Structured Review

Roche hot start taq polymerase
Hot Start Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hot start taq polymerase/product/Roche
Average 92 stars, based on 1 article reviews
Price from $9.99 to $1999.99
hot start taq polymerase - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. Eight-microlitre qPCR mix containing 5.45 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Amplification:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Ligation:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix. .. Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed and centrifuged for 3 min at 1450g .

Lambda DNA Preparation:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: .. Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). ..

Quantitative RT-PCR:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

SYBR Green Assay:

Article Title: Inducible Expression of Vascular Endothelial Growth Factor in Adult Mice Causes Severe Proliferative Retinopathy and Retinal Detachment
Article Snippet: .. Hot Start Taq DNA polymerase and the FastStart Master SYBR Green I reaction mix (Roche Molecular Biochemicals) were used. .. During amplification, SYBR Green fluorescence was automatically acquired during the elongation step of each cycle by the LightCycler software.

Nested PCR:

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Polymerase Chain Reaction:

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. Eight-microlitre RT-qPCR mix containing 5.35 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems), 0.1 μl Multiscribe (50 U/μl) (Applied Biosystems, #4319983) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. Eight-microlitre qPCR mix containing 5.45 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 1 μl 25 mM MgCl2 (Roche, #12032953001), 0.1 μl Rox Reference Dye (Invitrogen, #12223-012), 0.2 μl Assay On Demand (Applied Biosystems) and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2-μl sample. .. After sealing (Microseal ‘B’ film, Bio-Rad, #MSB1001), the plate was mixed and centrifuged for 3 min at 1450g .

Article Title: THE SIGNATURE OF MATERNAL REARING IN THE METHYLOME IN RHESUS MACAQUE PREFRONTAL CORTEX AND T CELLS
Article Snippet: .. The “outside” PCR amplification was performed using Taq DNA polymerase (Fermentas) while the nested PCR was performed using hot-start Taq polymerase (Roche). .. To obtain controls for the HRM reactions, we amplified the same regions from completely unmethylated (0%) or fully methylated (100%) rhesus DNA as described previously ( ).

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. On completion of the chemical ligation reaction, 8 μl PCR-mix containing 6.375 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 1 μl 10× PCR Buffer (Roche #14882500), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.1 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001) was added to each well of a new 384-well Hard-Shell PCR Plate (Bio-Rad, #HSP3901) followed by the addition of 2 μl of the Chemical Ligation-mix. .. Subsequently, the plate was sealed (Microseal ‘B’ film, Bio-Rad, #MSB1001), mixed and centrifuged for 3 min at 1450g .

Article Title: Whole-body scanning PCR; a highly sensitive method to study the biodistribution of mRNAs, noncoding RNAs and therapeutic oligonucleotides
Article Snippet: .. The PCR mix contained 3.325 μl DEPC-water, 0.15 μl 100 mM dNTPs (Applied Biosystems, #362271), 0.5 μl 10× PCR Buffer I (Applied Biosystems, #4379876), 0.5 μl 25 mM MgCl2 (Roche, #12032953001), 0.15 μl 10 μM forward primer, 0.15 μl 10 μM reverse primer, 0.075 μl 50 μM Anti-primer and 0.15 μl Hot Start Taq Polymerase (5 U/μl) (Roche, #12032953001). .. The PCR reaction was performed in a 7900HT Fast Real-Time PCR System (Applied Biosystems) and consisted of 1 cycle: 10 min/95°C followed by 50 cycles: 3 s/95°C; 30 s/55°C.

Construct:

Article Title: Automated size selection for short cell-free DNA fragments enriches for circulating tumor DNA and improves error correction during next generation sequencing
Article Snippet: .. Prior to use on human samples, extraction parameters were optimized with a four-rung ladder constructed from lambda phage using Hot Start Taq DNA polymerase (Roche, New York, NY) and the following primer pairs to generate specific lengths of lambda DNA: 278 bp: 5’-GATGCGATGTTATCGGTGCG-3’ and 5’-CACAGGTGAGCCGTGTAGTT-3’ 268 bp: 5’-TGGAACCCACCGAGTGAAAG-3’ and 5’-CAATGCAGCAGCAGTCATCC-3’ 233 bp: 5’-CGGCACGATCTCGTCAAAAC-3’ and 5’-GCCTTGAACTGAAATGCCCG-3’ 223 bp: 5’-GGAAGCTGCATGATGCGATG-3’ and 5’-CTGGTGCGTTTCGTTGGAAG-3’ Ladder lengths were constructed to guide targeting of desired ccfDNA fragment lengths after the addition of the truncated adapters (~103 bp; ). ..

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). ..

Sequencing:

Article Title: Fragment Length of Circulating Tumor DNA
Article Snippet: .. The ladder was constructed from lambda phage using Hot Start Taq DNA polymerase (Roche) and the following primer pairs: 262 bp: 5’–CATCTGCTTCTGCTTTCGCC–3’ and 3’–CTGGGTATTTCCCGGCCTTT–5’ 240 bp: 5’–GGAACCCACCGAGTGAAAGT–3’ and 3’–ACTCTTTCCATGCCGCTTCA–5’ 229 bp: 5’–GATGGCTCGCCAGTTCCATA–3’ and 3’–ACCAATATCCAGCACCGCAT–5’ Ladder lengths were selected to generally reflect the size of normal and tumor-derived cell-free DNA fragments observed by sequencing after the addition of the truncated adapters (~99 bp). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Roche faststart taq polymerase
    Faststart Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 125 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq polymerase/product/Roche
    Average 91 stars, based on 125 article reviews
    Price from $9.99 to $1999.99
    faststart taq polymerase - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    93
    Roche taq polymerase
    Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Roche
    Average 93 stars, based on 285 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    Image Search Results