Structured Review

Cambrex hepes
Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in <t>DMEM-HEPES</t> medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended
Hepes, supplied by Cambrex, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hepes/product/Cambrex
Average 94 stars, based on 1 article reviews
Price from $9.99 to $1999.99
hepes - by Bioz Stars, 2020-04
94/100 stars

Images

1) Product Images from "Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species"

Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species

Journal:

doi: 10.1016/j.jinorgbio.2007.12.030

Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended
Figure Legend Snippet: Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended

Techniques Used:

DMEM-HEPES medium incubated with 0.4 mM Na 2 CrO 4 at 37°C under room air generates Cr(V) (left), whereas LHC-9 medium does not (right). The times of incubation with Na 2 CrO 4 are indicated. Representative ESR spectra obtained at room temperature are
Figure Legend Snippet: DMEM-HEPES medium incubated with 0.4 mM Na 2 CrO 4 at 37°C under room air generates Cr(V) (left), whereas LHC-9 medium does not (right). The times of incubation with Na 2 CrO 4 are indicated. Representative ESR spectra obtained at room temperature are

Techniques Used: Incubation, Electron Paramagnetic Resonance

Representative ESR spectra of Cr(V) obtained following incubation of DMEM-grown BEAS-2B cells with Na 2 CrO 4 . Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended in a small volume
Figure Legend Snippet: Representative ESR spectra of Cr(V) obtained following incubation of DMEM-grown BEAS-2B cells with Na 2 CrO 4 . Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended in a small volume

Techniques Used: Electron Paramagnetic Resonance, Incubation

Related Articles

Clone Assay:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). .. Generation of Constructs and Transduced Cell Lines —The complete CLEC9A open reading frame (ORF) was isolated from human PBMC cDNA by PCR and cloned into the pFBneo (Stratagene) retroviral vector containing an HA tag ( ) using the following primers; AAAGAATTCCCACCATGCACGAGGAAGAAATATAC and AAACTCGAGGACAGAGGATCTCAACGC.

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. All eight gene segments of this virus were amplified by reverse transcription-PCR, cloned in a modified version of the bidirectional reverse genetics plasmid pHW2000 ( , ), and subsequently used to generate recombinant virus by reverse genetics as described elsewhere ( ).

Amplification:

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. All eight gene segments of this virus were amplified by reverse transcription-PCR, cloned in a modified version of the bidirectional reverse genetics plasmid pHW2000 ( , ), and subsequently used to generate recombinant virus by reverse genetics as described elsewhere ( ).

Stable Transfection:

Article Title: Fluorescent Nanoparticle Uptake for Brain Tumor Visualization 1
Article Snippet: Rat 9L gliosarcoma and human Gli36 glioblastoma cell lines that were stably transfected to express GFP [ ], as well as the 9L parent cell line from the American Type Culture Collection (ATCC; Manassas, VA), were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), L -glutamine (2 mM), and penicillin (100 U/ml)/streptomycin (100 µg/ml). .. The mouse CT26 colon carcinoma cell line from ATCC was grown in RPMI 1640 supplemented with 10% FBS, L -glutamine (2 mM), penicillin (100 U/ml)/streptomycin (100 µg/ml), HEPES (10 mM) (Cambrex, Walkerville, MD), sodium pyruvate (1 mM), and 14 mM glucose.

Construct:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). .. Generation of Constructs and Transduced Cell Lines —The complete CLEC9A open reading frame (ORF) was isolated from human PBMC cDNA by PCR and cloned into the pFBneo (Stratagene) retroviral vector containing an HA tag ( ) using the following primers; AAAGAATTCCCACCATGCACGAGGAAGAAATATAC and AAACTCGAGGACAGAGGATCTCAACGC.

Incubation:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Activity Assay:

Article Title: Molecular Determinants of Adaptation of Highly Pathogenic Avian Influenza H7N7 Viruses to Efficient Replication in the Human Host ▿
Article Snippet: One hour after inoculation, cells were washed once with PBS and grown in 200 μl of infection medium, consisting of EMEM (Cambrex, Heerhugowaard, the Netherlands) supplemented with 4% bovine serum albumin (BSA), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 1.5 mg/ml sodium bicarbonate (Cambrex), 10 mM HEPES (Cambrex), nonessential amino acids (MP Biomedicals), and 20 μg/ml trypsin (Cambrex). .. Three days after inoculation, the supernatants of infected cell cultures were tested for agglutinating activity using turkey erythrocytes as an indicator of infection of the cells.

