hi scribe t7 kit  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    HiScribe T7 High Yield RNA Synthesis Kit
    Description:
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    Catalog Number:
    e2040s
    Price:
    227
    Size:
    50 rxns
    Category:
    Transcription Kits
    Buy from Supplier


    Structured Review

    New England Biolabs hi scribe t7 kit
    HiScribe T7 High Yield RNA Synthesis Kit
    HiScribe T7 High Yield RNA Synthesis Kit 50 rxns
    https://www.bioz.com/result/hi scribe t7 kit/product/New England Biolabs
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 kit - by Bioz Stars, 2020-02
    95/100 stars

    Related Products / Commonly Used Together

    dsrna

    Images

    Related Articles

    Clone Assay:

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: The Bos taurus RB1 ( GGCCTTCGGGCCAA CGCGGCGCTCGGTTGCCGGGCGAGGGAGGGCCGGCCCGGTTTTTTTCTCAGGGGAACGTTCAAATTATTTTTGTAACGGGAGTCGGCCGAGGACGGGGCGTGCCCGAGGTGCGCGCGTCCTCTCCCTTCCCCGGCCCTCCTCCAGCGCCCGCCGGCGCCTGCCCAGCGAGCGCGTCATGCCGTCGATCCGGTTCGCCGG ATCCAAATCGGGCTTCGGTCCGGTTC ) and T.m. latirostris RB1 ( GGCCTTCGGGCCAA GCTCGGTTGCCGGGTGGGGAGGGCTTGTCCGGTTTTTCTCAGGGGACGTTCAAATTATTTTTGTAACGGGAGTCGAGAGAGGACGGGGCGTGCCCCGACGTGTGCGCGCGTCCCCCGCCCCCGCCCTCCTCCACAGCTCTCTAGCTCCTACCCTGTAAGGGCGTCATGCCGTCGATCCGGTTCGCCGG ATCCAAATCGGGCTTCGGTCCGGTTC ) sequences were also cloned by Genscript into pUC57. .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion).

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Amplification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion). ..

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: The unc-22 sequence with flanking T7 promoters was amplified (Phusion polymerase; NEB) from the unc-22 RNAi vector using the P16 primer. .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB).

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: The PCR amplification profile was as follows: 95 °C for 15 min, followed by six cycles at 95 °C for 20 s, 63 °C for 30 s, and 72 °C for one minute, then 28 cycles at 95 °C for 20 s, 77 °C for 30 s, and 72 °C for one minute, with a final extension at 72 °C for five minutes. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. The IAP LTR and the chimeric L1 were synthesized by IDT, and two homology arms (~ 1 kb) flanking the gRNA cutting sites of A or Axin1 locus were amplified by Q5® Hot Start High-Fidelity 2X Master Mix (M0494S, NEB) from mouse tail genomic DNA.

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). .. AaCas12b sgRNA (AasgRNA) and SpCas9 sgRNA templates for in vitro RNA transcription were PCR amplified using primers bearing a T7 promoter (Additional file : Table S1).

    Synthesized:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: .. Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit). .. Cas9 RNA was transcribed from pT3TS-nCas9n plasmid using mMESSAGE-mMACHINE T3 (Life Technologies) and quantified (NanoDrop 2000c, ThermoFisher).

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. Synthesized mRNAs were clean and concentrated with RNA Clean and Concentrator-25 Kit from Zymo Research.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: Once designed, sgRNAs were synthesized as described previously [ ]. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. The IAP LTR and the chimeric L1 were synthesized by IDT, and two homology arms (~ 1 kb) flanking the gRNA cutting sites of A or Axin1 locus were amplified by Q5® Hot Start High-Fidelity 2X Master Mix (M0494S, NEB) from mouse tail genomic DNA.

    Construct:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: Paragraph title: Cloning and expression of CRISPR-Cas9 constructs ... Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH.

