hemo klentaq  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    Hemo KlenTaq
    Description:
    Hemo KlenTaq 1 000 rxns
    Catalog Number:
    m0332l
    Price:
    432
    Size:
    1 000 rxns
    Category:
    Thermostable DNA Polymerases
    Buy from Supplier


    Structured Review

    New England Biolabs hemo klentaq
    Hemo KlenTaq
    Hemo KlenTaq 1 000 rxns
    https://www.bioz.com/result/hemo klentaq/product/New England Biolabs
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hemo klentaq - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    2) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    3) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    4) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    5) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    6) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    7) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    8) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    9) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    10) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    Journal: The Journal of Molecular Diagnostics : JMD

    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Amplification:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: .. Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. MIP concentration was based on a ratio of 667 copies of each MIP to each haploid genome copy, based on the 1X pool concentration.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Of importance, the complementing Taq polymerases produced, on average, approximately 30-fold more amplification products from plasma miR-16 than did the intact polymerase alone (see B at ), which suggests that overcoming blood-borne inhibitors of Taq polymerase using Hemo KlenTaq yields an overall increase in detection sensitivity and specificity of circulating miRNAs. .. To test whether overcoming endogenous inhibitors with complementing polymerases provides proportionally higher miRNA quantitation, we analyzed circulating miRNAs in the blood of six healthy individuals (see at ).

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Synthesized:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    SYBR Green Assay:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Supplemental Figure S6: Titration of Hemo KlenTaq with an intact Taq polymerase in TaqMan and SYBR Green reactions improves PCR yield. .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated. .. B: qPCR analyses of these reactions.

    Microarray:

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Quantitation Assay:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Stripping Membranes:

    Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
    Article Snippet: ABgene 8-Flat-Cap Strip Tubes. .. Hemo Klentaq (New England Biolabs).

    Hybridization:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: .. Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. MIP concentration was based on a ratio of 667 copies of each MIP to each haploid genome copy, based on the 1X pool concentration.

    Ligation:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: .. Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. MIP concentration was based on a ratio of 667 copies of each MIP to each haploid genome copy, based on the 1X pool concentration.

    other:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: We tested enzymes reported to be more resistant to inhibitors: Phusion, Phire, and Hemo KlenTaq.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: We tested whether this lack of specificity is a general property of Hemo KlenTaq by evaluating the purity of amplifying miR-16 released from BeWo cells in culture.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: This phenomenon may be a consequence of lack of the editing and proofreading 5′- > 3′ exonuclease domain in Hemo KlenTaq.

    Polymerase Chain Reaction:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Supplemental Figure S6: Titration of Hemo KlenTaq with an intact Taq polymerase in TaqMan and SYBR Green reactions improves PCR yield. .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. A: Functioning of GoTaq, Phire, Phusion, and Hemo KlenTaq was tested using cDNA of miRNA isolated from the indicated amount of starting volume of serum using end-point PCR (40 cycles). (−) indicates that PCR reaction was performed using Phire (left lane) or GoTaq (right lane) but with no template. .. B: Quantitation using TaqMan.

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB). .. Cycling conditions were 2 min at 94 °C, followed by 41 cycles of 94 °C for 30 s, 49 °C for 45 s, and 72 °C for 1 min. For measurement of KRAS G12D, each 50 μL reaction contained: 1× Standard Taq Buffer, 1.3 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 80 μM dNTPs, 500 nM MSP (5′-fluorescein-CTTGTGGTAGTTGGAGCTTA-3′), 475 nM BP (5′-CTTGTGGTAGTTGGAGCTTdG-3′), 500 nM downstream primer (5′-GATTTACCTCTATTGTTGGA-3′), 80 mU PerfectMatch PCR Enhancer, and 0.5 µL Hemo KlenTaq DNA polymerase.

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated. .. B: qPCR analyses of these reactions.

    Mutagenesis:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Hemo KlenTaq is a mutant Taq DNA polymerase that has 100-fold lower sensitivity to blood inhibitors than does wild-type Taq. .. Our analysis indicates that Hemo KlenTaq amplified miR-16, more efficiently than did Phusion ( A; see also A at ), and standard Taq DNA polymerase yielded low or no detectable PCR products in the same samples ( D).

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: Paragraph title: 4.4. Generation of Mutant and Wild-Type Standards and ACB-PCR ... For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Isolation:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. A: Functioning of GoTaq, Phire, Phusion, and Hemo KlenTaq was tested using cDNA of miRNA isolated from the indicated amount of starting volume of serum using end-point PCR (40 cycles). (−) indicates that PCR reaction was performed using Phire (left lane) or GoTaq (right lane) but with no template. .. B: Quantitation using TaqMan.

    Titration:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Supplemental Figure S6: Titration of Hemo KlenTaq with an intact Taq polymerase in TaqMan and SYBR Green reactions improves PCR yield. .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated.

    Sequencing:

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Paragraph title: Molecular inversion probes design, capture and sequencing ... For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. A: PAGE analyses of end-point PCR products of reactions supplemented with indicated volume of Hemo KlenTaq in TaqMan or SYBR Green master mixes as indicated. .. B: qPCR analyses of these reactions.

