high fidelity pcr system  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Roche high fidelity pcr system
    Schematic representation of the MIR171e gene and its precursors. Detection of <t>pri-,</t> pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; <t>RT-PCR</t> detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .
    High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr system/product/Roche
    Average 92 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr system - by Bioz Stars, 2020-08
    92/100 stars

    Images

    1) Product Images from "Developmentally regulated expression and complex processing of barley pri-microRNAs"

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-14-34

    Schematic representation of the MIR171e gene and its precursors. Detection of pri-, pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; RT-PCR detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .
    Figure Legend Snippet: Schematic representation of the MIR171e gene and its precursors. Detection of pri-, pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; RT-PCR detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR1120 gene and its precursor. Detection of pri-, pre- and mature miR1120. ( A ) MIR1120 gene structure; black squares in the gene and pri-miRNA1120 schemes show position of the ORF. ( B ) pre-miRNA1120 hairpin structure (ΔG=−42.3 kcal/mol) and its wheat orthologue (ΔG=−63.5 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA1120 structure and RT-PCR expression analysis in the five barley developmental stages studied. ( D ) Real-time PCR measurements of total pri-miRNA1120 expression levels; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR1120 molecule, and detection of pre-miRNA and mature miR1120 using Northern hybridization. U6 was used as a loading control. The level of pre-miRNAs and miRNA was calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Asterisk on agarose gel indicates unspecific product.
    Figure Legend Snippet: Schematic representation of the MIR1120 gene and its precursor. Detection of pri-, pre- and mature miR1120. ( A ) MIR1120 gene structure; black squares in the gene and pri-miRNA1120 schemes show position of the ORF. ( B ) pre-miRNA1120 hairpin structure (ΔG=−42.3 kcal/mol) and its wheat orthologue (ΔG=−63.5 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA1120 structure and RT-PCR expression analysis in the five barley developmental stages studied. ( D ) Real-time PCR measurements of total pri-miRNA1120 expression levels; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR1120 molecule, and detection of pre-miRNA and mature miR1120 using Northern hybridization. U6 was used as a loading control. The level of pre-miRNAs and miRNA was calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Asterisk on agarose gel indicates unspecific product.

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR1126 gene and its precursors. Detection of pri-, pre- and mature miR1126. ( A ) MIR1126 gene structure. ( B ) pre-miRNA1126 hairpin structure (ΔG=−78.4 kcal/mol) and its wheat orthologue (ΔG=−73.27 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–V) of the miR1126 transcript; dashed lines represents unamplified 5 ′ fragments of the noncoding RNA isoforms IV and V; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR expression analysis of splice isoforms (I–V) of the miR1126 transcript in all barley developmental stages studied. Half-open arrows on agarose gel indicate specific, identified products. ( E ) Real-time PCR measurements of total pri-miRNA1126 expression levels (upper graph) and pri-miR1126 fragments carrying the third intron (+IVS3) and after the third intron splicing (ΔIVS3) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( F ) Nucleotide sequence of the mature miR1126 molecule, and detection of pre-miRNA and mature miR1126 using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .
    Figure Legend Snippet: Schematic representation of the MIR1126 gene and its precursors. Detection of pri-, pre- and mature miR1126. ( A ) MIR1126 gene structure. ( B ) pre-miRNA1126 hairpin structure (ΔG=−78.4 kcal/mol) and its wheat orthologue (ΔG=−73.27 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–V) of the miR1126 transcript; dashed lines represents unamplified 5 ′ fragments of the noncoding RNA isoforms IV and V; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR expression analysis of splice isoforms (I–V) of the miR1126 transcript in all barley developmental stages studied. Half-open arrows on agarose gel indicate specific, identified products. ( E ) Real-time PCR measurements of total pri-miRNA1126 expression levels (upper graph) and pri-miR1126 fragments carrying the third intron (+IVS3) and after the third intron splicing (ΔIVS3) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( F ) Nucleotide sequence of the mature miR1126 molecule, and detection of pre-miRNA and mature miR1126 using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Techniques Used: Hybridization, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR159b gene and its precursors. Detection of pri- and mature miR159b. ( A ) MIR159b gene structure. ( B ) pre-miRNA159b hairpin structure (ΔG=−95 kcal/mol) and its rice orthologue (ΔG=−79.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 ( C ) pri-miRNA159b structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA159b expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR159b molecule, and detection of mature miR159b using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisks next to bands on agarose gel mark nonspecific products.
    Figure Legend Snippet: Schematic representation of the MIR159b gene and its precursors. Detection of pri- and mature miR159b. ( A ) MIR159b gene structure. ( B ) pre-miRNA159b hairpin structure (ΔG=−95 kcal/mol) and its rice orthologue (ΔG=−79.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 ( C ) pri-miRNA159b structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA159b expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR159b molecule, and detection of mature miR159b using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisks next to bands on agarose gel mark nonspecific products.

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR166n gene and its precursors. Detection of pri-, pre- and mature miR166n. ( A ) MIR166n gene structure. ( B ) pre-miRNA166n hairpin structure (ΔG=−61 kcal/mol) and its rice orthologue (ΔG=−52.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA166n structures (upper panel); RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA166n expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR166n molecule, and detection of pre-miRNA166n long (L) and short (S) intermediates, and mature miR166n using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .
    Figure Legend Snippet: Schematic representation of the MIR166n gene and its precursors. Detection of pri-, pre- and mature miR166n. ( A ) MIR166n gene structure. ( B ) pre-miRNA166n hairpin structure (ΔG=−61 kcal/mol) and its rice orthologue (ΔG=−52.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA166n structures (upper panel); RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA166n expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR166n molecule, and detection of pre-miRNA166n long (L) and short (S) intermediates, and mature miR166n using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR168a-5p/168-3p gene and its precursors. Detection of pri-, pre-, and mature miR168-5p and miR168a-3p. ( A ) MIR168a-5p/168-3p gene structure. ( B ) pre-miRNA168a-5p/168-3p hairpin structure (ΔG=−60.7 kcal/mol) and its rice orthologue (ΔG=−52.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA168a-5p/168-3p structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of pri-miRNA miRNA168a-5p/168-3p expression levels (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequences of the mature miR168a-5p and miR168a-3p molecules, and Northern detection of pre-miRNA168a-5p/168-3p long (L) and short (S) intermediates, mature miR168-5p and miR168a-3p. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisk next to band on agarose gel marks nonspecific product.
    Figure Legend Snippet: Schematic representation of the MIR168a-5p/168-3p gene and its precursors. Detection of pri-, pre-, and mature miR168-5p and miR168a-3p. ( A ) MIR168a-5p/168-3p gene structure. ( B ) pre-miRNA168a-5p/168-3p hairpin structure (ΔG=−60.7 kcal/mol) and its rice orthologue (ΔG=−52.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA168a-5p/168-3p structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of pri-miRNA miRNA168a-5p/168-3p expression levels (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequences of the mature miR168a-5p and miR168a-3p molecules, and Northern detection of pre-miRNA168a-5p/168-3p long (L) and short (S) intermediates, mature miR168-5p and miR168a-3p. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisk next to band on agarose gel marks nonspecific product.

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR156g gene and its precursors. Detection of pri-, pre- and mature miR156g. ( A ) MIR156g gene structure; thin black vertical bars within exons show additional splice sites identified during pri-miRNA156g analyses; dotted-vertical lines within the last exon together with pA symbols denote polyadenylation sites. ( B ) pre-miRNA156g hairpin structure (ΔG=−65.85 kcal/mol) and its rice orthologue (ΔG=−61.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–VIII) of the miR156g transcript; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR analysis of first intron retention throughout barley plant life stages. ( E–F ) pri-miRNA156g RT-PCR expression analysis in five barley developmental stages. Arrows on agarose gel indicate splice isoforms II, III and V. ( G ) Real-time PCR measurements of total pri-miRNA156g expression levels (upper graph) and pri-miR156g fragments carrying the first intron (+IVS1) and after the first intron splicing (ΔIVS1) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( H ) Nucleotide sequence of the mature miR156g molecule, and detection of pre-miRNA and mature miR156g using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Additional colors depict alternatively spliced exons in the pri-miRNA.
    Figure Legend Snippet: Schematic representation of the MIR156g gene and its precursors. Detection of pri-, pre- and mature miR156g. ( A ) MIR156g gene structure; thin black vertical bars within exons show additional splice sites identified during pri-miRNA156g analyses; dotted-vertical lines within the last exon together with pA symbols denote polyadenylation sites. ( B ) pre-miRNA156g hairpin structure (ΔG=−65.85 kcal/mol) and its rice orthologue (ΔG=−61.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–VIII) of the miR156g transcript; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR analysis of first intron retention throughout barley plant life stages. ( E–F ) pri-miRNA156g RT-PCR expression analysis in five barley developmental stages. Arrows on agarose gel indicate splice isoforms II, III and V. ( G ) Real-time PCR measurements of total pri-miRNA156g expression levels (upper graph) and pri-miR156g fragments carrying the first intron (+IVS1) and after the first intron splicing (ΔIVS1) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( H ) Nucleotide sequence of the mature miR156g molecule, and detection of pre-miRNA and mature miR156g using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Additional colors depict alternatively spliced exons in the pri-miRNA.