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: Briefly, to construct template DNA for in vitro transcription (IVT), a 60 nt sgRNA specific forward primer, containing a truncated T7 promoter and the 20 nt target sequence, as well as a universal reverse primer were used to amplify a synthetic double stranded DNA template (Integrated DNA Technologies) encoding the conserved trans-activating CRISPR RNA (tracr) sequence. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Incubation:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: These were then briefly centrifuged at 3000 g , resuspended in TE buffer at 10 ng µl−1 concentration and incubated at 50 ˚C for 20 min. gBlocks (200 pg per reaction) were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and 0.5 µM of T7 tail Fw and SP6 tail Rev primers according to the manufacturer’s instructions, using the following cycling conditions: denaturation at 98 ˚C for 30 s, followed by the amplification stage consisting of 35 cycles of denaturation at 98 ˚C for 10 s, primer annealing at 65 ˚C for 30 s and an extension at 72 ˚C for 1 min. .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight. .. For quantification and characterization of sgRNAs, purification was performed with the MEGAclear Transcription Clean-Up Kit (Ambion, AM1908) and quantified on a Nanodrop 2000 (Thermo Scientific).

    Expressing:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: Paragraph title: Cloning and expression of CRISPR-Cas9 constructs ... Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH.

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Knock-In:

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: Paragraph title: Generation of knock-in mice and breeding scheme ... The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research).

    Transfection:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Paragraph title: Cell transfection ... RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Generated:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: In vitro transcription of HCV PAMP and Sendai virus DI RNA HCV PAMP in vitro transcription template [ ] was generated by annealing HCV fwd and rev (5 μM each) oligos ( ). .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. Donor DNA templates that contain homology arms and the IAP LTR or the chimeric L1 were generated with NEBuilder® HiFi DNA Assembly Master Mix (E2621L, NEB).

    Sequencing:

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: The human WT RB1 5′ UTR sequence with hairpin adapters for SHAPE ( GGCCTTCGGGCCAA GCTCAGTTGCCGGGCGGGGGAGGGCGCGTCCGGTTTTTCTCAGGGGACGTTGAAATTATTTTTGTAACGGGAGTCGGGAGAGGACGGGGCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACAGCTCGCTGGCTCCCGCCGCGGAAAGGCGTCATGCCGTCGATCCGGTTCGCCGG ATCCAAATCGGGCTTCGGTCCGGTTC ) was inserted between the SgfI and MluI sites of the pCMV6-AC nontagged precision shuttle vector (Origene). .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion).

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: The unc-22 sequence with flanking T7 promoters was amplified (Phusion polymerase; NEB) from the unc-22 RNAi vector using the P16 primer. .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB).

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: A T7 promoter sequence was added, as described elsewhere [ ]. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: Blunt-end restriction using Msc I (New England Biolabs, Ipswich MA/US) resulted in a dsDNA fragment containing the promoter sequence for phage T7 RNA polymerase, the HHR-coding sequence and a 578-bp untranscribed region upstream of the promoter. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: Briefly, to construct template DNA for in vitro transcription (IVT), a 60 nt sgRNA specific forward primer, containing a truncated T7 promoter and the 20 nt target sequence, as well as a universal reverse primer were used to amplify a synthetic double stranded DNA template (Integrated DNA Technologies) encoding the conserved trans-activating CRISPR RNA (tracr) sequence. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Injection:

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit). .. Next, 2–5 nl of 50 ng/μl gRNA, 50 ng/μl Cas9 RNA and 0.05% phenol red (Sigma-Aldrich) were injected into zebrafish zygotes using a Pneumatic PicoPump (WPI).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. Female NSG mice 3–4 weeks of age (JAX Laboratories, stock number 005557) were super-ovulated by intraperitoneal injection with 2.5IU pregnant mare serum gonadotropin (National Hormone & Peptide Program, NIDDK), followed 48 hours later by injection of 2.5 IU human chorionic gonadotropin (hCG, National Hormone & Peptide Program, NIDDK).

    Binding Assay:

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: To avoid off-target affects we searched the whole salmon genome (No. AGKD00000000.4) for binding sites for the oligos selected for the CRISPR target for both dnd and alb , no specific binding was identified for the targets used. .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH.