Cell Culture:

Article Title: Bcl-xL and Myeloid cell leukaemia-1 contribute to apoptosis resistance of colorectal cancer cells
Article Snippet: .. Cell lines were cultured in RPMI 1640 (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), Pen/Strep (1%) (PAA Laboratories, Pasching, Austria), HEPES (1%) (Cambrex, Verviers, Belgium) and L-Glutamin (1%) (Cambrex). ..

Article Title: REDOX regulation of IL-13 signaling in intestinal epithelial cells: usage of alternate pathways mediates distinct gene expression patterns
Article Snippet: .. HT-29.19A, a subclone of the human colorectal cancer cell line HT-29, were cultured at 37°C in humidified 5% CO2 in 75 cm2 culture flasks in Dulbecco’s Modified Eagle Medium, supplemented with 1% L-glutamine, 2.5% Hepes, 1% non-essential amino acids (all from Cambrex, Walkersville, MD) and 10% heat-inactivated fetal calf serum (BioWhittaker, Walkersville, MD). .. IL-13 and the neutralizing antibody to IL-13Rα1 were purchased from R & D Systems (Minneapolis, MN).

Article Title: Fluorescent Nanoparticle Uptake for Brain Tumor Visualization 1
Article Snippet: Paragraph title: Cell Culture ... The mouse CT26 colon carcinoma cell line from ATCC was grown in RPMI 1640 supplemented with 10% FBS, L -glutamine (2 mM), penicillin (100 U/ml)/streptomycin (100 µg/ml), HEPES (10 mM) (Cambrex, Walkerville, MD), sodium pyruvate (1 mM), and 14 mM glucose.

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: .. Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. 293T cells were cultured in Dulbecco's modified Eagle's medium (Cambrex) supplemented with 10% FCS, 100 IU of penicillin/ml, 100 mg of streptomycin/ml, 2 mM glutamine, 1 mM sodium pyruvate, and nonessential amino acids.

Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species
Article Snippet: Paragraph title: 2.2 Cell culture ... Alternatively, BEAS-2B cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience), 10% fetal bovine serum (FBS Optima, Atlanta Biologicals; or Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 µg/ml).

Article Title: Nuclear Expression of the Deubiquitinase CYLD Is Associated with Improved Survival in Human Hepatocellular Carcinoma
Article Snippet: .. Cells were cultured in DMEM (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), 1% Pen/Strep (PAA Laboratories, Pasching, Austria), 1% HEPES and 1% L-Glutamine (Cambrex, Verviers, Belgium). ..

Article Title: The pro-oxidant chromium(VI) inhibits mitochondrial complex I, complex II, and aconitase in the bronchial epithelium: EPR markers for Fe-S proteins
Article Snippet: Paragraph title: 2.2 Cell culture and Cr(VI) treatment ... BEAS-2B cells were grown at 37°C in humidified air containing 5% CO2 in Dulbecco's Modified Eagle's Medium with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience) supplemented with 10% LHC-9 medium, 10% fetal bovine serum (Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 μg/ml).

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Article Title: TRAIL-induced apoptosis of hepatocellular carcinoma cells is augmented by targeted therapies
Article Snippet: .. Cells were cultured in DMEM (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), 1% Pen/Strep (PAA laboratories, Pasching, Austria), 1% HEPES and 1% L-Glutamine (Cambrex, Verviers, Belgium). ..

Modification:

Article Title: REDOX regulation of IL-13 signaling in intestinal epithelial cells: usage of alternate pathways mediates distinct gene expression patterns
Article Snippet: .. HT-29.19A, a subclone of the human colorectal cancer cell line HT-29, were cultured at 37°C in humidified 5% CO2 in 75 cm2 culture flasks in Dulbecco’s Modified Eagle Medium, supplemented with 1% L-glutamine, 2.5% Hepes, 1% non-essential amino acids (all from Cambrex, Walkersville, MD) and 10% heat-inactivated fetal calf serum (BioWhittaker, Walkersville, MD). .. IL-13 and the neutralizing antibody to IL-13Rα1 were purchased from R & D Systems (Minneapolis, MN).