    Techniques Used: Hybridization, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR397b-3p gene and its precursors. Detection of pri-, pre- and mature miR397b-3p. ( A ) MIR397b-3p gene structure; left arrow indicates putative transcription start site; arrow marked as pA depicts precursor polyadenylation site. ( B ) pre-miRNA397b-3p hairpin structure (ΔG=−70.8 kcal/mol) and its rice orthologue (ΔG=−51.2 kcal/mol); the blue line indicates the region of the pre-miRNA from which the hybridization probe for precursor detection was designed, while the red line highlights the probe for detection of the mature miRNA. ( C ) Structure of pri-miRNA397b-3p (upper panel); RT-PCR analysis of its expression in five barley developmental stages (lower panel); primer positions are marked by black triangles on the pri-miRNA graph. ( D ) Real-time PCR measurements of pri-miRNA397b-3p expression level; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miRNA397b-3p molecule; detection of pre-miRNA (left upper panel), mature miR397b-3p (left middle panel), and miR397b-5p (right panel) using Northern hybridization. U6 was used as a loading control. The level of pre-miRNA and miRNA in 1-week-old plants was arbitrarily assumed to be ‘1’, and the levels of pre-miRNA and miRNA were quantified relative to this at all other developmental stages. The miRNA is marked in red, the miRNA* in blue; 1w: one-week-old seedlings, 2w: two-week-old seedlings, 3w: three-week-old plants, 6w: six-week-old plants, 68d: 68-day-old plants, gDNA: genomic DNA; M - GeneRuler 100 bp Plus or 1kb Plus DNA Ladders.
    Figure Legend Snippet: Schematic representation of the MIR397b-3p gene and its precursors. Detection of pri-, pre- and mature miR397b-3p. ( A ) MIR397b-3p gene structure; left arrow indicates putative transcription start site; arrow marked as pA depicts precursor polyadenylation site. ( B ) pre-miRNA397b-3p hairpin structure (ΔG=−70.8 kcal/mol) and its rice orthologue (ΔG=−51.2 kcal/mol); the blue line indicates the region of the pre-miRNA from which the hybridization probe for precursor detection was designed, while the red line highlights the probe for detection of the mature miRNA. ( C ) Structure of pri-miRNA397b-3p (upper panel); RT-PCR analysis of its expression in five barley developmental stages (lower panel); primer positions are marked by black triangles on the pri-miRNA graph. ( D ) Real-time PCR measurements of pri-miRNA397b-3p expression level; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miRNA397b-3p molecule; detection of pre-miRNA (left upper panel), mature miR397b-3p (left middle panel), and miR397b-5p (right panel) using Northern hybridization. U6 was used as a loading control. The level of pre-miRNA and miRNA in 1-week-old plants was arbitrarily assumed to be ‘1’, and the levels of pre-miRNA and miRNA were quantified relative to this at all other developmental stages. The miRNA is marked in red, the miRNA* in blue; 1w: one-week-old seedlings, 2w: two-week-old seedlings, 3w: three-week-old plants, 6w: six-week-old plants, 68d: 68-day-old plants, gDNA: genomic DNA; M - GeneRuler 100 bp Plus or 1kb Plus DNA Ladders.

    Techniques Used: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    2) Product Images from "Splicing Factor 1 Modulates Dietary Restriction and TORC1 Pathway Longevity in C. elegans"

    Article Title: Splicing Factor 1 Modulates Dietary Restriction and TORC1 Pathway Longevity in C. elegans

    Journal: Nature

    doi: 10.1038/nature20789

    RT-PCR validation of alternative splicing events in ageing and with sfa-1 knockdown a, Sequencing reads coverage for tos-1 b, Age-associated isoform ratio change of a target of SFA-1, target of splicing ( tos-1 ) in WT worms at day 3 and 15 of adulthood ± sfa-1 RNAi by RT-PCR (biological replicates 3 and 4 shown). c, Sequencing read coverage map for ret-1 shows increased exon 5 skipping with age and with sfa-1 RNAi. d, Endogenous ret-1 exon 5 splicing pattern with age and sfa-1 RNAi in WT and DR worms by RT-PCR (day 3 vs. 15, 2 biological replicates shown). e, Sequencing tracks for lipl-7 pre-mRNA. f, Monitoring of intron retention between exons 4 and 5 at day 15 vs. day 3 of adulthood in WT and DR worms, +/− sfa-1 RNAi. g, Sequencing reads tracks for slo-2 pre-mRNA. h, slo-2 alternative exon skipping in day 3 and day 15 old WT and DR worms, +/− sfa-1 RNAi. i, Sequencing reads tracks for lea-1 pre-mRNA j , Alternative exon skipping in lea-1 with age and sfa-1 knockdown in WT and DR animals. Sequencing reads tracks generated by Splicing Java Coverage Viewer as part of SAJR 29 ; height of red lines represent RNA coverage of splice junctions, dark gray boxes represent exonic sequence, light gray boxes are alternative exon sequence.
    Figure Legend Snippet: RT-PCR validation of alternative splicing events in ageing and with sfa-1 knockdown a, Sequencing reads coverage for tos-1 b, Age-associated isoform ratio change of a target of SFA-1, target of splicing ( tos-1 ) in WT worms at day 3 and 15 of adulthood ± sfa-1 RNAi by RT-PCR (biological replicates 3 and 4 shown). c, Sequencing read coverage map for ret-1 shows increased exon 5 skipping with age and with sfa-1 RNAi. d, Endogenous ret-1 exon 5 splicing pattern with age and sfa-1 RNAi in WT and DR worms by RT-PCR (day 3 vs. 15, 2 biological replicates shown). e, Sequencing tracks for lipl-7 pre-mRNA. f, Monitoring of intron retention between exons 4 and 5 at day 15 vs. day 3 of adulthood in WT and DR worms, +/− sfa-1 RNAi. g, Sequencing reads tracks for slo-2 pre-mRNA. h, slo-2 alternative exon skipping in day 3 and day 15 old WT and DR worms, +/− sfa-1 RNAi. i, Sequencing reads tracks for lea-1 pre-mRNA j , Alternative exon skipping in lea-1 with age and sfa-1 knockdown in WT and DR animals. Sequencing reads tracks generated by Splicing Java Coverage Viewer as part of SAJR 29 ; height of red lines represent RNA coverage of splice junctions, dark gray boxes represent exonic sequence, light gray boxes are alternative exon sequence.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Sequencing, Generated

    3) Product Images from "Type I Interferon Response Is Delayed in Human Astrovirus Infections"

    Article Title: Type I Interferon Response Is Delayed in Human Astrovirus Infections

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0123087

    Induction of an IFN response is delayed during HAstV infection. (A) Temporal analysis of induction of IFN-β and ISG56 mRNA expression by in CaCo-2 cells infected with HAstV at a MOI of 1. Mock-infected cells, cells treated for 24 h with exogenous IFN at 1,000 U/ml, and polyI:C-transfected cells were used as controls. (B) HAstV growth curve on CaCo-2 cells at 2 different MOIs. Total HAstV RNA was measured by qRT-PCR at the indicated times post-infection. Data represent mean values of duplicate wells and error bars represent the standard error of the mean (SEM).
    Figure Legend Snippet: Induction of an IFN response is delayed during HAstV infection. (A) Temporal analysis of induction of IFN-β and ISG56 mRNA expression by in CaCo-2 cells infected with HAstV at a MOI of 1. Mock-infected cells, cells treated for 24 h with exogenous IFN at 1,000 U/ml, and polyI:C-transfected cells were used as controls. (B) HAstV growth curve on CaCo-2 cells at 2 different MOIs. Total HAstV RNA was measured by qRT-PCR at the indicated times post-infection. Data represent mean values of duplicate wells and error bars represent the standard error of the mean (SEM).