    Mutagenesis:

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: The mutant sequences, which varied only by point mutations, were inserted into pUC57 by Genscript. .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion).

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Purification:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions. .. The DNA template was then removed from the RNA samples by adding 4 units of DNase I (RNase-free, NEB) per sample and incubating at 37 ˚C for 15 min according to the manufacturer’s recommendations.

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: .. Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit). .. Cas9 RNA was transcribed from pT3TS-nCas9n plasmid using mMESSAGE-mMACHINE T3 (Life Technologies) and quantified (NanoDrop 2000c, ThermoFisher).

    Article Title: Successful CRISPR/Cas9 mediated homologous recombination in a chicken cell line
    Article Snippet: In vitro transcription of gRNAs HiScribe T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) was used forin vitro RNA synthesis of gRNAs, as described in the manufacturer’s protocol. .. RNA was purified using the MEGAclear™ Transcription Clean-Up Kit (AM1908, ThermoFisher) following the protocol from the manufacturer.

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB). .. Transcribed dsRNA product was purified (QIAquick PCR Purification Kit; Qiagen), treated with RNase A (Omega Bio-Tek), and purified (QIAquick PCR Purification Kit; Qiagen).

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR products were purified by EZ-Pure™ PCR Purification Kit ver. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. Both HCV PAMP and SeV DI RNA were purified by treatment with a 5X volume of homemade SPRI beads (comparable to Beckman-Coulter AMPure beads) and elution in RNAse-free water.

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight. .. For quantification and characterization of sgRNAs, purification was performed with the MEGAclear Transcription Clean-Up Kit (Ambion, AM1908) and quantified on a Nanodrop 2000 (Thermo Scientific).

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: .. The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. Cas9 mRNA was purchased from TriLink BioTechnologies (L7606).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    Polymerase Chain Reaction:

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: A 58-mer oligo and 80-mer ( , Table S8) oligos were annealed to form an 118 nt guide DNA by PCR extension at 72°C for 10 min ( , Table S8) ( ) and purified (Agencourt AMPure XP-beads, Beckman-Coulter). .. Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit).

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion). ..

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB). .. Transcribed dsRNA product was purified (QIAquick PCR Purification Kit; Qiagen), treated with RNase A (Omega Bio-Tek), and purified (QIAquick PCR Purification Kit; Qiagen).

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR products were purified by EZ-Pure™ PCR Purification Kit ver. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: In vitro transcription DNA templates of HHR variants were generated by PCR-mediated amplification from a pUC57 backbone (Piscataway NJ/US) using ODF98 and ODF99 (see Table ) and subsequent blunt-end restriction. .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA).

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: PCR was performed using Phusion High-Fidelity Polymerase (New England Biolabs) according to manufacturer protocols. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). .. AaCas12b sgRNA (AasgRNA) and SpCas9 sgRNA templates for in vitro RNA transcription were PCR amplified using primers bearing a T7 promoter (Additional file : Table S1).

    Cotransfection:

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: Unless stated explicitly, the plasmid concentrations used for transfection were as follows: For pRNAe and plasmid expressing target gene co-transfection, 0.2 μg expression plasmid and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates; for the expression of the light-chain and heavy-chain of anti-HIV antibody 10E8, 0.2 μg of each and 1.2 μg of pRNAe plasmid or control plasmid were used per well of 12-well plates. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    CRISPR:

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: Paragraph title: Zebrafish husbandry and CRISPR/Cas9 editing ... Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit).

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: Briefly, to construct template DNA for in vitro transcription (IVT), a 60 nt sgRNA specific forward primer, containing a truncated T7 promoter and the 20 nt target sequence, as well as a universal reverse primer were used to amplify a synthetic double stranded DNA template (Integrated DNA Technologies) encoding the conserved trans-activating CRISPR RNA (tracr) sequence. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Mouse Assay:

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: Paragraph title: NSG-IDUAX/X mice ... The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction.

