mouse tnf α cdna  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85

    Structured Review

    Roche mouse tnf α cdna
    Expression of <t>TNF-α</t> by recombinant RV. (A) Schematic of RV-TNF-α recombinant constructs. The pSPBN vector was derived from SN by removing the Ψ gene and introducing BsiWI and NheI sites between the G and L genes. Mouse <t>TNF-α</t> cDNA was amplified by PCR, with the introduction of BsiWI and NheI sites, and was ligated into pSPBN, resulting in pSPBN-TNF-α(+). In pSPBN-TNF-α(MEM), the proteolytic cleavage site of TNF-α was removed by deleting the coding sequence for the first nine amino acids of soluble TNF-α and exchanging the lysine at position 11 with glutamic acid, as described in Materials and Methods. To construct pSPBN-TNF-α(−), the first seven ATG codons of the TNF-α gene were mutated. (B) TNF-α production in BSR cells. BSR cells were infected with SPBN-TNF-α(−), SPBN-TNF-α(MEM), or SPBN-TNF-α(+) at an MOI of 0.1 and incubated at 37°C. TNF-α secreted into the tissue culture supernatants of infected BSR cells was measured at 24 h p.i., using ELISA. OD, optical density. (C to L) Confocal double-immunofluorescence microscopy of TNF-α (green, panels C, F, and I) and rabies ribonucleocapsid (RNP) (red, panels D, G, and K) in NA cells infected with SPBN-TNF-α(+), SPBN-TNF-α(MEM), or SPBN-TNF-α(−). Panels E, H, and L show the composites of TNF-α and RNP double immunofluorescence. Note that TNF-α is absent only in NA cells infected with SPBN-TNF-α(−) (panels I and L).
    Mouse Tnf α Cdna, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 12232 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mouse tnf α cdna/product/Roche
    Average 85 stars, based on 12232 article reviews
    Price from $9.99 to $1999.99
    mouse tnf α cdna - by Bioz Stars, 2020-08
    85/100 stars

    Images

    1) Product Images from "Overexpression of Tumor Necrosis Factor Alpha by a Recombinant Rabies Virus Attenuates Replication in Neurons and Prevents Lethal Infection in Mice"

    Article Title: Overexpression of Tumor Necrosis Factor Alpha by a Recombinant Rabies Virus Attenuates Replication in Neurons and Prevents Lethal Infection in Mice

    Journal: Journal of Virology

    doi: 10.1128/JVI.79.24.15405-15416.2005

    Expression of TNF-α by recombinant RV. (A) Schematic of RV-TNF-α recombinant constructs. The pSPBN vector was derived from SN by removing the Ψ gene and introducing BsiWI and NheI sites between the G and L genes. Mouse TNF-α cDNA was amplified by PCR, with the introduction of BsiWI and NheI sites, and was ligated into pSPBN, resulting in pSPBN-TNF-α(+). In pSPBN-TNF-α(MEM), the proteolytic cleavage site of TNF-α was removed by deleting the coding sequence for the first nine amino acids of soluble TNF-α and exchanging the lysine at position 11 with glutamic acid, as described in Materials and Methods. To construct pSPBN-TNF-α(−), the first seven ATG codons of the TNF-α gene were mutated. (B) TNF-α production in BSR cells. BSR cells were infected with SPBN-TNF-α(−), SPBN-TNF-α(MEM), or SPBN-TNF-α(+) at an MOI of 0.1 and incubated at 37°C. TNF-α secreted into the tissue culture supernatants of infected BSR cells was measured at 24 h p.i., using ELISA. OD, optical density. (C to L) Confocal double-immunofluorescence microscopy of TNF-α (green, panels C, F, and I) and rabies ribonucleocapsid (RNP) (red, panels D, G, and K) in NA cells infected with SPBN-TNF-α(+), SPBN-TNF-α(MEM), or SPBN-TNF-α(−). Panels E, H, and L show the composites of TNF-α and RNP double immunofluorescence. Note that TNF-α is absent only in NA cells infected with SPBN-TNF-α(−) (panels I and L).
    Figure Legend Snippet: Expression of TNF-α by recombinant RV. (A) Schematic of RV-TNF-α recombinant constructs. The pSPBN vector was derived from SN by removing the Ψ gene and introducing BsiWI and NheI sites between the G and L genes. Mouse TNF-α cDNA was amplified by PCR, with the introduction of BsiWI and NheI sites, and was ligated into pSPBN, resulting in pSPBN-TNF-α(+). In pSPBN-TNF-α(MEM), the proteolytic cleavage site of TNF-α was removed by deleting the coding sequence for the first nine amino acids of soluble TNF-α and exchanging the lysine at position 11 with glutamic acid, as described in Materials and Methods. To construct pSPBN-TNF-α(−), the first seven ATG codons of the TNF-α gene were mutated. (B) TNF-α production in BSR cells. BSR cells were infected with SPBN-TNF-α(−), SPBN-TNF-α(MEM), or SPBN-TNF-α(+) at an MOI of 0.1 and incubated at 37°C. TNF-α secreted into the tissue culture supernatants of infected BSR cells was measured at 24 h p.i., using ELISA. OD, optical density. (C to L) Confocal double-immunofluorescence microscopy of TNF-α (green, panels C, F, and I) and rabies ribonucleocapsid (RNP) (red, panels D, G, and K) in NA cells infected with SPBN-TNF-α(+), SPBN-TNF-α(MEM), or SPBN-TNF-α(−). Panels E, H, and L show the composites of TNF-α and RNP double immunofluorescence. Note that TNF-α is absent only in NA cells infected with SPBN-TNF-α(−) (panels I and L).