    Purification:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. We pooled 5 μl of ~96 different barcoded libraries together and purified the pools with 0.8X AMPure XP beads (Beckman Coulter, Brea, CA) according to the manufacturer’s protocol.

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: Probe sequences were synthesized on a single microarray as 150mers by CustomArray, Inc. smMIPS probes were PCR amplified from the resulting pool, using externally directed primers “mipPrep1F” and “mipPrep1R” (5′‐GGTAGCAAAGTGCAGATGTGCTCTTC‐3′, and 5′‐TGAACTCACACTGCTCTGAACTCTTC‐3′), digested overnight with EarI (NEB) to remove flanking amplification primers, purified with one volume SPRI beads supplemented with five volumes isopropanol, and eluted in Tris‐EDTA pH 8. .. For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre).

    Plasmid Preparation:

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Real-time Polymerase Chain Reaction:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Multiplex Assay:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: .. Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. MIP concentration was based on a ratio of 667 copies of each MIP to each haploid genome copy, based on the 1X pool concentration.

    Incubation:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. Reactions were incubated at 95°C for 10 min then at 60°C for 18 h. Exonuclease treatment and amplification of the captured DNA was performed as previously described .

    Article Title: Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism, et al. Next generation sequencing panel based on single molecule molecular inversion probes for detecting genetic variants in children with hypopituitarism
    Article Snippet: For smMIPS captures, approximately 3 ng smMIPS probes were combined with 125 ng genomic DNA, in a reaction mixture including Ampligase DNA Ligase Buffer 1X (Epicentre), 0.4 μM dNTPs (NEB), 3.2U HemoKlentaq (NEB) and 1U Ampligase (Epicentre). .. After denaturation at 95°C for 10 min and incubation at 60°C for 20 hr, linear probes and the remaining genomic DNA were removed by exonuclease treatment with ExoI and ExoII (NEB).

    Produced:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Hemo KlenTaq was used to amplify miR-16 cDNA produced from miRNAs released from BeWo cells into tissue culture media (BeWo exosomes). ..

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: .. Of importance, the complementing Taq polymerases produced, on average, approximately 30-fold more amplification products from plasma miR-16 than did the intact polymerase alone (see B at ), which suggests that overcoming blood-borne inhibitors of Taq polymerase using Hemo KlenTaq yields an overall increase in detection sensitivity and specificity of circulating miRNAs. .. To test whether overcoming endogenous inhibitors with complementing polymerases provides proportionally higher miRNA quantitation, we analyzed circulating miRNAs in the blood of six healthy individuals (see at ).

    Concentration Assay:

    Article Title: Recurrent de novo mutations implicate novel genes underlying simplex autism risk
    Article Snippet: Multiplex capture and amplification of targeted sequences Hybridization of smMIPs to genomic DNA, gap filling and ligation were performed in one 25 μl reaction of 1X Ampligase buffer (Epicentre, Madison, WI) with: 120 ng of genomic DNA, 0.32 μM dNTPs, 0.5X of Hemo KlenTaq (0.32μl) (New England Biolabs, Inc., Ipswich, MA), one unit of Ampligase (Epicentre), and MIPs. .. MIP concentration was based on a ratio of 667 copies of each MIP to each haploid genome copy, based on the 1X pool concentration.

    Article Title: Low-Frequency Mutational Heterogeneity of Invasive Ductal Carcinoma Subtypes: Information to Direct Precision Oncology
    Article Snippet: On the day of the ACB-PCR, purified PIK3CA codon 1047 and codon 545, KRAS codon 12, HRAS codon 12, or BRAF codon 12 mutant and wild-type reference DNAs (prepared by PCR amplification of cloned mutant or wild-type plasmid DNAs [ ]) were mixed to generate standards with MFs of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the wild-type sequence), at a concentration of 5 × 107 copies/μL for the PIK3CA E545K, KRAS G12D and G12V, and BRAF V600E standards, and 1 × 108 copies/μL for the PIK3CA H1047R and HRAS G12D standards. .. For the PIK3CA H1047R ACB-PCR, each 50 μL reaction contained: 1× Standard Taq Buffer (New England Biolabs (NEB), Beverly, MA, USA), 1.5 mM MgCl2 , 0.1 mg/mL gelatin, 1.0 mg/mL Triton X-100, 40 μM dNTPs, 150 nM MSP (5′-fluorescein-TGTTGTCCAGCCACCATGTC-3′), 500 nM BP (5′-TGTTGTCCAGCCACCATGTdT-3′), 150 nM upstream primer (5′-GATGCTTGGCTCTGGAATGC-3′), 60 mU PerfectMatch PCR Enhancer (Agilent Technologies), and 0.3 µL Hemo KlenTaq DNA polymerase (NEB).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs hemo klentaq
    Mutant TaqDNA polymerase, <t>Hemo</t> <t>KlenTaq</t> improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Hemo Klentaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hemo klentaq/product/New England Biolabs
    Average 95 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hemo klentaq - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Journal: The Journal of Molecular Diagnostics : JMD

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    doi: 10.1016/j.jmoldx.2011.09.002

    Figure Lengend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Article Snippet: Supplemental Figure S6: Titration of Hemo KlenTaq with an intact Taq polymerase in TaqMan and SYBR Green reactions improves PCR yield.

    Techniques: Mutagenesis, Polymerase Chain Reaction