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: Paragraph title: Generation of knock-in mice and breeding scheme ... The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research).

    Plasmid Preparation:

    Article Title: CDC14A phosphatase is essential for hearing and male fertility in mouse and human
    Article Snippet: Guide RNA was synthesized (HiScribe T7 High Yield RNA, NEB), purified by isopropanol/sodium acetate precipitation and quantified (Agilent small RNA quantification kit). .. Cas9 RNA was transcribed from pT3TS-nCas9n plasmid using mMESSAGE-mMACHINE T3 (Life Technologies) and quantified (NanoDrop 2000c, ThermoFisher).

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: The human WT RB1 5′ UTR sequence with hairpin adapters for SHAPE ( GGCCTTCGGGCCAA GCTCAGTTGCCGGGCGGGGGAGGGCGCGTCCGGTTTTTCTCAGGGGACGTTGAAATTATTTTTGTAACGGGAGTCGGGAGAGGACGGGGCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACAGCTCGCTGGCTCCCGCCGCGGAAAGGCGTCATGCCGTCGATCCGGTTCGCCGG ATCCAAATCGGGCTTCGGTCCGGTTC ) was inserted between the SgfI and MluI sites of the pCMV6-AC nontagged precision shuttle vector (Origene). .. A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion).

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: The unc-22 sequence with flanking T7 promoters was amplified (Phusion polymerase; NEB) from the unc-22 RNAi vector using the P16 primer. .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB).

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: For pRNAe-Plus experiments, the amount of pRNAe-Plus plasmid was as listed in the figure, while the total DNA amount per well was kept constant by supplementing to 1.5 μg with an appropriate amount of pRNAe-Mock plasmid. .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Agarose Gel Electrophoresis:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: PCR bands were checked with a 1% agarose gel electrophoresis. .. Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol.

    In Vitro:

    Article Title: Successful CRISPR/Cas9 mediated homologous recombination in a chicken cell line
    Article Snippet: .. In vitro transcription of gRNAs HiScribe T7 High Yield RNA Synthesis Kit (E2040S, New England Biolabs) was used forin vitro RNA synthesis of gRNAs, as described in the manufacturer’s protocol. .. RNA was purified using the MEGAclear™ Transcription Clean-Up Kit (AM1908, ThermoFisher) following the protocol from the manufacturer.

    Article Title: Extracellular RNA is transported from one generation to the next in Caenorhabditis elegans
    Article Snippet: .. The product was purified (QIAquick PCR Purification Kit; Qiagen), and dsRNA was transcribed in vitro (T7 High Yield RNA Synthesis Kit; NEB). .. Transcribed dsRNA product was purified (QIAquick PCR Purification Kit; Qiagen), treated with RNase A (Omega Bio-Tek), and purified (QIAquick PCR Purification Kit; Qiagen).

    Article Title: Dnd knockout ablates germ cells and demonstrates germ cell independent sex differentiation in Atlantic salmon
    Article Snippet: .. Cloning of CRISPR target sequences and preparation of cas9 mRNA and in-vitro transcription was conducted as previously described with the following exceptions: for in-vitro transcription of gRNA we used the HighScribe T7 High Yield RNA Synthesis Kit (NEB) according to the protocol for short transcripts and purified gRNA via an RNeasy column (Qiagen) using 3.5 vol. of 100% EtOH. .. Experimental setup and injections Injection procedures were carried out as described previously , using 50 ng/μl of each gRNA and 150 ng/μl of cas9 mRNA.

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: .. Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. 10 μL T7 reactions were carried out at 37 °C for 2 h. Reactions were then treated with 2 U RNase-free DNaseI (NEB) for 15 min at 37 °C to remove DNA template, and then polyadenylated with 5 U E. coli Poly-A Polymerase, 10× buffer, and 10 mM ATP (NEB) for 1 h at 37 °C.