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: .. NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). ..

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. 293T cells were cultured in Dulbecco's modified Eagle's medium (Cambrex) supplemented with 10% FCS, 100 IU of penicillin/ml, 100 mg of streptomycin/ml, 2 mM glutamine, 1 mM sodium pyruvate, and nonessential amino acids.

Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species
Article Snippet: .. Alternatively, BEAS-2B cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience), 10% fetal bovine serum (FBS Optima, Atlanta Biologicals; or Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 µg/ml). ..

Article Title: The pro-oxidant chromium(VI) inhibits mitochondrial complex I, complex II, and aconitase in the bronchial epithelium: EPR markers for Fe-S proteins
Article Snippet: .. BEAS-2B cells were grown at 37°C in humidified air containing 5% CO2 in Dulbecco's Modified Eagle's Medium with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience) supplemented with 10% LHC-9 medium, 10% fetal bovine serum (Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 μg/ml). ..

Western Blot:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: EXPERIMENTAL PROCEDURES Primary Cells, Cell Lines, and Growth Conditions —Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats (Western Province Blood Transfusion Service, Cape Town, South Africa) using Ficoll-Paque™ Plus (Amersham Biosciences), as previously described ( ). .. NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex).

Derivative Assay:

Article Title: Bcl-xL and Myeloid cell leukaemia-1 contribute to apoptosis resistance of colorectal cancer cells
Article Snippet: SW480, HT29, Caco-2 (all isolated from primary tumor tissue) and SW620 (derived from lymph node metastasis), all human CRC cell lines (adenocarcinomas), were purchased from ATCC. .. Cell lines were cultured in RPMI 1640 (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), Pen/Strep (1%) (PAA Laboratories, Pasching, Austria), HEPES (1%) (Cambrex, Verviers, Belgium) and L-Glutamin (1%) (Cambrex).

Transfection:

Article Title: Fluorescent Nanoparticle Uptake for Brain Tumor Visualization 1
Article Snippet: Rat 9L gliosarcoma and human Gli36 glioblastoma cell lines that were stably transfected to express GFP [ ], as well as the 9L parent cell line from the American Type Culture Collection (ATCC; Manassas, VA), were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), L -glutamine (2 mM), and penicillin (100 U/ml)/streptomycin (100 µg/ml). .. The mouse CT26 colon carcinoma cell line from ATCC was grown in RPMI 1640 supplemented with 10% FBS, L -glutamine (2 mM), penicillin (100 U/ml)/streptomycin (100 µg/ml), HEPES (10 mM) (Cambrex, Walkerville, MD), sodium pyruvate (1 mM), and 14 mM glucose.

Article Title: TRAIL-induced apoptosis of hepatocellular carcinoma cells is augmented by targeted therapies
Article Snippet: Cells were cultured in DMEM (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), 1% Pen/Strep (PAA laboratories, Pasching, Austria), 1% HEPES and 1% L-Glutamine (Cambrex, Verviers, Belgium). .. Transfection experiments were performed in OPTIMEM (Invitrogen).

Infection:

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. Influenza virus A/Netherlands/602/2009 was isolated from the first patient with pdmH1N1 virus infection in the Netherlands ( ).

Article Title: Molecular Determinants of Adaptation of Highly Pathogenic Avian Influenza H7N7 Viruses to Efficient Replication in the Human Host ▿
Article Snippet: .. One hour after inoculation, cells were washed once with PBS and grown in 200 μl of infection medium, consisting of EMEM (Cambrex, Heerhugowaard, the Netherlands) supplemented with 4% bovine serum albumin (BSA), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 1.5 mg/ml sodium bicarbonate (Cambrex), 10 mM HEPES (Cambrex), nonessential amino acids (MP Biomedicals), and 20 μg/ml trypsin (Cambrex). .. Three days after inoculation, the supernatants of infected cell cultures were tested for agglutinating activity using turkey erythrocytes as an indicator of infection of the cells.

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Hemagglutination Assay:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: Supernatants were harvested after 5 days, and influenza A virus was detected by the hemagglutination assay ( ). .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium.