    Techniques Used: Expressing, Recombinant, Construct, Plasmid Preparation, Derivative Assay, Amplification, Polymerase Chain Reaction, Sequencing, Infection, Incubation, Enzyme-linked Immunosorbent Assay, Immunofluorescence, Microscopy

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: The somatic piRNA pathway controls germline transposition over generations
    Article Snippet: .. One nanogram of total DNA was used for quantitative PCR reaction which was performed with the LightCycler 480 SYBR Green I Master mix on a Roche LichtCycler 480 instrument. .. Relative TE copy number was calculated with the advanced relative quantification method (Roche) using the Rpl32 single-copy gene as reference (for primer sequences see ).

    Amplification:

    Article Title: Germline and somatic mosaicism for FGFR2 mutation in the mother of a child with Crouzon syndrome: Implications for genetic testing in "paternal age-effect" syndromes
    Article Snippet: .. For further sequence analysis, amplification of exon 10 (IIIc) was performed in a 30 µl PCR reaction using Expand High FidelityPLUS PCR system reagents (Roche Applied Biosystems, Mannheim, Germany) in the following conditions: 1× HifiPLUS buffer, 2.5 mM MgCl2 , 0.75 U HifiPLUS DNA polymerase, 200 µM dNTPs and 0.1 µM each primer (5′-CCTCCACAATCATTCCTGTGTC-3′ and 5′-ATAGCAGTCAACCAAGAAAAGGG-3′). .. The following cycling conditions were used: initial 94°C for 2 min, followed by 30 cycles of 94°C for 10 sec, 62°C for 30 sec, 72°C for 30 sec, followed by a final extension at 72°C for 10 min. After checking for amplification on a 2% agarose gel, the fragments were gel-purified using a gel extraction microelute column (EZNA, Omega Bio-Tek, Norcross, GA).

    Synthesized:

    Article Title: Porcine Wharton’s jelly cells distribute throughout the body after intraperitoneal injection
    Article Snippet: .. Synthesis of DIG-labeled DNA probes Based on PCR reaction, 377 bp of dsDNA probe specific to porcine Y chromosome SRY was synthesized and labeled with DIG using a PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Briefly, 50 ng of male genomic DNA isolated from male WJCs was added to a 50-μL PCR reaction containing 1× PCR buffer with 1.5 mmol/L MgCl2 , 1× PCR DIG Probe Synthesis Mix containing dNTPs and DIG-11-dUTP, 0.75 μL of enzyme mix, and 0.25 μmol/L of specific porcine SRY forward and reverse primers (forward: 5’-AATCCACCATACCTCATGGACC-3’; reverse: 5’-TTTCTCCTGTATCCTCCTGC-3’; product size: 377 bp).

    Labeling:

    Article Title: Porcine Wharton’s jelly cells distribute throughout the body after intraperitoneal injection
    Article Snippet: .. Synthesis of DIG-labeled DNA probes Based on PCR reaction, 377 bp of dsDNA probe specific to porcine Y chromosome SRY was synthesized and labeled with DIG using a PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Briefly, 50 ng of male genomic DNA isolated from male WJCs was added to a 50-μL PCR reaction containing 1× PCR buffer with 1.5 mmol/L MgCl2 , 1× PCR DIG Probe Synthesis Mix containing dNTPs and DIG-11-dUTP, 0.75 μL of enzyme mix, and 0.25 μmol/L of specific porcine SRY forward and reverse primers (forward: 5’-AATCCACCATACCTCATGGACC-3’; reverse: 5’-TTTCTCCTGTATCCTCCTGC-3’; product size: 377 bp).

    SYBR Green Assay:

    Article Title: The somatic piRNA pathway controls germline transposition over generations
    Article Snippet: .. One nanogram of total DNA was used for quantitative PCR reaction which was performed with the LightCycler 480 SYBR Green I Master mix on a Roche LichtCycler 480 instrument. .. Relative TE copy number was calculated with the advanced relative quantification method (Roche) using the Rpl32 single-copy gene as reference (for primer sequences see ).

    Sequencing:

    Article Title: Germline and somatic mosaicism for FGFR2 mutation in the mother of a child with Crouzon syndrome: Implications for genetic testing in "paternal age-effect" syndromes
    Article Snippet: .. For further sequence analysis, amplification of exon 10 (IIIc) was performed in a 30 µl PCR reaction using Expand High FidelityPLUS PCR system reagents (Roche Applied Biosystems, Mannheim, Germany) in the following conditions: 1× HifiPLUS buffer, 2.5 mM MgCl2 , 0.75 U HifiPLUS DNA polymerase, 200 µM dNTPs and 0.1 µM each primer (5′-CCTCCACAATCATTCCTGTGTC-3′ and 5′-ATAGCAGTCAACCAAGAAAAGGG-3′). .. The following cycling conditions were used: initial 94°C for 2 min, followed by 30 cycles of 94°C for 10 sec, 62°C for 30 sec, 72°C for 30 sec, followed by a final extension at 72°C for 10 min. After checking for amplification on a 2% agarose gel, the fragments were gel-purified using a gel extraction microelute column (EZNA, Omega Bio-Tek, Norcross, GA).