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: .. This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA). .. The composition of the reaction mix differed from the manufacturers suggestions by using 0.5x NEB transcription buffer and adding 1.25 mM EDTA as well as addition of 60 μM of a DNA 21-mer (see Table ) reverse complementary to the HHR catalytic core resulting in an optimized protocol with increased yield of cis- cleaving full-length HHRs.

    Article Title: In vitro–transcribed guide RNAs trigger an innate immune response via the RIG-I pathwaySometimes You’re the Scooper, and Sometimes You Get Scooped; How to Turn Both into Something Good.
    Article Snippet: .. Plasmid was digested with HindII/EcoRI before in vitro transcription with HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs). .. The sequence of the IVT DI, including the T7 promoter, hepatitis delta virus ribozyme, and the T7 terminator, is TAATACGACTCACTATA ACCAGACAAGAGTTTAAGAGATATGTATCCTTTTAAATTTTCTTGTCTTCTTGTAAGTTTTTCTTACTATTGTCATATGGATAAGTCCAAGACTTCCAGGTACCGCGGAGCTTCGATCGTTCTGCACGATAGGGACTAATTATTACGAGCTGTCATATGGCTCGATATCACCCAGTGATCCATCATCAATCACGGTCGTGTATTCATTTTGCCTGGCCCCGAACATCTTGACTGCCCCTAAAATCTTCATCAAAATCTTTATTTCTTTGGTGAGGAATCTATACGTTATACTATGTATAATATCCTCAAACCTGTCTAATAAAGTTTTTGTGATAACCCTCAGGTTCCTGATTTCACGGGATGATAATGAAACTATTCCCAATTGAAGTCTTGCTTCAAACTTCTGGTCAGGGAATGACCCAGTTACCAATCTTGTGGACATAGATAAAGATAGTCTTGGACTTATCCATATGACAATAGTAAGAAAAACTTACAAGAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTCTGGT GGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG .

    Article Title: High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells
    Article Snippet: Briefly, to construct template DNA for in vitro transcription (IVT), a 60 nt sgRNA specific forward primer, containing a truncated T7 promoter and the 20 nt target sequence, as well as a universal reverse primer were used to amplify a synthetic double stranded DNA template (Integrated DNA Technologies) encoding the conserved trans-activating CRISPR RNA (tracr) sequence. .. IVT was performed using the HiScribe T7 transcription kit (New England Biolabs, E2040S) and incubated at 37°C overnight.

    Article Title: Human genome-edited hematopoietic stem cells phenotypically correct Mucopolysaccharidosis type I
    Article Snippet: .. The guides were prepared by in vitro transcription (HiScribe™ T7 High Yield RNA Synthesis Kit, E2040S, New England Biolabs) of a dsDNA template generated by annealing two oligos (with a T7 promoter in the sense oligo) followed by a standard PCR reaction. .. The ssODN donor DNA contained an intended point mutation leading to a STOP codon (TGG to TAG): 5′-ggtgggagctagatattagggtaggaagccagatgctaggtatgagagagccaacagcctcagccctctgcttggcttatagATGGAGAACAA/CTCT A GGCAGAGGTCTCAAAGGCTGGGGCTGTGTTGGACAGCAATCATA/CAGTGGGTGTCCTGGCCAGCACCCATCACCCTGAAGGCTCCGCAGCGGCCTGGAGTAC-3′ (lower case is intron, upper case is exon, guide cut sites marked by “/” and the mutation in bold).

    Article Title: Insertion of a chimeric retrotransposon sequence in mouse Axin1 locus causes metastable kinky tail phenotype
    Article Snippet: .. The gRNAs were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (E2040S, NEB) and purified using RNA Clean & Concentrator™-5 (R1013, Zymo Research). .. Cas9 mRNA was purchased from TriLink BioTechnologies (L7606).

    Article Title: RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat
    Article Snippet: RNA without 5' cap for transfection was transcribed in vitro by HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, UK). .. RNA with 5' cap was transcribed also by HiScribe™ T7 High Yield RNA Synthesis Kit with m7G(5′)ppp(5′)G (New England Biolabs, UK) added.

