen hotstar taq polymerase buffer
    Hotstar Taq Polymerase Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar taq polymerase buffer/product/Qiagen
    Average 94 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    hotstar taq polymerase buffer - by Bioz Stars, 2020-04
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Quiagen, Hilden, Germany) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: The amplification factor was then multiplied by the known concentration of the reference to give copies/μl. .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Qiagen) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Article Title: Comprehensive analysis of CDKN2A (p16INK4A/p14ARF) and CDKN2B genes in 53 melanoma index cases considered to be at heightened risk of melanoma
    Article Snippet: .. We screened for germline mutations in CDKN2B (exon 1 and 2), ARF (exon 1β), and CDKN2A (exon 1α, 2, and 3) and CDK4 (exon 2) by dHPLC analysis, an automated heteroduplex detection method., , PCR amplification was performed in a 20 μl reaction with 100 ng genomic DNA, 1×HotStar Taq DNA polymerase buffer including 1.5 mM MgCl2 (Qiagen), 1 U of HotStar Taq DNA polymerase (Qiagen), and 4 pmol of each primer. .. For CDKN2A exon 1α, 1.25 M betain (Sigma, St Louis, MO) was added to the PCR reaction mix.

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: The VEGF165 specific cDNA was amplified by PCR using the following primers: 5′-ttggccgaattcatgaactttctgctgtcttgggt-3′ and 5′-tttggccctcgagtcaccgcctcggcttgtcac-3′. .. PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. For PCR amplification of each exon, a touch down protocol was used as follows: initial denaturation and HotStar Taq Polymerase activation at 95°C for 15 min; six cycles of 30 s at 95°C, 30 s at 66°C (the annealing temperature decreasing by 2°C at every two cycles), 30 s at 72°C; followed by 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: Then the DNA samples were subjected to a sensitive, single-tube, nested PCR that enables amplification of part of the major immediate-early region of the RCMV genome ( ). .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Real-time Polymerase Chain Reaction:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: .. The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 400 nM for OvwFtsZ and OvActin, final taqman probe concentrations were 25 nM for OvwFtsZ and 50 nM for OvActin and 6 mM for the MgCl2 concentration.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: Paragraph title: Quantitative real-time PCR ... The optimised PCR conditions were: 1 × HotStar® Taq Polymerase buffer (Qiagen), 4 mM MgCl2 , 200 μM dNTP, 300 nM each forward and reverse primers (Table ), 0.2 μl of Sybr Green (1:1,000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 U HotStar® Taq Polymerase and 2 μl DNA in a 20 μl reaction.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction. .. The PCR profile was: 1 × 15 min at 95°C, 45 cycles of 94°C for 15s, 58°C for 20s, 72°C for 20s.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 500 nM for LsFtsZ and 400 nM for LsActin, final taqman probe concentrations were 25 nM for LsFtsZ and 50 nM for LsActin and 6 mM for the MgCl2 concentration.

    Incubation:

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The Qiagen protocol was used with the following changes: the worms were incubated with proteinase K overnight at 56°C; and Wizard SV96 DNA binding plates (Promega) and vacuum manifold instead of DNA columns were used to bind, wash, and elute the DNA in 50 μL of 10-mM Tris, 0.5-mM EDTA, pH 9. .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction.

    Expressing:

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: The primers contain the restriction sites for EcoRI and XhoI enzymes, subsequently used for insertion of the VEGF165 cDNA into the expression vector. .. PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Modification:

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Copy numbers for each gene were calculated using a modification of the comparative quantification formula as described in [ ].

    Hybridization:

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: For all samples, the following master mix was used: 1 × QuantiTect® Virus NR Master Mix (Qiagen), 300 nM each forward and reverse primers (Table ), 50 nM TaqMan hybridisation probe with the fluorescent dye 6-FAM (6-carboxyfluorescein) and Tamra (Biomers, Ulm, Germany) and 10 μl of sample DNA in a 20 μl reaction. .. The optimised PCR conditions were: 1 × HotStar® Taq Polymerase buffer (Qiagen), 4 mM MgCl2 , 200 μM dNTP, 300 nM each forward and reverse primers (Table ), 0.2 μl of Sybr Green (1:1,000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 U HotStar® Taq Polymerase and 2 μl DNA in a 20 μl reaction.

