Structured Review

Roche hot start taq polymerase
Hot Start Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hot start taq polymerase/product/Roche
Average 88 stars, based on 1 article reviews
Price from $9.99 to $1999.99
hot start taq polymerase - by Bioz Stars, 2019-12
88/100 stars

Images

Related Articles

Amplification:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: 2 ul of the “outside” primers amplification reaction mixture were then amplified with nested primers. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: Primer mix was introduced into each sample before amplification. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics). .. The internal transcribed spacer (ITS) region was selected as the target region for bacterial and fungal species differentiation.

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. During amplification, SYBR Green fluorescence was automatically acquired during the elongation step of each cycle by the LightCycler software.

Glucose Assay:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: In brief, mutarotase was used for complete conversion to β- d -glucose, glucose oxidase to produce hydrogen peroxide, ascorbate oxidase to eliminate ascorbic acid interference, and peroxidase and 4-aminoantipyrine to form a quinoneimine dye for quantification at 505 nm according to the manufacturer’s instructions (Autokit Glucose Assay; Wako Diagnostics, Richmond, VA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Synthesized:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Lambda DNA Preparation:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: Selection of fractions from truncated ccfDNA libraries was done with an automated liquid handler (NIMBUS Select, Hamilton, Reno, NV) that incorporated Ranger Technology (Coastal Genomics, Burnaby, BC) [ ] for the monitoring and real-time manipulation of electrophoretic mobilities through a 3.0% agarose matrix in a 12-channel cassette. .. Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). .. The short fraction was optimized to extract a ccfDNA fraction that included both the 223 and 233 bands and no portion of the 268 band, while the long fraction was optimized to include both the 268 and 278 bands, but not the 233 band.

Construct:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: Selection of fractions from truncated ccfDNA libraries was done with an automated liquid handler (NIMBUS Select, Hamilton, Reno, NV) that incorporated Ranger Technology (Coastal Genomics, Burnaby, BC) [ ] for the monitoring and real-time manipulation of electrophoretic mobilities through a 3.0% agarose matrix in a 12-channel cassette. .. Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). .. The short fraction was optimized to extract a ccfDNA fraction that included both the 223 and 233 bands and no portion of the 268 band, while the long fraction was optimized to include both the 268 and 278 bands, but not the 233 band.

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: A custom-made ladder of double-stranded DNA fragment was loaded into the wells adjacent to the sample. .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. The ladder contained 75 ng of each of the three fragment lengths.

Real-time Polymerase Chain Reaction:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged and incubated for 10 min at 25°C followed by 5 min at 95°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. The PCR mix contained 3.325 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 0.5 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 0.5 μl 25 mM MgCl2 (Roche, #12032953001), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.15 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001).

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged for 3 min at 1450g and incubated for 30 min at 33°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix.

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample.

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The detection of 18S genomic DNA was performed in a one-step reaction. .. Eight-microlitre qPCR mix containing 5.45 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific). .. Results were analyzed by the ΔΔ Ct method and presented as fold changes compared to controls after normalizing to internal control RPL13a .

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: Primer mix was introduced into each sample before amplification. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics). .. The internal transcribed spacer (ITS) region was selected as the target region for bacterial and fungal species differentiation.

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Real-time quantitative PCR was performed and analyzed using the SYBR Green I format on the LightCycler rapid thermal cycler system (Roche Molecular Biochemicals, Indianapolis, IN) using a previously published procedure and primer pairs specific for human VEGF. .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used.

Microarray:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: Primers were designed to generate amplicons < 250 bp corresponding to the sequence containing differentially methylated regions in the microarray analysis. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche).

Incubation:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp).

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged and incubated for 10 min at 25°C followed by 5 min at 95°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. The PCR mix contained 3.325 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 0.5 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 0.5 μl 25 mM MgCl2 (Roche, #12032953001), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.15 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001).

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged for 3 min at 1450g and incubated for 30 min at 33°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix.

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: The lysed specimens were incubated for 1 h with a protease and chaotropic lysis buffer. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Diffusion-based Assay:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. Six consecutive fragments were selected from the gel for DNA extraction after the gel was incubated in TBE with SYBER safe (Thermofisher) per the manufacturer’s instructions at RT x 30 minutes on a gentle shaker.

Expressing:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific). .. Results were analyzed by the ΔΔ Ct method and presented as fold changes compared to controls after normalizing to internal control RPL13a .

Blocking Assay:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. Six consecutive fragments were selected from the gel for DNA extraction after the gel was incubated in TBE with SYBER safe (Thermofisher) per the manufacturer’s instructions at RT x 30 minutes on a gentle shaker.

Hybridization:

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics). .. Internal controls for the amplification step were included with each assay run.

Ligation:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged for 3 min at 1450g and incubated for 30 min at 33°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix. .. Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed and centrifuged for 3 min at 1450g .

Northern Blot:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Real time PCR allows for precise quantitation of mRNA using total RNA from a single retina and obviates the need for Northern blots using pooled retinas. .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used.

Generated:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. After the amplification protocol, melting curve analysis was performed.

Sequencing:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: A custom-made ladder of double-stranded DNA fragment was loaded into the wells adjacent to the sample. .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. The ladder contained 75 ng of each of the three fragment lengths.

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: Primers were designed to generate amplicons < 250 bp corresponding to the sequence containing differentially methylated regions in the microarray analysis. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche).