Generated:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: Monocyte-derived macrophages and dendritic cells were generated from PBMCs as described ( ). .. NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex).

other:

Article Title: Viral Factors Important for Efficient Replication of Influenza A Viruses in Cells of the Central Nervous System
Article Snippet: MDCK cells were maintained in EMEM supplemented with 10% FBS, 100 IU/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 1.5 mg/ml sodium bicarbonate, 1 mM, 10 mM HEPES (Cambrex), and 1× (0.1 mM) nonessential amino acids.

Isolation:

Article Title: Bcl-xL and Myeloid cell leukaemia-1 contribute to apoptosis resistance of colorectal cancer cells
Article Snippet: SW480, HT29, Caco-2 (all isolated from primary tumor tissue) and SW620 (derived from lymph node metastasis), all human CRC cell lines (adenocarcinomas), were purchased from ATCC. .. Cell lines were cultured in RPMI 1640 (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), Pen/Strep (1%) (PAA Laboratories, Pasching, Austria), HEPES (1%) (Cambrex, Verviers, Belgium) and L-Glutamin (1%) (Cambrex).

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: EXPERIMENTAL PROCEDURES Primary Cells, Cell Lines, and Growth Conditions —Peripheral blood mononuclear cells (PBMC) were isolated from buffy coats (Western Province Blood Transfusion Service, Cape Town, South Africa) using Ficoll-Paque™ Plus (Amersham Biosciences), as previously described ( ). .. NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex).

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. Influenza virus A/Netherlands/602/2009 was isolated from the first patient with pdmH1N1 virus infection in the Netherlands ( ).

Polymerase Chain Reaction:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). .. Generation of Constructs and Transduced Cell Lines —The complete CLEC9A open reading frame (ORF) was isolated from human PBMC cDNA by PCR and cloned into the pFBneo (Stratagene) retroviral vector containing an HA tag ( ) using the following primers; AAAGAATTCCCACCATGCACGAGGAAGAAATATAC and AAACTCGAGGACAGAGGATCTCAACGC.

Recombinant:

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. All eight gene segments of this virus were amplified by reverse transcription-PCR, cloned in a modified version of the bidirectional reverse genetics plasmid pHW2000 ( , ), and subsequently used to generate recombinant virus by reverse genetics as described elsewhere ( ).

Article Title: TRAIL-induced apoptosis of hepatocellular carcinoma cells is augmented by targeted therapies
Article Snippet: Cells were cultured in DMEM (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), 1% Pen/Strep (PAA laboratories, Pasching, Austria), 1% HEPES and 1% L-Glutamine (Cambrex, Verviers, Belgium). .. Reagents were purchased from the following suppliers: recombinant TRAIL (with Enhancer applied in a concentration of 1 μg/mL) and SuperKillerTRAIL (SkTRAIL) from Alexis Biochemicals (SanDiego, CA, USA), goat anti-human IgG F(ab)’2 from Meridian Life Science (Cincinnati, USA), 5-fluorouracil (5-FU), doxorubicin (Doxo) from Sigma (Deisenhofen, Germany), SP600125, AG1478, PD98059, LY294002 and rapamycin (RAPA) from Calbiochem (Schwalbach, Germany).

Endpoint Dilution Assay:

Article Title: Molecular Determinants of Adaptation of Highly Pathogenic Avian Influenza H7N7 Viruses to Efficient Replication in the Human Host ▿
Article Snippet: One hour after inoculation, cells were washed once with PBS and grown in 200 μl of infection medium, consisting of EMEM (Cambrex, Heerhugowaard, the Netherlands) supplemented with 4% bovine serum albumin (BSA), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 1.5 mg/ml sodium bicarbonate (Cambrex), 10 mM HEPES (Cambrex), nonessential amino acids (MP Biomedicals), and 20 μg/ml trypsin (Cambrex). .. Infectious titers were calculated from five replicates by the Spearman-Karber method ( ).