    High Performance Liquid Chromatography:

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Mutation analysis For detecting CDKN2A/ARF and CDK4 gene coding region sequence alterations, exons 1α , 1β and 2 of CDKN2A/ARF and exon 2 of CDK4 were screened by dHPLC (denaturing high performance liquid chromatography), by using PCR and dHPLC analysis conditions previously described ( ). .. Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Activation Assay:

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. PCR amplification conditions were as follows: initial denaturation and HotStar Taq Polymerase activation at 95°C for 15 min; 35 cycles of 30 s at 95°C, 30 s at 62°C with 45 s extension at 72°C; final extention of 7 min at 72°C.

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. For PCR amplification of each exon, a touch down protocol was used as follows: initial denaturation and HotStar Taq Polymerase activation at 95°C for 15 min; six cycles of 30 s at 95°C, 30 s at 66°C (the annealing temperature decreasing by 2°C at every two cycles), 30 s at 72°C; followed by 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Infection:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: Thus, two groups of 6-week-old, immunosuppressed rats (five animals per group) were infected with 106 PFU of either RCMV or RCMVΔr144. .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Inhibition:

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: To exclude inhibition of the PCR reaction by inhibitors in the DNA a third PCR with a plasmid containing a fragment of the murine Interferon-γ gene was performed in the presence of the extracted DNA. .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction.

    Polymerase Chain Reaction:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: .. The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 400 nM for OvwFtsZ and OvActin, final taqman probe concentrations were 25 nM for OvwFtsZ and 50 nM for OvActin and 6 mM for the MgCl2 concentration.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: .. The optimised PCR conditions were: 1 × HotStar® Taq Polymerase buffer (Qiagen), 4 mM MgCl2 , 200 μM dNTP, 300 nM each forward and reverse primers (Table ), 0.2 μl of Sybr Green (1:1,000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 U HotStar® Taq Polymerase and 2 μl DNA in a 20 μl reaction. .. The PCR profile used a 3-step program with an initial 95°C for 15 min, followed by 35 cycles at 94°C for 10s, 52°C for 15s and finally 72°C for 15s.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: To exclude inhibition of the PCR reaction by inhibitors in the DNA a third PCR with a plasmid containing a fragment of the murine Interferon-γ gene was performed in the presence of the extracted DNA. .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 500 nM for LsFtsZ and 400 nM for LsActin, final taqman probe concentrations were 25 nM for LsFtsZ and 50 nM for LsActin and 6 mM for the MgCl2 concentration.

    Article Title: Comprehensive analysis of CDKN2A (p16INK4A/p14ARF) and CDKN2B genes in 53 melanoma index cases considered to be at heightened risk of melanoma
    Article Snippet: .. We screened for germline mutations in CDKN2B (exon 1 and 2), ARF (exon 1β), and CDKN2A (exon 1α, 2, and 3) and CDK4 (exon 2) by dHPLC analysis, an automated heteroduplex detection method., , PCR amplification was performed in a 20 μl reaction with 100 ng genomic DNA, 1×HotStar Taq DNA polymerase buffer including 1.5 mM MgCl2 (Qiagen), 1 U of HotStar Taq DNA polymerase (Qiagen), and 4 pmol of each primer. .. For CDKN2A exon 1α, 1.25 M betain (Sigma, St Louis, MO) was added to the PCR reaction mix.

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: .. PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. PCR amplification conditions were as follows: initial denaturation and HotStar Taq Polymerase activation at 95°C for 15 min; 35 cycles of 30 s at 95°C, 30 s at 62°C with 45 s extension at 72°C; final extention of 7 min at 72°C.

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: .. Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. For PCR amplification of each exon, a touch down protocol was used as follows: initial denaturation and HotStar Taq Polymerase activation at 95°C for 15 min; six cycles of 30 s at 95°C, 30 s at 66°C (the annealing temperature decreasing by 2°C at every two cycles), 30 s at 72°C; followed by 40 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C.

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen). .. Amplification was performed with a GeneAmp PCR System 9600 thermal cycler (Perkin-Elmer, Nieuwerkerk aan de Ijssel, The Netherlands), which was programmed to incubate the samples for 15 min at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 70°C, and 30 s at 72°C and 25 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C.

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: .. The PCR amplifications were carried out in a final volume of 25 μ l, the reaction mix containing: 1 × HotStar Taq DNA polymerase buffer with 1.5 mM MgCl2 (Qiagen, Chatsworth, CA, USA), 1 UI HotStar Taq DNA polymerase (Qiagen), 4 pmoles of each primer and 0.2 mM dNTPs. ..