    Techniques Used: Infection, Expressing, Transfection, Quantitative RT-PCR

    4) Product Images from "Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells"

    Article Title: Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2011.1

    IL-3 modulates Xbp1 expression and splicing. ( a ) An RT-PCR analysis of Xbp1 . Both un-spliced and spliced forms decreased after withdrawal of IL-3. β-actin was used to confirm the quality and quantity of RNA. ( b ) Xbp1 expression is comparable between BaF3 with IL-3 and B6F without IL-3. ( c and d ) Upregulation of Xbp1S expression by IL-3 stimulation. BaF3 cells were cultured under the IL-3-free condition for 16 h. IL-3 was then added to the medium at 10 ng/ml and cells were harvested after incubation for the indicated periods. Whole cell extracts of BaF3 were subjected to RT-PCR ( c ) to detect Xbp1S and Xbp1U , and western blotting ( d ) to detect Xbp1S, phospho-IRE1, IRE1, cleaved ATF6, phospho-Stat5, GRP78 and GAPDH. Both Xbp1S upregulation and IRE1 phosphorylation was observed at 48 h after IL-3 stimulation. ( e ) Genomic DNA fragments encompassing the Xbp1 upstream region indicated were subcloned into the pGL3 basic vector. The constructs were nucleofected together with pRL-SV40 into 32Dcl3 and the cells were incubated for 24 h in growth medium containing IL-3. The cells were starved for IL-3 for 24 h and IL-3 was then added for additional 12 h. The cells were harvested at each time point and subjected to the luciferase assay. The bars represent the means of the relative luciferase activities, which were calculated by dividing the luciferase activity by the Renilla activity used as a transfection control. The means±S.D. from three independent experiments are shown ( ** P
    Figure Legend Snippet: IL-3 modulates Xbp1 expression and splicing. ( a ) An RT-PCR analysis of Xbp1 . Both un-spliced and spliced forms decreased after withdrawal of IL-3. β-actin was used to confirm the quality and quantity of RNA. ( b ) Xbp1 expression is comparable between BaF3 with IL-3 and B6F without IL-3. ( c and d ) Upregulation of Xbp1S expression by IL-3 stimulation. BaF3 cells were cultured under the IL-3-free condition for 16 h. IL-3 was then added to the medium at 10 ng/ml and cells were harvested after incubation for the indicated periods. Whole cell extracts of BaF3 were subjected to RT-PCR ( c ) to detect Xbp1S and Xbp1U , and western blotting ( d ) to detect Xbp1S, phospho-IRE1, IRE1, cleaved ATF6, phospho-Stat5, GRP78 and GAPDH. Both Xbp1S upregulation and IRE1 phosphorylation was observed at 48 h after IL-3 stimulation. ( e ) Genomic DNA fragments encompassing the Xbp1 upstream region indicated were subcloned into the pGL3 basic vector. The constructs were nucleofected together with pRL-SV40 into 32Dcl3 and the cells were incubated for 24 h in growth medium containing IL-3. The cells were starved for IL-3 for 24 h and IL-3 was then added for additional 12 h. The cells were harvested at each time point and subjected to the luciferase assay. The bars represent the means of the relative luciferase activities, which were calculated by dividing the luciferase activity by the Renilla activity used as a transfection control. The means±S.D. from three independent experiments are shown ( ** P

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Incubation, Western Blot, Plasmid Preparation, Construct, Luciferase, Activity Assay, Transfection

    Xbp1 expression and activation is regulated by PI3K and Stat5 signaling. ( a ) Real-time PCR of Xbp1 . Xbp1 expression was reduced by LY294002 treatment (30 μ M) but not PD98059 (50 μ M) in BaF3 cells ( ** P
    Figure Legend Snippet: Xbp1 expression and activation is regulated by PI3K and Stat5 signaling. ( a ) Real-time PCR of Xbp1 . Xbp1 expression was reduced by LY294002 treatment (30 μ M) but not PD98059 (50 μ M) in BaF3 cells ( ** P

    Techniques Used: Expressing, Activation Assay, Real-time Polymerase Chain Reaction

    5) Product Images from "Improving the Pathogenicity of a Nematode-Trapping Fungus by Genetic Engineering of a Subtilisin with Nematotoxic Activity"

    Article Title: Improving the Pathogenicity of a Nematode-Trapping Fungus by Genetic Engineering of a Subtilisin with Nematotoxic Activity

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.68.7.3408-3415.2002

    Construction of Δ PII mutants. (A) Gene disruption vector pBHE constructed by inserting the hph gene ( Escherichia coli hygromycin B resistance gene, under the control of the trpC promoter from A. nidulans ) in the open reading frame of PII present in the vector pUBH. fla, flanking region. Arrows indicate PCR primers used for cloning (a 1 and a 2 ) and for screening (b 1 and b 2 ). (B) Southern analysis of gene disruption mutants obtained using the vector pBHE. Genomic DNA was digested with Bam HI/ Hin dIII and probed with a 32 P-labeled fragment of the PII gene ( Bam HI/ Hin ). Lanes 1 to 5 are mutants (designated TJÅDPII.2, -3, -4, -9, and -20) for which the mutated PII gene has been homologously integrated into the genome. Lane 6 shows a mutant (TJÅDPII.8) containing nonhomologous integration of the mutated PII gene. Lane 7 is the wild type. (C) Partial purification of the extracellular serine proteases produced by the wild type and the deletion mutant TJÅDPII.2 of A. oligospora ). One-milliliter fractions were collected and assayed for protease activity by using the chromogenic substrate Azocoll.
    Figure Legend Snippet: Construction of Δ PII mutants. (A) Gene disruption vector pBHE constructed by inserting the hph gene ( Escherichia coli hygromycin B resistance gene, under the control of the trpC promoter from A. nidulans ) in the open reading frame of PII present in the vector pUBH. fla, flanking region. Arrows indicate PCR primers used for cloning (a 1 and a 2 ) and for screening (b 1 and b 2 ). (B) Southern analysis of gene disruption mutants obtained using the vector pBHE. Genomic DNA was digested with Bam HI/ Hin dIII and probed with a 32 P-labeled fragment of the PII gene ( Bam HI/ Hin ). Lanes 1 to 5 are mutants (designated TJÅDPII.2, -3, -4, -9, and -20) for which the mutated PII gene has been homologously integrated into the genome. Lane 6 shows a mutant (TJÅDPII.8) containing nonhomologous integration of the mutated PII gene. Lane 7 is the wild type. (C) Partial purification of the extracellular serine proteases produced by the wild type and the deletion mutant TJÅDPII.2 of A. oligospora ). One-milliliter fractions were collected and assayed for protease activity by using the chromogenic substrate Azocoll.

    Techniques Used: Plasmid Preparation, Construct, Polymerase Chain Reaction, Clone Assay, Labeling, Mutagenesis, Purification, Produced, Activity Assay

    Expression of the subtilisin PII during the infection of nematodes. (A) Adhesion and killing of the nematode P. redivivus during infection by the fungus A. oligospora . The numbers of adhered (captured) and killed (captured and not moving) nematodes were counted using a microscope. (B) Results of analysis of transcript levels of PII and tubA , using competitive reverse transcription-PCR. Tubulin was used as a positive control gene fragment and for normalizing the data. ▪, PII transcript level; □, tubA transcript level; ▴, PII - tubA molar ratio.
    Figure Legend Snippet: Expression of the subtilisin PII during the infection of nematodes. (A) Adhesion and killing of the nematode P. redivivus during infection by the fungus A. oligospora . The numbers of adhered (captured) and killed (captured and not moving) nematodes were counted using a microscope. (B) Results of analysis of transcript levels of PII and tubA , using competitive reverse transcription-PCR. Tubulin was used as a positive control gene fragment and for normalizing the data. ▪, PII transcript level; □, tubA transcript level; ▴, PII - tubA molar ratio.

    Techniques Used: Expressing, Infection, Microscopy, Polymerase Chain Reaction, Positive Control

    6) Product Images from "Leucine-rich repeat kinase 2 induces ?-synuclein expression via the extracellular signal-regulated kinase pathway"

    Article Title: Leucine-rich repeat kinase 2 induces ?-synuclein expression via the extracellular signal-regulated kinase pathway

    Journal: Cellular signalling

    doi: 10.1016/j.cellsig.2010.01.006

    LRRK2-mediated induction of SNCA is repressed by the phospho-MEK1/2 inhibitor U0126. HEK293 cells transiently transfected with different LRRK2 constructs were treated with 10 μg/ml U0126 or vehicle (DMSO) for 12 h prior to harvesting. Total mRNA was extracted and SNCA-specific mRNA quantified by real-time RT-PCR to measure the induction levels of SNCA. Similar results were achieved in 3 independent experiments.
    Figure Legend Snippet: LRRK2-mediated induction of SNCA is repressed by the phospho-MEK1/2 inhibitor U0126. HEK293 cells transiently transfected with different LRRK2 constructs were treated with 10 μg/ml U0126 or vehicle (DMSO) for 12 h prior to harvesting. Total mRNA was extracted and SNCA-specific mRNA quantified by real-time RT-PCR to measure the induction levels of SNCA. Similar results were achieved in 3 independent experiments.