    Article Title: CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity
    Article Snippet: .. Guide RNAs (gRNAs: sgRNAs or crRNAs) were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and purified using MicroElute RNA Clean Up Kit (Omega). ..

    Spectrophotometry:

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Produced:

    Article Title: Engineering a ribozyme cleavage-induced split fluorescent aptamer complementation assay
    Article Snippet: This template was transcribed in vitro using the HiScribe T7 High Yield RNA Synthesis Kit (NEB, Ipswich MA). .. Supplementary Table S1 lists all RNA oligonucleotides produced in this study.

    Concentration Assay:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: These were then briefly centrifuged at 3000 g , resuspended in TE buffer at 10 ng µl−1 concentration and incubated at 50 ˚C for 20 min. gBlocks (200 pg per reaction) were amplified using Q5 Hot Start High-Fidelity 2X Master Mix (NEB) and 0.5 µM of T7 tail Fw and SP6 tail Rev primers according to the manufacturer’s instructions, using the following cycling conditions: denaturation at 98 ˚C for 30 s, followed by the amplification stage consisting of 35 cycles of denaturation at 98 ˚C for 10 s, primer annealing at 65 ˚C for 30 s and an extension at 72 ˚C for 1 min. .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Article Title: Multiple conformations are a conserved and regulatory feature of the RB1 5′ UTR
    Article Snippet: A T7 promoter (TAATACGACTCACTATAGGG) was introduced to the 5′ end of the 5′ UTR during PCR amplification followed by transcription with the T7 high-yield RNA synthesis kit (New England Biolabs) and cleanup by MegaClear (Ambion). .. Of note, 2 pmol RNA were used for each reaction and, after denaturation as previously described, were folded in a final concentration of 100 mM HEPES, pH 8.0, 10 mM MgCl2 , 100 mM KCl at 37°C for 15 min. Primer extension was performed as previously described, but with 2 pmol of Vic or Ned-labeled primer without RNase inhibitor.

    Article Title: RAN translation at C9orf72-associated repeat expansions is selectively enhanced by the integrated stress response
    Article Snippet: .. Linearized DNA was in vitro transcribed using HiScribe T7 High Yield RNA Synthesis Kit (NEB), with 3′-O-Me-m7 GpppG anti-reverse cap analog (ARCA) or ApppG cap (NEB) added at eight times the concentration of GTP, for a capping efficiency of ~ 90%. .. 10 μL T7 reactions were carried out at 37 °C for 2 h. Reactions were then treated with 2 U RNase-free DNaseI (NEB) for 15 min at 37 °C to remove DNA template, and then polyadenylated with 5 U E. coli Poly-A Polymerase, 10× buffer, and 10 mM ATP (NEB) for 1 h at 37 °C.

    Article Title: Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae) on Blood Engorgement and Reproduction
    Article Snippet: Double-stranded RNA was synthesized from T7 linked DNA using a HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs, Inc., Hitchin, UK) in accordance with the manufacturer’s protocol. .. The concentration of dsRNA was measured using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

    Gel Extraction:

    Article Title: Point-of-care diagnostic assay for the detection of Zika virus using the recombinase polymerase amplification method
    Article Snippet: The generated fragments were resolved on a 1 % agarose gel and gel-extracted using a QIAquick Gel Extraction kit (QIAgen). .. RNA template fragments were synthesized from the amplified and purified gBlock DNA fragments at approximately 1 µg per reaction using the HiScribe T7 High Yield RNA Synthesis kit (NEB) at 37 ˚C for 2 h according to the manufacturer’s instructions.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs hi scribe t7 kit
    Hi Scribe T7 Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 kit/product/New England Biolabs
    Average 95 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 kit - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    78
    New England Biolabs hi scribe t7 in vitro transcription kit
    Hi Scribe T7 In Vitro Transcription Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi scribe t7 in vitro transcription kit/product/New England Biolabs
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hi scribe t7 in vitro transcription kit - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results