    Polymerase Chain Reaction:

    Article Title: Germline and somatic mosaicism for FGFR2 mutation in the mother of a child with Crouzon syndrome: Implications for genetic testing in "paternal age-effect" syndromes
    Article Snippet: .. For further sequence analysis, amplification of exon 10 (IIIc) was performed in a 30 µl PCR reaction using Expand High FidelityPLUS PCR system reagents (Roche Applied Biosystems, Mannheim, Germany) in the following conditions: 1× HifiPLUS buffer, 2.5 mM MgCl2 , 0.75 U HifiPLUS DNA polymerase, 200 µM dNTPs and 0.1 µM each primer (5′-CCTCCACAATCATTCCTGTGTC-3′ and 5′-ATAGCAGTCAACCAAGAAAAGGG-3′). .. The following cycling conditions were used: initial 94°C for 2 min, followed by 30 cycles of 94°C for 10 sec, 62°C for 30 sec, 72°C for 30 sec, followed by a final extension at 72°C for 10 min. After checking for amplification on a 2% agarose gel, the fragments were gel-purified using a gel extraction microelute column (EZNA, Omega Bio-Tek, Norcross, GA).

    Article Title: A novel strategy to identify the location of necessary and sufficient cis-acting regulatory mRNA elements in trypanosomes
    Article Snippet: .. The PCR reaction was carried out by using 100 ng of self-ligated genomic DNA in a 50 μL PCR reaction using Expand DNA polymerase (Roche) and the oligonucleotides 5′cgccatcgccttctatcgcc and 5′GCGTGCAATCCATCTTGTTC, both of which prime outward from inside the neoR ORF (Fig. 4a ). ..

    Article Title: Sensitivity of human prostate cancer cells to chemotherapeutic drugs depends on EndoG expression regulated by promoter methylation
    Article Snippet: .. Each PCR reaction contained 0.25 μg of undigested or McrBC-digested DNA and 50 pmol of each primer in 25 μl of 1X GC-RICH PCR System (Roche Diagnostic, Indianapolis, IN). .. The cycling conditions consisted of an initial denaturation at 95°C for 10 min, followed by 30 cycles of denaturation at 95°C for 30 s, primer annealing at 66°C for 60 s, and extension at 72°C for 60 s. The semi-quantitative aspect of the procedure was verified by a linear increase in PCR product recovery with increasing cycle number and DNA template concentration.

    Article Title: Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies
    Article Snippet: .. Each 25 μl PCR reaction contained ~10 ng of DNA and was carried out using the FastStart High Fidelity PCR System (Roche Applied Science, Mannheim, Germany). ..

    Article Title: Porcine Wharton’s jelly cells distribute throughout the body after intraperitoneal injection
    Article Snippet: .. Synthesis of DIG-labeled DNA probes Based on PCR reaction, 377 bp of dsDNA probe specific to porcine Y chromosome SRY was synthesized and labeled with DIG using a PCR DIG Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Briefly, 50 ng of male genomic DNA isolated from male WJCs was added to a 50-μL PCR reaction containing 1× PCR buffer with 1.5 mmol/L MgCl2 , 1× PCR DIG Probe Synthesis Mix containing dNTPs and DIG-11-dUTP, 0.75 μL of enzyme mix, and 0.25 μmol/L of specific porcine SRY forward and reverse primers (forward: 5’-AATCCACCATACCTCATGGACC-3’; reverse: 5’-TTTCTCCTGTATCCTCCTGC-3’; product size: 377 bp).

    Article Title: Rapid detection of ERG11 gene mutations in clinical Candida albicans isolates with reduced susceptibility to fluconazole by rolling circle amplification and DNA sequencing
    Article Snippet: .. Each PCR reaction contained: 1.5 μl (12–15 ng/μl) template DNA, 0.25 μl (50 pmol/μl) each of forward primer and reverse primer, 1.25 μl dNTPs (2.5 mM of each dNTP; [Roche Diagnostics, Mannheim, Germany]), 0.1 μl HotStar Taq polymerase (5 units/μl), 2.5 μl 10 × PCR buffer, (Qiagen, Doncaster, Victoria, Australia) and water to a total volume of 25 μl. .. Amplification was performed on a Mastercycler gradient thermocycler (Eppendorf AG, North Ryde, Australia).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Roche hi fi pcr taq polymerase
    Hi Fi Pcr Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi fi pcr taq polymerase/product/Roche
    Average 92 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    hi fi pcr taq polymerase - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Roche hi fi taq polymerase
    Hi Fi Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi fi taq polymerase/product/Roche
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hi fi taq polymerase - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results