    Techniques Used: Transfection, Construct, Quantitative RT-PCR

    7) Product Images from "MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting"

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003785

    miR-17-92 represses genes important for craniofacial development. (A–D) Whole mount in situ hybridization with indicated probes in mouse embryos with designated genotypes. Black arrows and arrowhead designate expression pattern. (E) qRT-PCR data indicate that expression of Fgf10 , Shox2 , Tbx1 , Tbx3 and Osr1 is elevated in miR-17-92 ; miR-106b-25 compound knock out mutants. (F) Overexpression of miR-17-92 in cranial neural crest results in repression of Fgf10 , Shox2 , Tbx1 , Tbx3 and Osr1 . (G) Luciferase reporter assays with Tbx3 reporters and miRs as labeled (See Fig. S5 for miR seed sites and mutations). mean ±s.e.m., * indicates statistically significant difference, Student's t -test (P
    Figure Legend Snippet: miR-17-92 represses genes important for craniofacial development. (A–D) Whole mount in situ hybridization with indicated probes in mouse embryos with designated genotypes. Black arrows and arrowhead designate expression pattern. (E) qRT-PCR data indicate that expression of Fgf10 , Shox2 , Tbx1 , Tbx3 and Osr1 is elevated in miR-17-92 ; miR-106b-25 compound knock out mutants. (F) Overexpression of miR-17-92 in cranial neural crest results in repression of Fgf10 , Shox2 , Tbx1 , Tbx3 and Osr1 . (G) Luciferase reporter assays with Tbx3 reporters and miRs as labeled (See Fig. S5 for miR seed sites and mutations). mean ±s.e.m., * indicates statistically significant difference, Student's t -test (P

    Techniques Used: In Situ Hybridization, Expressing, Quantitative RT-PCR, Knock-Out, Over Expression, Luciferase, Labeling

    8) Product Images from "A peculiar IclR family transcription factor regulates para-hydroxybenzoate catabolism in Streptomyces coelicolor"

    Article Title: A peculiar IclR family transcription factor regulates para-hydroxybenzoate catabolism in Streptomyces coelicolor

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx1234

    Biochemical and bioinformatic analyses of PobR, a negative regulator of pobA . ( A ) Predicted domains organization of PobR protein. Both N-terminal domain and C-terminal domains of PobR are homologous to intact IclR family transcription factors. ( B ) The overall view of the region upstream of the pobA open reading frame (ORF), highlighting the transcription start site of pobA (turquoise), putative -35 and -10 pobA promoter elements (underlined and highlighted in orange) and the PobR regulator binding site sequence (in bold and boxed). ( C ) DNA binding of PobR was assessed using agarose electrophoretic mobility shift assays (EMSAs). A PCR-amplified DNA fragment spanning the entire region between the transcription and translation start sites (5′-untranslated region) was titrated with PobR. In comparison with the unbound DNA probe in the electrophoresis, retarded migration of the DNA probe was observed upon addition of PobR. Bands representing the PobR-DNA probe complex and the unbound DNA probe are highlighted by arrows. For a negative control, a 486-bp fragment amplified from hrdB ORF, which does not contain the PobR binding site, was used. ( D ) The PobR binding site upstream of the pobA ORF was mapped using DNase I footprinting analysis. A 5′- 32 P end-labeled 118-bp DNA fragment was digested with DNase I in the absence and presence of heterologously produced and purified PobR. In comparison with the DNA digest in the absence of PobR, a protected region was observed when DNA was incubated with PobR before digestion. Sequencing ladders indicated by lanes C/T and A/G were generated via Maxam-Gilbert reactions. The reactions were performed in duplicate. ( E ) Sequence alignment of the regions upstream of the pobA ORFs in various streptomycetes. Putative –35 and –10 pobA promoter elements and PobR binding site sequence (boxed) identified in DNase I footprinting reaction are conserved in several members of the Streptomyces genus. A conserved PobR binding site was also identified using the Gibbs Motif Sampler ( 47 ). Sequence logo images ( 51 ) depict the sequence conservation of PobR binding site.
    Figure Legend Snippet: Biochemical and bioinformatic analyses of PobR, a negative regulator of pobA . ( A ) Predicted domains organization of PobR protein. Both N-terminal domain and C-terminal domains of PobR are homologous to intact IclR family transcription factors. ( B ) The overall view of the region upstream of the pobA open reading frame (ORF), highlighting the transcription start site of pobA (turquoise), putative -35 and -10 pobA promoter elements (underlined and highlighted in orange) and the PobR regulator binding site sequence (in bold and boxed). ( C ) DNA binding of PobR was assessed using agarose electrophoretic mobility shift assays (EMSAs). A PCR-amplified DNA fragment spanning the entire region between the transcription and translation start sites (5′-untranslated region) was titrated with PobR. In comparison with the unbound DNA probe in the electrophoresis, retarded migration of the DNA probe was observed upon addition of PobR. Bands representing the PobR-DNA probe complex and the unbound DNA probe are highlighted by arrows. For a negative control, a 486-bp fragment amplified from hrdB ORF, which does not contain the PobR binding site, was used. ( D ) The PobR binding site upstream of the pobA ORF was mapped using DNase I footprinting analysis. A 5′- 32 P end-labeled 118-bp DNA fragment was digested with DNase I in the absence and presence of heterologously produced and purified PobR. In comparison with the DNA digest in the absence of PobR, a protected region was observed when DNA was incubated with PobR before digestion. Sequencing ladders indicated by lanes C/T and A/G were generated via Maxam-Gilbert reactions. The reactions were performed in duplicate. ( E ) Sequence alignment of the regions upstream of the pobA ORFs in various streptomycetes. Putative –35 and –10 pobA promoter elements and PobR binding site sequence (boxed) identified in DNase I footprinting reaction are conserved in several members of the Streptomyces genus. A conserved PobR binding site was also identified using the Gibbs Motif Sampler ( 47 ). Sequence logo images ( 51 ) depict the sequence conservation of PobR binding site.

    Techniques Used: Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Polymerase Chain Reaction, Amplification, Electrophoresis, Migration, Negative Control, Footprinting, Labeling, Produced, Purification, Incubation, Generated

    9) Product Images from "Silencing of Vlaro2 for chorismate synthase revealed that the phytopathogen Verticillium longisporum induces the cross-pathway control in the xylem"

    Article Title: Silencing of Vlaro2 for chorismate synthase revealed that the phytopathogen Verticillium longisporum induces the cross-pathway control in the xylem

    Journal: Applied Microbiology and Biotechnology

    doi: 10.1007/s00253-009-2269-0

    Infection assay and determination of the V. longisporum DNA concentration in the infected plant tissue. a V. longisporum DNA concentration in the plant stem. b V. longisporum DNA concentration in the hypocotyl . V. longisporum DNA was measured with real-time PCR in stem and hypocotyl of B. napus inoculated with Vlaro 2 silenced mutant ( Vlaro2sm ) and wild type ( wt ) at 14, 21, 28, and 35 dpi. Data represent average ± standard deviations of three experimental replicates. The mock-inoculated plants as a control did not show presence of any V. longisporum DNA. N VL DNA / g FW = nanogram V. longisporum DNA/gram fresh weight of plant tissue. (In the inset , a representative rapeseed plant depicting the stem (5–6 cm from the top) and the hypocotyl harvested for the quantification of the V. longisporum DNA is shown). c V. longisporum DNA concentration in A. thaliana . DNA was measured with real-time PCR in A. thaliana inoculated with Vlaro 2 silenced mutant ( Vlaro2sm ) and wild type ( wt ) at 28 dpi. Data represent average ± standard deviations of three experimental replicates. The mock-inoculated plants as a control did not show presence of any V. longisporum DNA. P Vl DNA / 10 8 molecules of actin , picogram V. longisporum DNA/10 8 molecules of actin of A. thaliana
    Figure Legend Snippet: Infection assay and determination of the V. longisporum DNA concentration in the infected plant tissue. a V. longisporum DNA concentration in the plant stem. b V. longisporum DNA concentration in the hypocotyl . V. longisporum DNA was measured with real-time PCR in stem and hypocotyl of B. napus inoculated with Vlaro 2 silenced mutant ( Vlaro2sm ) and wild type ( wt ) at 14, 21, 28, and 35 dpi. Data represent average ± standard deviations of three experimental replicates. The mock-inoculated plants as a control did not show presence of any V. longisporum DNA. N VL DNA / g FW = nanogram V. longisporum DNA/gram fresh weight of plant tissue. (In the inset , a representative rapeseed plant depicting the stem (5–6 cm from the top) and the hypocotyl harvested for the quantification of the V. longisporum DNA is shown). c V. longisporum DNA concentration in A. thaliana . DNA was measured with real-time PCR in A. thaliana inoculated with Vlaro 2 silenced mutant ( Vlaro2sm ) and wild type ( wt ) at 28 dpi. Data represent average ± standard deviations of three experimental replicates. The mock-inoculated plants as a control did not show presence of any V. longisporum DNA. P Vl DNA / 10 8 molecules of actin , picogram V. longisporum DNA/10 8 molecules of actin of A. thaliana

    Techniques Used: Infection, Concentration Assay, Real-time Polymerase Chain Reaction, Mutagenesis