    Binding Assay:

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The Qiagen protocol was used with the following changes: the worms were incubated with proteinase K overnight at 56°C; and Wizard SV96 DNA binding plates (Promega) and vacuum manifold instead of DNA columns were used to bind, wash, and elute the DNA in 50 μL of 10-mM Tris, 0.5-mM EDTA, pH 9. .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction.

    DNA Extraction:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: PCR For DNA extraction 8 nodule paraffin sections of 4 μm were placed in microcentrifuge tubes and DNA was extracted according to the manufacturer’s instructions (Quiamp DNA Mini Kit). .. The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: Paragraph title: DNA extraction and PCR ... The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction.

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: On day 330 p.i., total cellular DNA was purified from various tissues and organs of the rats using an XTRAX DNA extraction kit (Gull Laboratories, Salt Lake City, Utah). .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Fluorescence:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Quiagen, Hilden, Germany) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Qiagen) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Mutagenesis:

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Paragraph title: Mutation analysis ... Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Size-exclusion Chromatography:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Quiagen, Hilden, Germany) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Genes were amplified in a Rotorgene 3000 (Qiagen) using the following conditions: 1X 15 min at 95°C, 45 cycles of 95°C for 15 sec, 58°C for 30 sec. Fluorescence was acquired on the FAM and JOE channel.

    Purification:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: .. The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 400 nM for OvwFtsZ and OvActin, final taqman probe concentrations were 25 nM for OvwFtsZ and 50 nM for OvActin and 6 mM for the MgCl2 concentration.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 500 nM for LsFtsZ and 400 nM for LsActin, final taqman probe concentrations were 25 nM for LsFtsZ and 50 nM for LsActin and 6 mM for the MgCl2 concentration.

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: On day 330 p.i., total cellular DNA was purified from various tissues and organs of the rats using an XTRAX DNA extraction kit (Gull Laboratories, Salt Lake City, Utah). .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Sequencing:

    Article Title: Comprehensive analysis of CDKN2A (p16INK4A/p14ARF) and CDKN2B genes in 53 melanoma index cases considered to be at heightened risk of melanoma
    Article Snippet: Paragraph title: dHPLC and sequence analyses ... We screened for germline mutations in CDKN2B (exon 1 and 2), ARF (exon 1β), and CDKN2A (exon 1α, 2, and 3) and CDK4 (exon 2) by dHPLC analysis, an automated heteroduplex detection method., , PCR amplification was performed in a 20 μl reaction with 100 ng genomic DNA, 1×HotStar Taq DNA polymerase buffer including 1.5 mM MgCl2 (Qiagen), 1 U of HotStar Taq DNA polymerase (Qiagen), and 4 pmol of each primer.

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. In order to verify the nucleotidic sequence of the obtained VEGF165 specific cDNA, the amplicons were subsequently bidirectionally sequenced using the BigDye Terminator sequencing kit (Applied Biosystems) according to the manufacturer’s instructions on an ABI Prism 310 capillary electrophoresis device (Applied Biosystems).

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Mutation analysis For detecting CDKN2A/ARF and CDK4 gene coding region sequence alterations, exons 1α , 1β and 2 of CDKN2A/ARF and exon 2 of CDK4 were screened by dHPLC (denaturing high performance liquid chromatography), by using PCR and dHPLC analysis conditions previously described ( ). .. Briefly, PCR was carried out in a final volume of 20 μ l containing 100 ng genomic DNA, 1 × HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1 UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen). .. Amplification was performed with a GeneAmp PCR System 9600 thermal cycler (Perkin-Elmer, Nieuwerkerk aan de Ijssel, The Netherlands), which was programmed to incubate the samples for 15 min at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 70°C, and 30 s at 72°C and 25 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C.

    Nested PCR:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: Then the DNA samples were subjected to a sensitive, single-tube, nested PCR that enables amplification of part of the major immediate-early region of the RCMV genome ( ). .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen). .. Amplification was performed with a GeneAmp PCR System 9600 thermal cycler (Perkin-Elmer, Nieuwerkerk aan de Ijssel, The Netherlands), which was programmed to incubate the samples for 15 min at 95°C, followed by 30 cycles of 30 s at 95°C, 30 s at 70°C, and 30 s at 72°C and 25 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C.