Microscopy:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Titration:

Article Title: Molecular Determinants of Adaptation of Highly Pathogenic Avian Influenza H7N7 Viruses to Efficient Replication in the Human Host ▿
Article Snippet: Virus titrations were performed by end point titration in MDCK cells as described previously ( ). .. One hour after inoculation, cells were washed once with PBS and grown in 200 μl of infection medium, consisting of EMEM (Cambrex, Heerhugowaard, the Netherlands) supplemented with 4% bovine serum albumin (BSA), 100 U/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine, 1.5 mg/ml sodium bicarbonate (Cambrex), 10 mM HEPES (Cambrex), nonessential amino acids (MP Biomedicals), and 20 μg/ml trypsin (Cambrex).

Quantitative RT-PCR:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Plasmid Preparation:

Article Title: CLEC9A Is a Novel Activation C-type Lectin-like Receptor Expressed on BDCA3+ Dendritic Cells and a Subset of Monocytes * Dendritic Cells and a Subset of Monocytes * S⃞
Article Snippet: NIH3T3 and HEK293T fibroblasts, RAW264.7 macrophages, HEK293T-based Phoenix ecotropic retroviral packaging cell lines (a gift from Dr. Gary Nolan, Stanford University), Syk-deficient (C35) and Syk-reconstituted (WT8) B-cell lines ( ) were maintained in Dulbecco's modified Eagle's medium or RPMI1640 medium (Cambrex) supplemented with 10% heat-inactivated fetal calf serum (Invitrogen), 20 mm HEPES, 2 mm l -glutamine, 100 units/ml penicillin, and 0.1 mg/ml streptomycin (Cambrex). .. Generation of Constructs and Transduced Cell Lines —The complete CLEC9A open reading frame (ORF) was isolated from human PBMC cDNA by PCR and cloned into the pFBneo (Stratagene) retroviral vector containing an HA tag ( ) using the following primers; AAAGAATTCCCACCATGCACGAGGAAGAAATATAC and AAACTCGAGGACAGAGGATCTCAACGC.

Article Title: Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿Virulence-Associated Substitution D222G in the Hemagglutinin of 2009 Pandemic Influenza A(H1N1) Virus Affects Receptor Binding ▿ ‡
Article Snippet: Madin-Darby Canine kidney (MDCK) cells were cultured in Eagle's minimum essential medium (EMEM; Cambrex, Heerhugowaard, Netherlands) supplemented with 10% fetal calf serum (FCS), 100 IU of penicillin/ml, 100 μg of streptomycin/ml, 2 mM glutamine, 1.5 mg of sodium bicarbonate (Cambrex)/ml, 10 mM HEPES (Cambrex), and nonessential amino acids (MP Biomedicals Europe, Illkirch, France). .. All eight gene segments of this virus were amplified by reverse transcription-PCR, cloned in a modified version of the bidirectional reverse genetics plasmid pHW2000 ( , ), and subsequently used to generate recombinant virus by reverse genetics as described elsewhere ( ).

Produced:

Article Title: REDOX regulation of IL-13 signaling in intestinal epithelial cells: usage of alternate pathways mediates distinct gene expression patterns
Article Snippet: HT-29.19A, a subclone of the human colorectal cancer cell line HT-29, were cultured at 37°C in humidified 5% CO2 in 75 cm2 culture flasks in Dulbecco’s Modified Eagle Medium, supplemented with 1% L-glutamine, 2.5% Hepes, 1% non-essential amino acids (all from Cambrex, Walkersville, MD) and 10% heat-inactivated fetal calf serum (BioWhittaker, Walkersville, MD). .. Apocynin and the JAK1 inhibitor were obtained from Calbiochem (Gibbstown, NJ), and DPI was produced by Sigma-Aldrich (St Louis, MO).

Concentration Assay:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: The highest concentration of trypsin at which cells showed a normal morphology was used in each infection medium. .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium.

Virus Isolation Assay:

Article Title: Practical Considerations for High-Throughput Influenza A Virus Surveillance Studies of Wild Birds by Use of Molecular Diagnostic Tests ▿
Article Snippet: .. To evaluate MDCK cells for use for primary virus isolation attempts, the MDCK cells were inoculated with 100 μl of the original material positive for the M gene by RRT-PCR in 1 ml MDCK infection medium (Eagle minimal essential medium supplemented with 4% bovine serum albumin [Gibco], 100 IU/ml penicillin, 100 μg/ml streptomycin, 1.5 mg/ml sodium bicarbonate, 2 mM glutamine, 10 mM HEPES, nonessential amino acids, and 20 μg/ml trypsin [Cambrex]) and incubated for 1 h. The cells were subsequently washed once with phosphate-buffered saline and cultured in infection medium. .. The cells were checked daily for cytopathic effects by microscopy.