    Characterization of the Vlaro 2 silenced mutants. a Southern hybridization analysis of Vlaro 2 silenced mutants to detect integration of T-DNA after A. tumefaciens -mediated transformation . Five Vlaro 2 silenced mutants ( 1 – 5 ) and wild-type ( wt ) gDNA was digested with Hin dIII and the hygromycin resistance gene was used as a probe. All mutants showed single integration of the gene. b RT-PCR analysis of Vlaro 2 mRNA expression in the Vlaro 2 silenced mutants. For RNA integrity, the actin gene was used as a control. 1 – 5 , Vlaro 2 silenced mutants; wt , wild type; NTC , no template control. c Western hybridization analysis of Vlaro 2 expression in the Vlaro 2 silenced mutants compared to the wild type. Proteins were extracted from the Vlaro 2 silenced mutants and wild type, ran on SDS-polyacrylamide gel, blotted and probed with N. crassa CS antibody. The same blot was stripped and probed again with Rat IgG tubulin antibody as a control. 1 – 5 , Vlaro 2 silenced mutants; wt , wild type. In the graph , CS expression was quantified and normalized against the tubulin level for the different samples using Kodak Molecular Imaging 4.05 software. Data represent average ± standard deviations of three experimental replicates
    Figure Legend Snippet: Characterization of the Vlaro 2 silenced mutants. a Southern hybridization analysis of Vlaro 2 silenced mutants to detect integration of T-DNA after A. tumefaciens -mediated transformation . Five Vlaro 2 silenced mutants ( 1 – 5 ) and wild-type ( wt ) gDNA was digested with Hin dIII and the hygromycin resistance gene was used as a probe. All mutants showed single integration of the gene. b RT-PCR analysis of Vlaro 2 mRNA expression in the Vlaro 2 silenced mutants. For RNA integrity, the actin gene was used as a control. 1 – 5 , Vlaro 2 silenced mutants; wt , wild type; NTC , no template control. c Western hybridization analysis of Vlaro 2 expression in the Vlaro 2 silenced mutants compared to the wild type. Proteins were extracted from the Vlaro 2 silenced mutants and wild type, ran on SDS-polyacrylamide gel, blotted and probed with N. crassa CS antibody. The same blot was stripped and probed again with Rat IgG tubulin antibody as a control. 1 – 5 , Vlaro 2 silenced mutants; wt , wild type. In the graph , CS expression was quantified and normalized against the tubulin level for the different samples using Kodak Molecular Imaging 4.05 software. Data represent average ± standard deviations of three experimental replicates

    Techniques Used: Hybridization, Transformation Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Western Blot, Imaging, Software

    10) Product Images from "Identification and characterization of human Mex-3 proteins, a novel family of evolutionarily conserved RNA-binding proteins differentially localized to processing bodies"

    Article Title: Identification and characterization of human Mex-3 proteins, a novel family of evolutionarily conserved RNA-binding proteins differentially localized to processing bodies

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm016

    Biochemical characterization of hMex-3 proteins. ( A and B ) BOSC cells were transiently transfected with vectors expressing myc-tagged forms of hMex-3A, -3B and -3C. Western blot analysis was performed with anti-myc antibody. In (B) treatment of protein extracts with (+) or without (−) λ-Phosphatase. ( C ) Kinase assay. hMex-3A and -3B proteins or a control protein (Bpag1) expressed in BOSC cells were immunoprecipitated with the anti-myc antibody and incubated with kinase buffer and [γ 32 P] ATP. Labeled proteins were revealed by autoradiography. ( D ) RNA homopolymer binding assay. Proteins from indicated expression vectors were in vitro translated in the presence of [ 35 S] methionine ( top ). Binding to agarose beads coupled to poly(A) ( bottom ) RNA homopolymers is shown for in vitro translated proteins. As a negative control, a fragment of P62-sequestosome protein was incubated with RNA homopolymers in the same conditions. One-tenth of the initial translation reactions and all the bound proteins were analysed by SDS-PAGE and autoradiography. ( E ) In vivo hMex-3 binding to mRNA. BOSC cells were transiently transfected with vectors expressing myc-tagged proteins, as indicated. RT-PCR amplification was performed on total RNA extracted from those cells ( top left ). Western blot analysis performed with anti-myc antibody ( bottom left ). RT-PCR amplification performed on total RNA extracted from sepharose-protein A beads after immunoprecipitation by an anti-myc antibody ( right ).
    Figure Legend Snippet: Biochemical characterization of hMex-3 proteins. ( A and B ) BOSC cells were transiently transfected with vectors expressing myc-tagged forms of hMex-3A, -3B and -3C. Western blot analysis was performed with anti-myc antibody. In (B) treatment of protein extracts with (+) or without (−) λ-Phosphatase. ( C ) Kinase assay. hMex-3A and -3B proteins or a control protein (Bpag1) expressed in BOSC cells were immunoprecipitated with the anti-myc antibody and incubated with kinase buffer and [γ 32 P] ATP. Labeled proteins were revealed by autoradiography. ( D ) RNA homopolymer binding assay. Proteins from indicated expression vectors were in vitro translated in the presence of [ 35 S] methionine ( top ). Binding to agarose beads coupled to poly(A) ( bottom ) RNA homopolymers is shown for in vitro translated proteins. As a negative control, a fragment of P62-sequestosome protein was incubated with RNA homopolymers in the same conditions. One-tenth of the initial translation reactions and all the bound proteins were analysed by SDS-PAGE and autoradiography. ( E ) In vivo hMex-3 binding to mRNA. BOSC cells were transiently transfected with vectors expressing myc-tagged proteins, as indicated. RT-PCR amplification was performed on total RNA extracted from those cells ( top left ). Western blot analysis performed with anti-myc antibody ( bottom left ). RT-PCR amplification performed on total RNA extracted from sepharose-protein A beads after immunoprecipitation by an anti-myc antibody ( right ).

    Techniques Used: Transfection, Expressing, Western Blot, Kinase Assay, Immunoprecipitation, Incubation, Labeling, Autoradiography, Binding Assay, In Vitro, Negative Control, SDS Page, In Vivo, Reverse Transcription Polymerase Chain Reaction, Amplification

    Expression profile of hMex -3 genes and hMex-3B protein. ( A ) Human Mex -3 gene expression levels ( panels 1–4 ) were examined by RT-PCR with specific internal primers and were compared with expression level of ubiquitously expressed GAPDH gene ( panel 5 ). RNA were extracted from 7 human cell lines ( left ) and from 20 human tissues (Multiple Tissue Total RNA panel, BD Biosciences) ( right ). ( B ) Human colon sections (magnification: ×100 or ×400) were stained with anti-hMex-3Bβ antibody ( panels 1 and 2 ), anti-hMex-3Bβ antibody + hMex-3B peptide, as control ( panel 3 ). ( C ) Serial sections of human Meckel's diverticulum (magnification: ×100 or ×400) were stained with anti-hMex-3Bβ ( top left ) and anti-MUC2 ( bottom left ), anti-hMex-3Bβ ( top middle ) and anti-Chromogranin-A ( bottom middle ), anti-hMex-3Bβ ( top right ) and anti-Lysozyme ( bottom right ).
    Figure Legend Snippet: Expression profile of hMex -3 genes and hMex-3B protein. ( A ) Human Mex -3 gene expression levels ( panels 1–4 ) were examined by RT-PCR with specific internal primers and were compared with expression level of ubiquitously expressed GAPDH gene ( panel 5 ). RNA were extracted from 7 human cell lines ( left ) and from 20 human tissues (Multiple Tissue Total RNA panel, BD Biosciences) ( right ). ( B ) Human colon sections (magnification: ×100 or ×400) were stained with anti-hMex-3Bβ antibody ( panels 1 and 2 ), anti-hMex-3Bβ antibody + hMex-3B peptide, as control ( panel 3 ). ( C ) Serial sections of human Meckel's diverticulum (magnification: ×100 or ×400) were stained with anti-hMex-3Bβ ( top left ) and anti-MUC2 ( bottom left ), anti-hMex-3Bβ ( top middle ) and anti-Chromogranin-A ( bottom middle ), anti-hMex-3Bβ ( top right ) and anti-Lysozyme ( bottom right ).

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Staining

    11) Product Images from "Bmp signaling represses Vegfa to promote outflow tract cushion development"

    Article Title: Bmp signaling represses Vegfa to promote outflow tract cushion development

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.097360

    miR-17/20a are downstream effectors of Bmp signaling. ( A ) Analysis of the Vegfa 3′UTR reveals a highly conserved miR-17/20a binding site (boxed). Species abbreviations as . ( B ) qRT-PCR analysis of pri-miR-17-92, miR-17 and miR-20a in the
    Figure Legend Snippet: miR-17/20a are downstream effectors of Bmp signaling. ( A ) Analysis of the Vegfa 3′UTR reveals a highly conserved miR-17/20a binding site (boxed). Species abbreviations as . ( B ) qRT-PCR analysis of pri-miR-17-92, miR-17 and miR-20a in the

    Techniques Used: Binding Assay, Quantitative RT-PCR

    12) Product Images from "Xenopus ?-catenin is essential in early embryogenesis and is functionally linked to cadherins and small GTPases"

    Article Title: Xenopus ?-catenin is essential in early embryogenesis and is functionally linked to cadherins and small GTPases