    Plasmid Preparation:

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction. .. The PCR profile was: 1 × 15 min at 95°C, 45 cycles of 94°C for 15s, 58°C for 20s, 72°C for 20s.

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: Paragraph title: VEGF165 vector construction and multiplication ... PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs.

    Software:

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: Primers and hybridisation probe were designed with Primer3 software [ ] for the O. volvulus Wolbachia ftsZ gene (GenBank accession No. AJ276501 ), which codes for a single-copy cell division protein. .. The optimised PCR conditions were: 1 × HotStar® Taq Polymerase buffer (Qiagen), 4 mM MgCl2 , 200 μM dNTP, 300 nM each forward and reverse primers (Table ), 0.2 μl of Sybr Green (1:1,000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 U HotStar® Taq Polymerase and 2 μl DNA in a 20 μl reaction.

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. The obtained sequence was compared with the GenBank reference sequence with the aid of the Sequencing Analysis v3.1 (Applied Biosystems) software.

    SYBR Green Assay:

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: .. The optimised PCR conditions were: 1 × HotStar® Taq Polymerase buffer (Qiagen), 4 mM MgCl2 , 200 μM dNTP, 300 nM each forward and reverse primers (Table ), 0.2 μl of Sybr Green (1:1,000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 U HotStar® Taq Polymerase and 2 μl DNA in a 20 μl reaction. .. The PCR profile used a 3-step program with an initial 95°C for 15 min, followed by 35 cycles at 94°C for 10s, 52°C for 15s and finally 72°C for 15s.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction. .. The PCR profile was: 1 × 15 min at 95°C, 45 cycles of 94°C for 15s, 58°C for 20s, 72°C for 20s.

    Multiplex Assay:

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: .. The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 500 nM for LsFtsZ and 400 nM for LsActin, final taqman probe concentrations were 25 nM for LsFtsZ and 50 nM for LsActin and 6 mM for the MgCl2 concentration.

    Recombinant:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: Although differences between WT and recombinant virus were not seen during the acute phase of infection, we considered the possibility that disruption of the RCMV r144 gene might have an effect on long-term persistent or latent infection of rats. .. The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen).

    Agarose Gel Electrophoresis:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen). .. PCR products were analyzed by agarose gel electrophoresis and ethidium bromide staining.

    Electrophoresis:

    Article Title: Clinical improvement after treatment with VEGF165 in patients with severe chronic lower limb ischaemia
    Article Snippet: PCR reaction was carried out in a final volume of 20 μl containing 50 ng genomic DNA, 1x HotStar Taq DNA Polymerase buffer with 1.5 mM MgCl2 (Qiagen), 4 pmoles of each primer, 1UI HotStar Taq DNA Polymerase (Quiagen) and 2.5 mM dNTPs. .. In order to verify the nucleotidic sequence of the obtained VEGF165 specific cDNA, the amplicons were subsequently bidirectionally sequenced using the BigDye Terminator sequencing kit (Applied Biosystems) according to the manufacturer’s instructions on an ABI Prism 310 capillary electrophoresis device (Applied Biosystems).

    Concentration Assay:

    Article Title: Comparison of Doxycycline, Minocycline, Doxycycline plus Albendazole and Albendazole Alone in Their Efficacy against Onchocerciasis in a Randomized, Open-Label, Pilot Trial
    Article Snippet: The Wolbachia ftsZ and O . volvulus actin gene were quantified from the purified DNA by real-time duplex PCR (qPCR) using the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: OvFtsZ forward primer (aggaatgggtggtggtactg), OvFtsZ reverse primer (ctttaaccgcagctcttgct), OvActin forward primer (gtgctacgttgctttggact), OvActin reverse primer (gtaatcacttggccatcagg), OvFtsZ taqman probe (5’6-FAM ccttgccgctttcgcaatcac 3’DDQ-1), OvActin taqman probe(5’HEX aacaggaaatggcaactgctgc 3’BHQ-1), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 400 nM for OvwFtsZ and OvActin, final taqman probe concentrations were 25 nM for OvwFtsZ and 50 nM for OvActin and 6 mM for the MgCl2 concentration.

