high specificity hotstar taq dna polymerase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Qiagen high specificity hotstar taq dna polymerase
    High Specificity Hotstar Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high specificity hotstar taq dna polymerase/product/Qiagen
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    high specificity hotstar taq dna polymerase - by Bioz Stars, 2020-04
    90/100 stars

    Related Products / Commonly Used Together

    pcr
    dcm − genomic

    Images

    Related Articles

    Amplification:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT. .. An aliquot of each PCR product was then methylated in vitro using SssI DNA methylase (New England Biolabs).

    In Vitro:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT. .. An aliquot of each PCR product was then methylated in vitro using SssI DNA methylase (New England Biolabs).

    Magnetic Beads:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Methylated DNA was captured using the MethylCap kit (Diagenode), based on binding to methylated DNA of a recombinant H6-GST-MBD protein then captured on magnetic beads coated with GSH. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Methylation:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Paragraph title: Preparation of DNA and enrichment for the methylated fraction ... To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Generated:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Purified fragmented DNA was then spiked with unmethylated and methylated internal controls generated from Lambda phage genomic DNA. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Purification:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Purified fragmented DNA was then spiked with unmethylated and methylated internal controls generated from Lambda phage genomic DNA. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Incubation:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT. .. Spiked DNA samples were denatured at 95 °C then incubated for 4 h at 4 °C with anti-5-methylcytidine (5mC) antibody (Eurogentec) (12 μl per 4.5 μg DNA) in 10 mM Na-Phosphate pH 7.0, 140 mM NaCl, 0.05 % Triton X-100.

    Binding Assay:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Methylated DNA was captured using the MethylCap kit (Diagenode), based on binding to methylated DNA of a recombinant H6-GST-MBD protein then captured on magnetic beads coated with GSH. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Polymerase Chain Reaction:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT. .. An aliquot of each PCR product was then methylated in vitro using SssI DNA methylase (New England Biolabs).

    Sonication:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Caco-2 DNA was fragmented by sonication and purified from agarose gels to produce DNA fragments ranging from 200–1000 bp in length. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Recombinant:

    Article Title: SIRT1 affects DNA methylation of polycomb group protein target genes, a hotspot of the epigenetic shift observed in ageing
    Article Snippet: Methylated DNA was captured using the MethylCap kit (Diagenode), based on binding to methylated DNA of a recombinant H6-GST-MBD protein then captured on magnetic beads coated with GSH. .. To generate these samples, two different fragments of ~500 bp in length were amplified by PCR from Lambda phage dam− dcm− genomic DNA (Fermentas) using high specificity HotStar Taq DNA polymerase (Qiagen) and primer pairs AGCAACCAACAAGAAAACACT plus TCATCCTCGGCAAACTCTTT and GTGAGGTGAATGTGGTGAAGT plus TCGCAGAGATAAAACACGCT.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen high specificity hotstar taq dna polymerase
    High Specificity Hotstar Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high specificity hotstar taq dna polymerase/product/Qiagen
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    high specificity hotstar taq dna polymerase - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results