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.031948

    Spatial expression of Xenopus δ-catenin. (A) As viewed in animal versus vegetal regions, whole-mount in situ RNA hybridization detects δ-catenin mRNA signals in the ectoderm regions of blastula (subpanels A-C) and gastrula (subpanel D) embryos. At neurulation (subpanel E), the anterior and dorsal neural regions displayed the most apparent signals. Embryos at tadpole stages (subpanel F) showed a distinctive staining pattern in tissues of neural derivation such as brain, eye vesicle, ear vesicle, branchial arches (higher magnification in subpanel G) and spinal cord as well as somites (higher magnification in subpanel H). Subpanels I-L are cross-section views of paraffin-fixed embryos from corresponding stages. Sense probe hybridization was processed in parallel as negative controls (subpanels M-O). (B) RT-PCR analyses detect δ-catenin transcripts in all adult Xenopus tissues examined, with stronger expression in brain, nerve, muscle and skin. (C) Immunoblotting using an N-terminus-directed antibody detected three δ-catenin isoforms migrating at approximately 160, 130 and 100 kDa. The 130 and 100 kDa isoforms are ubiquitously present, whereas the 160 kDa appears to be brain specific. An antibody directed against the δ-catenin C-terminus reacts with the 160 kDa and 130 kDa isoforms in brain.
    Figure Legend Snippet: Spatial expression of Xenopus δ-catenin. (A) As viewed in animal versus vegetal regions, whole-mount in situ RNA hybridization detects δ-catenin mRNA signals in the ectoderm regions of blastula (subpanels A-C) and gastrula (subpanel D) embryos. At neurulation (subpanel E), the anterior and dorsal neural regions displayed the most apparent signals. Embryos at tadpole stages (subpanel F) showed a distinctive staining pattern in tissues of neural derivation such as brain, eye vesicle, ear vesicle, branchial arches (higher magnification in subpanel G) and spinal cord as well as somites (higher magnification in subpanel H). Subpanels I-L are cross-section views of paraffin-fixed embryos from corresponding stages. Sense probe hybridization was processed in parallel as negative controls (subpanels M-O). (B) RT-PCR analyses detect δ-catenin transcripts in all adult Xenopus tissues examined, with stronger expression in brain, nerve, muscle and skin. (C) Immunoblotting using an N-terminus-directed antibody detected three δ-catenin isoforms migrating at approximately 160, 130 and 100 kDa. The 130 and 100 kDa isoforms are ubiquitously present, whereas the 160 kDa appears to be brain specific. An antibody directed against the δ-catenin C-terminus reacts with the 160 kDa and 130 kDa isoforms in brain.

    Techniques Used: Expressing, In Situ, Hybridization, Staining, Reverse Transcription Polymerase Chain Reaction

    13) Product Images from "DIFFERENTIAL TRANSCRIPTIONAL CONTROL OF THE SOD2 ?B ELEMENT IN NEURONS AND ASTROCYTES *"

    Article Title: DIFFERENTIAL TRANSCRIPTIONAL CONTROL OF THE SOD2 ?B ELEMENT IN NEURONS AND ASTROCYTES *

    Journal: The Journal of biological chemistry

    doi: 10.1074/jbc.M604166200

    Association of Sp-factors with the SOD2 κB element in situ The NT2 cell line was differentiated into neuronal cells with retinoic acid, and the T98G astroglioma cell line was stimulated with 50 ng/ml TNF for 30 min. Cultures were then fixed in formaldehyde and processed for immunoprecipitation with antibody to p50, p65, Sp1, Sp3, or Sp4. A negative-control precipitation was also performed with protein A/G-agarose alone. Coprecipitating DNA was subjected to PCR with primers directed against the the κB region in the SOD2 second intron. From the blank precipitation, the extract from the boiled pellet (“no Ab”) and the initial supernatant (“input”) were also subjected to PCR as negative and positive controls, respectively.
    Figure Legend Snippet: Association of Sp-factors with the SOD2 κB element in situ The NT2 cell line was differentiated into neuronal cells with retinoic acid, and the T98G astroglioma cell line was stimulated with 50 ng/ml TNF for 30 min. Cultures were then fixed in formaldehyde and processed for immunoprecipitation with antibody to p50, p65, Sp1, Sp3, or Sp4. A negative-control precipitation was also performed with protein A/G-agarose alone. Coprecipitating DNA was subjected to PCR with primers directed against the the κB region in the SOD2 second intron. From the blank precipitation, the extract from the boiled pellet (“no Ab”) and the initial supernatant (“input”) were also subjected to PCR as negative and positive controls, respectively.

    Techniques Used: In Situ, Immunoprecipitation, Negative Control, Polymerase Chain Reaction

    14) Product Images from "Atf4 regulates chondrocyte proliferation and differentiation during endochondral ossification by activating Ihh transcription"

    Article Title: Atf4 regulates chondrocyte proliferation and differentiation during endochondral ossification by activating Ihh transcription

    Journal: Development (Cambridge, England)

    doi: 10.1242/dev.043281

    Ihh expression is decreased in Atf4 −/− cartilage. ( Aa-o ′) In situ hybridization of sections of E14, E16 and P0 WT and Atf4 −/− mouse humeri. Note the decrease in Ihh and Gli1 , but normal PPR ( Pth1r ), expression in Atf4 −/− growth plates. Although the Col2a1 -positive zones are shorter and the Col10a1- positive zones are slightly longer than their WT counterparts at every stage examined, the expression of Col2a1 and Col10a1 was unchanged in Atf4 −/− growth plates. Scale bars: 0.2 mm. ( B ) qRT-PCR analysis showing decreased levels of Ihh, PTHrP ( Pthlh ) and Gli1 and normal levels of PPR mRNA in E14 Atf4 −/− cartilage. Data are normalized to expression levels in WT cartilage and 18S rRNA ( n =3).
    Figure Legend Snippet: Ihh expression is decreased in Atf4 −/− cartilage. ( Aa-o ′) In situ hybridization of sections of E14, E16 and P0 WT and Atf4 −/− mouse humeri. Note the decrease in Ihh and Gli1 , but normal PPR ( Pth1r ), expression in Atf4 −/− growth plates. Although the Col2a1 -positive zones are shorter and the Col10a1- positive zones are slightly longer than their WT counterparts at every stage examined, the expression of Col2a1 and Col10a1 was unchanged in Atf4 −/− growth plates. Scale bars: 0.2 mm. ( B ) qRT-PCR analysis showing decreased levels of Ihh, PTHrP ( Pthlh ) and Gli1 and normal levels of PPR mRNA in E14 Atf4 −/− cartilage. Data are normalized to expression levels in WT cartilage and 18S rRNA ( n =3).

    Techniques Used: Expressing, In Situ Hybridization, Quantitative RT-PCR

    Related Articles

    Amplification:

    Article Title: Leucine-rich repeat kinase 2 induces ?-synuclein expression via the extracellular signal-regulated kinase pathway
    Article Snippet: .. The 7.58 kb LRRK2 gene was amplified with a high fidelity PCR System (Roche) by using four complementary fragments from human brain (BD Biosciences Clontech) and cerebellum cDNA libraries (Dr. K. Kaupmann, Novartis). .. Full-length cDNA was generated by subcloning the fragments in the mammalian expression vector pCI (Promega) using the three unique internal restriction sites AfeI, NdeI and ClaI.

    Article Title: Splicing Factor 1 Modulates Dietary Restriction and TORC1 Pathway Longevity in C. elegans
    Article Snippet: .. Expand High Fidelity PCR System (Roche) or Apex Taq RED (Genesee Scientific) was used for amplification with an annealing temperature of 60°C and 35 cycles. .. Alternative splicing events detected by our RNA-Seq analysis were validated using Apex Taq RED master mix.

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs
    Article Snippet: .. The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix. .. Genomic DNA template was used as a positive PCR control.

    Article Title: Improving the Pathogenicity of a Nematode-Trapping Fungus by Genetic Engineering of a Subtilisin with Nematotoxic Activity
    Article Snippet: .. The genomic PII clone pUBH was PCR amplified (Expand High-Fidelity PCR system; Roche Molecular Biochemicals) with two primers designed from the PII sequence: a1 (5′-TGGGAGATGCGAATACCGGT; position 854 to 873; GenBank accession no. ) and a2 (5′-ACCGTGAATGGTTCATCCCG; position 948 to 967). .. The hph gene under the control of the trpC promoter from Aspergillus nidulans was excised from the plasmid pCB1003 using Eco RI ( ).

    Polymerase Chain Reaction:

    Article Title: Leucine-rich repeat kinase 2 induces ?-synuclein expression via the extracellular signal-regulated kinase pathway
    Article Snippet: .. The 7.58 kb LRRK2 gene was amplified with a high fidelity PCR System (Roche) by using four complementary fragments from human brain (BD Biosciences Clontech) and cerebellum cDNA libraries (Dr. K. Kaupmann, Novartis). .. Full-length cDNA was generated by subcloning the fragments in the mammalian expression vector pCI (Promega) using the three unique internal restriction sites AfeI, NdeI and ClaI.

    Article Title: Splicing Factor 1 Modulates Dietary Restriction and TORC1 Pathway Longevity in C. elegans
    Article Snippet: .. Expand High Fidelity PCR System (Roche) or Apex Taq RED (Genesee Scientific) was used for amplification with an annealing temperature of 60°C and 35 cycles. .. Alternative splicing events detected by our RNA-Seq analysis were validated using Apex Taq RED master mix.

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Article Title: Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells
    Article Snippet: .. RT-PCR The splicing of Xbp1 was detected by RT-PCR using (Promega) and Expand High Fidelity PCR System (Roche, Basel, Switzerland) using the Xbp1 362F (5′-TAACGGGAGAAAACTCACGGC-3′) and Xbp1 1017R (5′-CAGACAATGGCTGGATGAAAGC-3′) primers. .. PCR products were digested by Pst I to differentiate Xbp1U from Xbp1S , separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.

    Article Title: Type I Interferon Response Is Delayed in Human Astrovirus Infections
    Article Snippet: .. Conventional RT-PCR reactions to detect HAstV RNA, IFN-β, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), and ISG56 mRNAs were performed using Expand Reverse Transcriptase and Expand High Fidelity PCR System (Roche). .. HAstV genome amplification was performed using primers A1 and A2 as described previously [ , ].