Sonication:

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: One milliliter of the sonication fluid was subjected to mechanical lysis and purification of DNA (SeptiFast lysis kit MGRADE ; Roche Diagnostics) according to the manufacturer's instructions. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

DNA Extraction:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp).

Fluorescence:

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics). .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Methylation:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: Primers were designed to generate amplicons < 250 bp corresponding to the sequence containing differentially methylated regions in the microarray analysis. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche).

Isolation:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Retinal RNA was isolated using Trizol solution (Life Technologies, Inc.) as directed by the manufacturer. .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used.

Purification:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). .. A second run using intermediate parameters to collect a medium fraction between the short and long fractions from PCR-amplified truncated ccfDNA libraries (1 μg) was also performed.

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: One milliliter of the sonication fluid was subjected to mechanical lysis and purification of DNA (SeptiFast lysis kit MGRADE ; Roche Diagnostics) according to the manufacturer's instructions. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Polymerase Chain Reaction:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). .. Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ).

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed and centrifuged for 3 min at 1450g . .. The PCR mix contained 3.325 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 0.5 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 0.5 μl 25 mM MgCl2 (Roche, #12032953001), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.15 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001). .. The PCR reaction was performed in a 7900HT Fast Real-Time PCR System (Applied Biosystems) and consisted of 1 cycle: 10 min/95°C followed by 50 cycles: 3 s/95°C; 30 s/55°C.

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed, centrifuged for 3 min at 1450g and incubated for 30 min at 33°C in a 7900HT Fast Real-Time PCR System (Applied Biosystems). .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix. .. Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed and centrifuged for 3 min at 1450g .

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The detection of 18S rRNA and various mRNAs was performed in a one-step reaction. .. Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The detection of 18S genomic DNA was performed in a one-step reaction. .. Eight-microlitre qPCR mix containing 5.45 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: 2 ul of the “outside” primers amplification reaction mixture were then amplified with nested primers. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: Paragraph title: Multiplex PCR assay. ... The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Quantitative RT-PCR:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: The detection of 18S rRNA and various mRNAs was performed in a one-step reaction. .. Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Paragraph title: Real-Time RT-PCR ... Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used.

Nested PCR:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: 2 ul of the “outside” primers amplification reaction mixture were then amplified with nested primers. .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Plasmid Preparation:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. After the amplification protocol, melting curve analysis was performed.

Software:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. The PCR and melting analyses were conducted using Roche LightCycler 480 System.

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. After the amplification protocol, melting curve analysis was performed.

SYBR Green Assay:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific). .. Results were analyzed by the ΔΔ Ct method and presented as fold changes compared to controls after normalizing to internal control RPL13a .

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Real-time quantitative PCR was performed and analyzed using the SYBR Green I format on the LightCycler rapid thermal cycler system (Roche Molecular Biochemicals, Indianapolis, IN) using a previously published procedure and primer pairs specific for human VEGF. .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. During amplification, SYBR Green fluorescence was automatically acquired during the elongation step of each cycle by the LightCycler software.

Multiplex Assay:

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: Paragraph title: Multiplex PCR assay. ... The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Selection:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: Paragraph title: Fragment size selection ... Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ).

Enzyme-linked Immunosorbent Assay:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: Serum insulin levels were determined by ELISA using antibody specific for mouse insulin and anti-insulin horseradish peroxidase (HRP) conjugate according to the manufacturer’s instructions (Crystal Chem, Downers Grove, IL, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Quantitation Assay:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Real time PCR allows for precise quantitation of mRNA using total RNA from a single retina and obviates the need for Northern blots using pooled retinas. .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used.

Concentration Assay:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. Quantification was done with the LightCycler Software by linear regression analysis using a series of specimen dilution curves and a series of standard curves generated with known amounts of cDNA (linearized plasmid containing the requisite VEGF cDNA diluted in 10-fold increments up to 1:10,000).

Lysis:

Article Title: Sex difference in mouse metabolic response to erythropoietin
Article Snippet: For gene expression analysis, in brief, total RNA was extracted from adipose tissue using QIAzol Lysis Reagent, chloroform was added for aqueous phase extraction, total RNA was isolated using an RNeasy spin column following the manufacturer’s instructions (RNeasy Lipid Tissue Mini procedure; Qiagen, Germantown, MD, USA), and cDNA was synthesized using MultiScribe Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). .. Gene expression was quantified by real-time quantitative PCR (qPCR) using SYBR Green dye and qPCR SuperMix containing hot-start Taq DNA polymerase (Roche Applied Science, Indianapolis, IN, USA) and gene-specific primers , and an ABI 7900HT Real-Time PCR System (Thermo Fisher Scientific).

Article Title: Improved Diagnosis of Periprosthetic Joint Infection by Multiplex PCR of Sonication Fluid from Removed Implants
Article Snippet: The lysed specimens were incubated for 1 h with a protease and chaotropic lysis buffer. .. The real-time PCR amplification of target DNA was performed in parallel reactions for Gram-positive bacteria, Gram-negative bacteria, and fungi using Hot Start Taq polymerase and the LightCycler instrument (LightCycler 2.0; Roche Diagnostics).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Roche hot start taq dna polymerase
    Hot Start Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 98/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hot start taq dna polymerase/product/Roche
    Average 98 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hot start taq dna polymerase - by Bioz Stars, 2019-12
    98/100 stars
      Buy from Supplier

    99
    Roche faststart taq dna polymerase
    Faststart Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 260 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase/product/Roche
    Average 99 stars, based on 260 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results