hi scribe t7 transcription kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HiScribe T7 High Yield RNA Synthesis Kit
    Description:
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    Catalog Number:
    e2040s
    Price:
    227
    Size:
    50 rxns
    Category:
    Transcription Kits
    Buy from Supplier


    Structured Review

    New England Biolabs hi scribe t7 transcription kit
    HiScribe T7 High Yield RNA Synthesis Kit
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2020-05
    99/100 stars

    Related Products / Commonly Used Together

    dsrna

    Images

    Related Articles

    Clone Assay:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Amplification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion). ..

    In Vitro:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA). .. The composition of the reaction mix differed from the manufacturers suggestions by using 0.5x NEB transcription buffer and adding 1.25 mM EDTA as well as addition of 60 μM of a DNA 21-mer (see Table ) reverse complementary to the HHR catalytic core resulting in an optimized protocol with increased yield of cis- cleaving full-length HHRs.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: .. The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. Cas9 mRNA was purchased from TriLink BioTechnologies (L7606).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    Synthesized:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Purification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: .. The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. Cas9 mRNA was purchased from TriLink BioTechnologies (L7606).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    CRISPR:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Polymerase Chain Reaction:

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion). ..

    Plasmid Preparation:

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs hi scribe t7 transcription kit
    Hi Scribe T7 Transcription Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 transcription kit/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 transcription kit - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results