    Article Title: A peculiar IclR family transcription factor regulates para-hydroxybenzoate catabolism in Streptomyces coelicolor
    Article Snippet: .. PCR was performed with Tap (Invitrogen), Pfu (Stratagene, Agilent Technologies), Crimson Taq DNA polymerase (New England Biolabs) and Expand High Fidelity PCR system (Roche). .. All PCR reactions were performed with 5% (vol/vol) DMSO to facilitate amplification of GC-rich DNA ( ).

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs
    Article Snippet: .. The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix. .. Genomic DNA template was used as a positive PCR control.

    Article Title: Improving the Pathogenicity of a Nematode-Trapping Fungus by Genetic Engineering of a Subtilisin with Nematotoxic Activity
    Article Snippet: .. The genomic PII clone pUBH was PCR amplified (Expand High-Fidelity PCR system; Roche Molecular Biochemicals) with two primers designed from the PII sequence: a1 (5′-TGGGAGATGCGAATACCGGT; position 854 to 873; GenBank accession no. ) and a2 (5′-ACCGTGAATGGTTCATCCCG; position 948 to 967). .. The hph gene under the control of the trpC promoter from Aspergillus nidulans was excised from the plasmid pCB1003 using Eco RI ( ).

    Construct:

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Sequencing:

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Article Title: Improving the Pathogenicity of a Nematode-Trapping Fungus by Genetic Engineering of a Subtilisin with Nematotoxic Activity
    Article Snippet: .. The genomic PII clone pUBH was PCR amplified (Expand High-Fidelity PCR system; Roche Molecular Biochemicals) with two primers designed from the PII sequence: a1 (5′-TGGGAGATGCGAATACCGGT; position 854 to 873; GenBank accession no. ) and a2 (5′-ACCGTGAATGGTTCATCCCG; position 948 to 967). .. The hph gene under the control of the trpC promoter from Aspergillus nidulans was excised from the plasmid pCB1003 using Eco RI ( ).

    Luciferase:

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Expressing:

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs
    Article Snippet: .. The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix. .. Genomic DNA template was used as a positive PCR control.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Anti-apoptotic function of Xbp1 as an IL-3 signaling molecule in hematopoietic cells
    Article Snippet: .. RT-PCR The splicing of Xbp1 was detected by RT-PCR using (Promega) and Expand High Fidelity PCR System (Roche, Basel, Switzerland) using the Xbp1 362F (5′-TAACGGGAGAAAACTCACGGC-3′) and Xbp1 1017R (5′-CAGACAATGGCTGGATGAAAGC-3′) primers. .. PCR products were digested by Pst I to differentiate Xbp1U from Xbp1S , separated by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.

    Article Title: Type I Interferon Response Is Delayed in Human Astrovirus Infections
    Article Snippet: .. Conventional RT-PCR reactions to detect HAstV RNA, IFN-β, GAPDH (glyceraldehyde-3-phosphate dehydrogenase), and ISG56 mRNAs were performed using Expand Reverse Transcriptase and Expand High Fidelity PCR System (Roche). .. HAstV genome amplification was performed using primers A1 and A2 as described previously [ , ].

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs
    Article Snippet: .. The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix. .. Genomic DNA template was used as a positive PCR control.

    Plasmid Preparation:

    Article Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting
    Article Snippet: .. Generation of constructs To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10 , Osr1 , Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). .. Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CG ACTAGT AAGAAAACACTGTTGGTGGATGCAG -3′ , and antisense, 5′-GC ACGCGT TTTTATTCTCTTTTCCCAGC-3′ .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Roche high fidelity pcr system
    Schematic representation of the MIR171e gene and its precursors. Detection of <t>pri-,</t> pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; <t>RT-PCR</t> detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .
    High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high fidelity pcr system/product/Roche
    Average 92 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    high fidelity pcr system - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    Image Search Results


    Schematic representation of the MIR171e gene and its precursors. Detection of pri-, pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; RT-PCR detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR171e gene and its precursors. Detection of pri-, pre- and mature miR171e. ( A ) MIR171e gene structure. ( B ) pre-miRNA171e hairpin structure (ΔG=−59.1 kcal/mol) and its rice orthologue (ΔG=−58.9 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA171e structures (upper panel), green and yellow colors show alternatively retained transcript fragments as a consequence of alternative splicing events; RT-PCR detection of pri-miRNA171e expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA171e expression levels (upper graph) and its splice variants (I–IV) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR171e molecule, detection of pre-miRNA171e long (L) and short (S) intermediates, and mature miR171e using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR1120 gene and its precursor. Detection of pri-, pre- and mature miR1120. ( A ) MIR1120 gene structure; black squares in the gene and pri-miRNA1120 schemes show position of the ORF. ( B ) pre-miRNA1120 hairpin structure (ΔG=−42.3 kcal/mol) and its wheat orthologue (ΔG=−63.5 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA1120 structure and RT-PCR expression analysis in the five barley developmental stages studied. ( D ) Real-time PCR measurements of total pri-miRNA1120 expression levels; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR1120 molecule, and detection of pre-miRNA and mature miR1120 using Northern hybridization. U6 was used as a loading control. The level of pre-miRNAs and miRNA was calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Asterisk on agarose gel indicates unspecific product.

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR1120 gene and its precursor. Detection of pri-, pre- and mature miR1120. ( A ) MIR1120 gene structure; black squares in the gene and pri-miRNA1120 schemes show position of the ORF. ( B ) pre-miRNA1120 hairpin structure (ΔG=−42.3 kcal/mol) and its wheat orthologue (ΔG=−63.5 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA1120 structure and RT-PCR expression analysis in the five barley developmental stages studied. ( D ) Real-time PCR measurements of total pri-miRNA1120 expression levels; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR1120 molecule, and detection of pre-miRNA and mature miR1120 using Northern hybridization. U6 was used as a loading control. The level of pre-miRNAs and miRNA was calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Asterisk on agarose gel indicates unspecific product.

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR1126 gene and its precursors. Detection of pri-, pre- and mature miR1126. ( A ) MIR1126 gene structure. ( B ) pre-miRNA1126 hairpin structure (ΔG=−78.4 kcal/mol) and its wheat orthologue (ΔG=−73.27 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–V) of the miR1126 transcript; dashed lines represents unamplified 5 ′ fragments of the noncoding RNA isoforms IV and V; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR expression analysis of splice isoforms (I–V) of the miR1126 transcript in all barley developmental stages studied. Half-open arrows on agarose gel indicate specific, identified products. ( E ) Real-time PCR measurements of total pri-miRNA1126 expression levels (upper graph) and pri-miR1126 fragments carrying the third intron (+IVS3) and after the third intron splicing (ΔIVS3) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( F ) Nucleotide sequence of the mature miR1126 molecule, and detection of pre-miRNA and mature miR1126 using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR1126 gene and its precursors. Detection of pri-, pre- and mature miR1126. ( A ) MIR1126 gene structure. ( B ) pre-miRNA1126 hairpin structure (ΔG=−78.4 kcal/mol) and its wheat orthologue (ΔG=−73.27 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–V) of the miR1126 transcript; dashed lines represents unamplified 5 ′ fragments of the noncoding RNA isoforms IV and V; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR expression analysis of splice isoforms (I–V) of the miR1126 transcript in all barley developmental stages studied. Half-open arrows on agarose gel indicate specific, identified products. ( E ) Real-time PCR measurements of total pri-miRNA1126 expression levels (upper graph) and pri-miR1126 fragments carrying the third intron (+IVS3) and after the third intron splicing (ΔIVS3) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( F ) Nucleotide sequence of the mature miR1126 molecule, and detection of pre-miRNA and mature miR1126 using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR159b gene and its precursors. Detection of pri- and mature miR159b. ( A ) MIR159b gene structure. ( B ) pre-miRNA159b hairpin structure (ΔG=−95 kcal/mol) and its rice orthologue (ΔG=−79.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 ( C ) pri-miRNA159b structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA159b expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR159b molecule, and detection of mature miR159b using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisks next to bands on agarose gel mark nonspecific products.

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR159b gene and its precursors. Detection of pri- and mature miR159b. ( A ) MIR159b gene structure. ( B ) pre-miRNA159b hairpin structure (ΔG=−95 kcal/mol) and its rice orthologue (ΔG=−79.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 ( C ) pri-miRNA159b structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA159b expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR159b molecule, and detection of mature miR159b using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisks next to bands on agarose gel mark nonspecific products.

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR166n gene and its precursors. Detection of pri-, pre- and mature miR166n. ( A ) MIR166n gene structure. ( B ) pre-miRNA166n hairpin structure (ΔG=−61 kcal/mol) and its rice orthologue (ΔG=−52.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA166n structures (upper panel); RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA166n expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR166n molecule, and detection of pre-miRNA166n long (L) and short (S) intermediates, and mature miR166n using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR166n gene and its precursors. Detection of pri-, pre- and mature miR166n. ( A ) MIR166n gene structure. ( B ) pre-miRNA166n hairpin structure (ΔG=−61 kcal/mol) and its rice orthologue (ΔG=−52.3 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA166n structures (upper panel); RT-PCR analysis of their expression in five barley developmental stages studied (lower panel). ( D ) Real-time PCR measurements of total pri-miRNA166n expression level (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miR166n molecule, and detection of pre-miRNA166n long (L) and short (S) intermediates, and mature miR166n using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 .

