hifi hotstart uracil readymix  (Kapa Biosystems)


Bioz Verified Symbol Kapa Biosystems is a verified supplier
Bioz Manufacturer Symbol Kapa Biosystems manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    KAPA HiFi HotStart ReadyMix
    Description:
    HotStart ReadyMix 100 x 25 µL reactions
    Catalog Number:
    kk2601
    Price:
    None
    Size:
    1 25 mL
    Buy from Supplier


    Structured Review

    Kapa Biosystems hifi hotstart uracil readymix
    HotStart ReadyMix 100 x 25 µL reactions
    https://www.bioz.com/result/hifi hotstart uracil readymix/product/Kapa Biosystems
    Average 99 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    hifi hotstart uracil readymix - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: .. The resultant products were PCR-amplified with KAPA HIFI Hotstart Readymix (KAPA Biosystems) and primers (100 nM) carrying Illumina sequence adaptors. .. PCR products were purified with QIAquick Gel Extraction Kit (QIAGEN), and sequenced via 150-bp paired-end sequencing on an Illumina MiSeq instrument.

    Article Title: Regulation of life span by the gut microbiota in the short-lived African turquoise killifish
    Article Snippet: .. Both PCR steps used KAPA HiFi Hotstart ReadyMix (KAPA Biosystems) and 1 μm of primers in 25 μl total volume. .. Second-step PCR products were run on a 1.2% agarose gel and DNA products between 500–700 base pairs were excised and cleaned up as in step 1.

    Article Title: The saliva microbiome profiles are minimally affected by collection method or DNA extraction protocols
    Article Snippet: .. Q5® Hot Start High-Fidelity (New England Biolads, Masachusetts, USA) polymerase enzyme was used for the index PCR instead of the recommended KAPA HiFi HotStart ReadyMix (Kapa Biosystem, Massachusetts, USA) polymerase enzyme, as the former enzyme yielded superior amplification efficiency with a lower error rate. .. Sequencing was performed at the Australian Centre for Ecogenomics (ACE, Brisbane, Australia).

    Article Title: Effect of Bifidobacterium breve on the Intestinal Microbiota of Coeliac Children on a Gluten Free Diet: A Pilot Study
    Article Snippet: .. Each 25 µL PCR reaction contained 12.5 µL of HiFi HotStart ReadyMix (KAPA Biosystems, Woburn, MA, USA), 5 µL of each primer (0.2 µM) and microbial DNA (5 ng/µL). .. PCR amplification was performed using the following program: Heated lid at 110 °C, 95 °C for 3 min followed by 25 cycles at 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, followed by a final elongation step at 72 °C for 5 min. PCR products were cleaned using the AMPure beads XP purification system (Beckman Coulter, UK) following Illumina 16S Ribosomal RNA Gene Amplicon instructions.

    Article Title: High-throughput sequencing of partially edited trypanosome mRNAs reveals barriers to editing progression and evidence for alternative editing
    Article Snippet: .. Twenty-five microliters of 2× KAPA HiFi HotStart Ready mix was combined with 5 µL Nextera XT Index primer 1 (N7xx) and Index primer 2 (S5xx) and added to 2 ng of cDNA for the PCR reaction. .. AMPure XP beads (Beckman Coulter Genomics) were used to purify the final libraries.

    Article Title: Improved Protocols for Illumina Sequencing
    Article Snippet: .. Materials Adapter-ligated DNA library (see Basic Protocol 3) KAPA HiFi HotStart ReadyMix (KAPA Biosystems, cat. no KK2601) Paired-end PCR primers at 100 μM: PCR_F 5′ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T 3′ (*indicates phosphorothioate; ( ) PCR_R 5′ CAAGCAGAAGACGGCATACGAGATXXXXXXXXCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T 3′ (*indicates phosphorothioate ( ); XXXXXXXX can be used to insert index tags) Thermal cycler 1.5-ml microcentrifuge tubes Agencourt AMPure XP (Beckman Coulter Genomics, cat. no ) Magnetic separator (e.g. DynaMag-Spin Life Technologies cat. no. 12320D) 80% ethanol .. Perform PCR 1a.

    Sequencing:

    Article Title: An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells
    Article Snippet: .. The resultant products were PCR-amplified with KAPA HIFI Hotstart Readymix (KAPA Biosystems) and primers (100 nM) carrying Illumina sequence adaptors. .. PCR products were purified with QIAquick Gel Extraction Kit (QIAGEN), and sequenced via 150-bp paired-end sequencing on an Illumina MiSeq instrument.

    Amplification:

    Article Title: The saliva microbiome profiles are minimally affected by collection method or DNA extraction protocols
    Article Snippet: .. Q5® Hot Start High-Fidelity (New England Biolads, Masachusetts, USA) polymerase enzyme was used for the index PCR instead of the recommended KAPA HiFi HotStart ReadyMix (Kapa Biosystem, Massachusetts, USA) polymerase enzyme, as the former enzyme yielded superior amplification efficiency with a lower error rate. .. Sequencing was performed at the Australian Centre for Ecogenomics (ACE, Brisbane, Australia).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Kapa Biosystems kapa hifi hotstart uracil readymix 2×
    Kapa Hifi Hotstart Uracil Readymix 2×, supplied by Kapa Biosystems, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kapa hifi hotstart uracil readymix 2×/product/Kapa Biosystems
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    kapa hifi hotstart uracil readymix 2× - by Bioz Stars, 2020-09
    86/100 stars
      Buy from Supplier

    93
    Roche kapa hifi hotstart uracil readymix
    Kapa Hifi Hotstart Uracil Readymix, supplied by Roche, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kapa hifi hotstart uracil readymix/product/Roche
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    kapa hifi hotstart uracil readymix - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results