Staining:

Article Title: Nuclear Expression of the Deubiquitinase CYLD Is Associated with Improved Survival in Human Hepatocellular Carcinoma
Article Snippet: Cells were cultured in DMEM (Invitrogen, Karlsruhe, Germany), supplemented with 10% fetal calf serum (FCS, Biochrom, Berlin, Germany), 1% Pen/Strep (PAA Laboratories, Pasching, Austria), 1% HEPES and 1% L-Glutamine (Cambrex, Verviers, Belgium). .. For immunhistochemical staining 2.5×106 cells were seeded in 12-well plates on cover glasses (18 mm diameter).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Cambrex hepes
    Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in <t>DMEM-HEPES</t> medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended
    Hepes, supplied by Cambrex, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hepes/product/Cambrex
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hepes - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    80
    Cambrex mm hepes
    Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in <t>DMEM-HEPES</t> medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended
    Mm Hepes, supplied by Cambrex, used in various techniques. Bioz Stars score: 80/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mm hepes/product/Cambrex
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    mm hepes - by Bioz Stars, 2020-04
    80/100 stars
      Buy from Supplier

    86
    Cambrex hepes buffered saline
    Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in <t>DMEM-HEPES</t> medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended
    Hepes Buffered Saline, supplied by Cambrex, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hepes buffered saline/product/Cambrex
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    hepes buffered saline - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended

    Journal:

    Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species

    doi: 10.1016/j.jinorgbio.2007.12.030

    Figure Lengend Snippet: Representative Cr(V) signals from BEAS-2B cells exposed to 0.4 mM Na 2 CrO 4 for 5 min at 37°C in LHC-9 medium under room air. Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended

    Article Snippet: Alternatively, BEAS-2B cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience), 10% fetal bovine serum (FBS Optima, Atlanta Biologicals; or Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 µg/ml).

    Techniques:

    DMEM-HEPES medium incubated with 0.4 mM Na 2 CrO 4 at 37°C under room air generates Cr(V) (left), whereas LHC-9 medium does not (right). The times of incubation with Na 2 CrO 4 are indicated. Representative ESR spectra obtained at room temperature are

    Journal:

    Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species

    doi: 10.1016/j.jinorgbio.2007.12.030

    Figure Lengend Snippet: DMEM-HEPES medium incubated with 0.4 mM Na 2 CrO 4 at 37°C under room air generates Cr(V) (left), whereas LHC-9 medium does not (right). The times of incubation with Na 2 CrO 4 are indicated. Representative ESR spectra obtained at room temperature are

    Article Snippet: Alternatively, BEAS-2B cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience), 10% fetal bovine serum (FBS Optima, Atlanta Biologicals; or Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 µg/ml).

    Techniques: Incubation, Electron Paramagnetic Resonance

    Representative ESR spectra of Cr(V) obtained following incubation of DMEM-grown BEAS-2B cells with Na 2 CrO 4 . Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended in a small volume

    Journal:

    Article Title: Reductive Activation of Hexavalent Chromium by Human Lung Epithelial Cells: Generation of Cr(V) and Cr(V)-Thiol Species

    doi: 10.1016/j.jinorgbio.2007.12.030

    Figure Lengend Snippet: Representative ESR spectra of Cr(V) obtained following incubation of DMEM-grown BEAS-2B cells with Na 2 CrO 4 . Cells were grown in DMEM-HEPES medium with 10% FBS, harvested by scraping, washed in pre-warmed LHC-9 medium, and resuspended in a small volume

    Article Snippet: Alternatively, BEAS-2B cells were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 25 mM HEPES and 4.5 g/L glucose (BioWhittaker 12-709F, Cambrex BioScience), 10% fetal bovine serum (FBS Optima, Atlanta Biologicals; or Valley Biomedical, Winchester, VA), penicillin (100 U/ml), and streptomycin (100 µg/ml).

    Techniques: Electron Paramagnetic Resonance, Incubation