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR168a-5p/168-3p gene and its precursors. Detection of pri-, pre-, and mature miR168-5p and miR168a-3p. ( A ) MIR168a-5p/168-3p gene structure. ( B ) pre-miRNA168a-5p/168-3p hairpin structure (ΔG=−60.7 kcal/mol) and its rice orthologue (ΔG=−52.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA168a-5p/168-3p structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of pri-miRNA miRNA168a-5p/168-3p expression levels (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequences of the mature miR168a-5p and miR168a-3p molecules, and Northern detection of pre-miRNA168a-5p/168-3p long (L) and short (S) intermediates, mature miR168-5p and miR168a-3p. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisk next to band on agarose gel marks nonspecific product.

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR168a-5p/168-3p gene and its precursors. Detection of pri-, pre-, and mature miR168-5p and miR168a-3p. ( A ) MIR168a-5p/168-3p gene structure. ( B ) pre-miRNA168a-5p/168-3p hairpin structure (ΔG=−60.7 kcal/mol) and its rice orthologue (ΔG=−52.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) pri-miRNA168a-5p/168-3p structures (upper panel) and RT-PCR analysis of their expression in five barley developmental stages (lower panel). ( D ) Real-time PCR measurements of pri-miRNA miRNA168a-5p/168-3p expression levels (upper graph) and its spliced (ΔIVS) and unspliced variants (+IVS) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( E ) Nucleotide sequences of the mature miR168a-5p and miR168a-3p molecules, and Northern detection of pre-miRNA168a-5p/168-3p long (L) and short (S) intermediates, mature miR168-5p and miR168a-3p. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 ; asterisk next to band on agarose gel marks nonspecific product.

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Northern Blot, Agarose Gel Electrophoresis

    Schematic representation of the MIR156g gene and its precursors. Detection of pri-, pre- and mature miR156g. ( A ) MIR156g gene structure; thin black vertical bars within exons show additional splice sites identified during pri-miRNA156g analyses; dotted-vertical lines within the last exon together with pA symbols denote polyadenylation sites. ( B ) pre-miRNA156g hairpin structure (ΔG=−65.85 kcal/mol) and its rice orthologue (ΔG=−61.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–VIII) of the miR156g transcript; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR analysis of first intron retention throughout barley plant life stages. ( E–F ) pri-miRNA156g RT-PCR expression analysis in five barley developmental stages. Arrows on agarose gel indicate splice isoforms II, III and V. ( G ) Real-time PCR measurements of total pri-miRNA156g expression levels (upper graph) and pri-miR156g fragments carrying the first intron (+IVS1) and after the first intron splicing (ΔIVS1) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( H ) Nucleotide sequence of the mature miR156g molecule, and detection of pre-miRNA and mature miR156g using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Additional colors depict alternatively spliced exons in the pri-miRNA.

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR156g gene and its precursors. Detection of pri-, pre- and mature miR156g. ( A ) MIR156g gene structure; thin black vertical bars within exons show additional splice sites identified during pri-miRNA156g analyses; dotted-vertical lines within the last exon together with pA symbols denote polyadenylation sites. ( B ) pre-miRNA156g hairpin structure (ΔG=−65.85 kcal/mol) and its rice orthologue (ΔG=−61.2 kcal/mol); blue and red lines indicate hybridization regions as described in Figure 1 . ( C ) Structures of splice isoforms (I–VIII) of the miR156g transcript; …polyA indicates a putative polyA site in splice isoforms as the determination of an accurate polyA site for PCR products is not possible. ( D ) RT-PCR analysis of first intron retention throughout barley plant life stages. ( E–F ) pri-miRNA156g RT-PCR expression analysis in five barley developmental stages. Arrows on agarose gel indicate splice isoforms II, III and V. ( G ) Real-time PCR measurements of total pri-miRNA156g expression levels (upper graph) and pri-miR156g fragments carrying the first intron (+IVS1) and after the first intron splicing (ΔIVS1) (lower graph); bars on the charts represent standard deviation. Values are shown as the mean ±SD (n=3) from three independent experiments. ( H ) Nucleotide sequence of the mature miR156g molecule, and detection of pre-miRNA and mature miR156g using Northern hybridization. U6 was used as a loading control. The levels of pre-miRNAs and miRNA were calculated as described in Figure 1 . Colors, abbreviations, and symbols as in Figure 1 . Additional colors depict alternatively spliced exons in the pri-miRNA.

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot

    Schematic representation of the MIR397b-3p gene and its precursors. Detection of pri-, pre- and mature miR397b-3p. ( A ) MIR397b-3p gene structure; left arrow indicates putative transcription start site; arrow marked as pA depicts precursor polyadenylation site. ( B ) pre-miRNA397b-3p hairpin structure (ΔG=−70.8 kcal/mol) and its rice orthologue (ΔG=−51.2 kcal/mol); the blue line indicates the region of the pre-miRNA from which the hybridization probe for precursor detection was designed, while the red line highlights the probe for detection of the mature miRNA. ( C ) Structure of pri-miRNA397b-3p (upper panel); RT-PCR analysis of its expression in five barley developmental stages (lower panel); primer positions are marked by black triangles on the pri-miRNA graph. ( D ) Real-time PCR measurements of pri-miRNA397b-3p expression level; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miRNA397b-3p molecule; detection of pre-miRNA (left upper panel), mature miR397b-3p (left middle panel), and miR397b-5p (right panel) using Northern hybridization. U6 was used as a loading control. The level of pre-miRNA and miRNA in 1-week-old plants was arbitrarily assumed to be ‘1’, and the levels of pre-miRNA and miRNA were quantified relative to this at all other developmental stages. The miRNA is marked in red, the miRNA* in blue; 1w: one-week-old seedlings, 2w: two-week-old seedlings, 3w: three-week-old plants, 6w: six-week-old plants, 68d: 68-day-old plants, gDNA: genomic DNA; M - GeneRuler 100 bp Plus or 1kb Plus DNA Ladders.

    Journal: BMC Genomics

    Article Title: Developmentally regulated expression and complex processing of barley pri-microRNAs

    doi: 10.1186/1471-2164-14-34

    Figure Lengend Snippet: Schematic representation of the MIR397b-3p gene and its precursors. Detection of pri-, pre- and mature miR397b-3p. ( A ) MIR397b-3p gene structure; left arrow indicates putative transcription start site; arrow marked as pA depicts precursor polyadenylation site. ( B ) pre-miRNA397b-3p hairpin structure (ΔG=−70.8 kcal/mol) and its rice orthologue (ΔG=−51.2 kcal/mol); the blue line indicates the region of the pre-miRNA from which the hybridization probe for precursor detection was designed, while the red line highlights the probe for detection of the mature miRNA. ( C ) Structure of pri-miRNA397b-3p (upper panel); RT-PCR analysis of its expression in five barley developmental stages (lower panel); primer positions are marked by black triangles on the pri-miRNA graph. ( D ) Real-time PCR measurements of pri-miRNA397b-3p expression level; bars on a chart represent standard deviation. Values are shown as the mean ± SD (n=3) from three independent experiments. ( E ) Nucleotide sequence of the mature miRNA397b-3p molecule; detection of pre-miRNA (left upper panel), mature miR397b-3p (left middle panel), and miR397b-5p (right panel) using Northern hybridization. U6 was used as a loading control. The level of pre-miRNA and miRNA in 1-week-old plants was arbitrarily assumed to be ‘1’, and the levels of pre-miRNA and miRNA were quantified relative to this at all other developmental stages. The miRNA is marked in red, the miRNA* in blue; 1w: one-week-old seedlings, 2w: two-week-old seedlings, 3w: three-week-old plants, 6w: six-week-old plants, 68d: 68-day-old plants, gDNA: genomic DNA; M - GeneRuler 100 bp Plus or 1kb Plus DNA Ladders.

    Article Snippet: The pri-miRNA amplifications and cDNA purity control reactions were performed with Taq DNA polymerase (Thermo Fisher Scientific, formerly Fermentas, Lithuania) or Expand High Fidelity PCR system (Roche, Mannheim, Germany) and two pri-miRNA specific primers (500 nM each) using the following thermal profile - 1 cycle: denaturation at 94°C/1 min, annealing at 65°C/30 s, elongation at 72°C/2 min; 29 cycles: denaturation at 94°C/30 s, annealing at 63°C/30 s (Δ -0.5°C/cycle), elongation at 72°C/2 min; 10 to 13 cycles, depending on the expression level of the pri-miRNA: denaturation at 94°C/30 s, annealing at 53°C/30 s, elongation 72°C/2 min. To improve amplification, Q-Solution (Qiagen, Hilden, Germany) was added to the RT-PCR mix.

    Techniques: Hybridization, Reverse Transcription Polymerase Chain Reaction, Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Sequencing, Northern Blot