    Article Title: Retarded Onchocerca volvulus L1 to L3 larval development in the Simulium damnosum vector after anti-wolbachial treatment of the human host
    Article Snippet: The amplification factor was then multiplied by the known concentration of the reference to give copies/μl. .. The samples were set up for real-time PCR with a master mix containing 1 × HotStar® Taq Polymerase buffer (Qiagen), 200 μm dNTP, 400 nM each of forward and reverse primer (Table ), 0.2 μl SYBR® Green (1:1000 diluted in DMSO, Roche, Mannheim, Germany), 2.5 units HotStar® Taq Polymerase, 2 μl reference Plasmid DNA and 2 μl sample DNA in a 20 μl reaction.

    Article Title: Combinations of registered drugs reduce treatment times required to deplete Wolbachia in the Litomosoides sigmodontis mouse model
    Article Snippet: The genes were quantified from the purified DNA by real-time duplex PCR (qPCR) using the Qiagen’s QuantiTect Multiplex NoROX Kit with the following conditions: 10x HotStar Taq Polymerase buffer (Qiagen), 200 μM dNTP, Primers: LsFtsZ forward primer (5´-cgatgagattatggaacatataa-3´), LsFtsZ reverse primer (5´-ttgcaattactggtgctgc-3´), LsActin forward primer (5´-atccaagctgtcctgtctct-3`), LsActin reverse primer (5´-tgagaattgatttgagctaatg-3´), LsFtsZ taqman probe (5’6-FAM cagggatgggtggtggtactggaa 3’ TAMRA), LsActin taqman probe (5’HEX actaccggtattgtgctcgatt 3’TAMRA), 2.5 units HotStar Taq, and 2 μl DNA in a 20 μl reaction. .. Final primer concentrations were 500 nM for LsFtsZ and 400 nM for LsActin, final taqman probe concentrations were 25 nM for LsFtsZ and 50 nM for LsActin and 6 mM for the MgCl2 concentration.

    Marker:

    Article Title: Search for germline alterations in CDKN2A/ARF and CDK4 of 42 Jewish melanoma families with or without neural system tumours
    Article Snippet: Deletion genotyping was performed using the D9S1748 microsatellite marker located adjacent to CDKN2A exon 1β . .. The PCR amplifications were carried out in a final volume of 25 μ l, the reaction mix containing: 1 × HotStar Taq DNA polymerase buffer with 1.5 mM MgCl2 (Qiagen, Chatsworth, CA, USA), 1 UI HotStar Taq DNA polymerase (Qiagen), 4 pmoles of each primer and 0.2 mM dNTPs.

    Staining:

    Article Title: The r144 Major Histocompatibility Complex Class I-Like Gene of Rat Cytomegalovirus Is Dispensable for both Acute and Long-Term Infection in the Immunocompromised Host
    Article Snippet: The PCR mixtures (50 μl) contained 1 μg of target DNA, 0.05 μM concentrations of primers RIE3F (5′-CCA GAG TGA CGT TGC AGA TGT TGG AAA TCA-3′; nucleotides 3425 to 3454 of the sequence assigned GenBank accession no. ) and RIE3R2 (5′-GGT CAC GAC CCT GCT GCC GTC TAG GT-3′; complement of nucleotides 3719 to 3744 of the sequence assigned GenBank accession no. ), 1 μM concentrations of primers RIE4F (5′-ATG AAA TGG TGA TGA GAT-3′; nucleotides 3461 to 3478 of the sequence assigned GenBank accession no. ) and RIE4R (5′-CTT CTA GTG ATT TGG CAT-3′; complement of nucleotides 3686 to 3707 of the sequence assigned GenBank accession no. ), 100 μM concentrations of each deoxynucleoside triphosphate, 1.25 U of HotStar Taq DNA polymerase (Qiagen, Leusden, The Netherlands), and HotStar Taq DNA polymerase buffer (Qiagen). .. PCR products were analyzed by agarose gel electrophoresis and ethidium bromide staining.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen hotstart taq dna polymerase
    Hotstart Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstart taq dna polymerase/product/Qiagen
    Average 99 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    hotstart taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Qiagen pcr reaction
    Pcr Reaction, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 920 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction/product/Qiagen
    Average 99 stars, based on 920 article reviews
    Price from $9.99 to $1999.99
    pcr reaction - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Qiagen hotstar taq plus buffer
    Hotstar Taq Plus Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar taq plus buffer/product/Qiagen
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hotstar taq plus buffer - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    Image Search Results