hemo klentaq  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Hemo KlenTaq
    Hemo KlenTaq 1 000 rxns
    Catalog Number:
    1 000 rxns
    Thermostable DNA Polymerases
    Buy from Supplier

    Structured Review

    New England Biolabs hemo klentaq
    Hemo KlenTaq
    Hemo KlenTaq 1 000 rxns
    https://www.bioz.com/result/hemo klentaq/product/New England Biolabs
    Average 97 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    hemo klentaq - by Bioz Stars, 2019-10
    97/100 stars


    1) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    2) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    3) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    4) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    5) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    6) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    7) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    8) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    9) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    10) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    11) Product Images from "Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation"

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation


    doi: 10.1016/j.jmoldx.2011.09.002

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Figure Legend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Techniques Used: Mutagenesis, Polymerase Chain Reaction

    Related Articles


    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: It was observed that Hemo KlenTaq in combination with intact Taq polymerases amplified specific PCR products suitable for qPCR using SYBR Green or TaqMan ( , B and C; see also A at ). .. Of importance, the complementing Taq polymerases produced, on average, approximately 30-fold more amplification products from plasma miR-16 than did the intact polymerase alone (see B at ), which suggests that overcoming blood-borne inhibitors of Taq polymerase using Hemo KlenTaq yields an overall increase in detection sensitivity and specificity of circulating miRNAs. .. To test whether overcoming endogenous inhibitors with complementing polymerases provides proportionally higher miRNA quantitation, we analyzed circulating miRNAs in the blood of six healthy individuals (see at ).

    Article Title: Evaluation of Inhibitor-Resistant Real-Time PCR Methods for Diagnostics in Clinical and Environmental Samples
    Article Snippet: Three different PCR buffers designed for amplification in inhibitory samples were used, including PCRboost (Biomatrica, San Diego, CA), STRboost (Biomatrica), and Ampdirect (Rockland Immunochemicals, Gilbertsville, PA). .. Phusion Blood Direct PCR Kit (New England Biolabs, Ipswich, MA), Hemo KlenTaq (New England Biolabs), KAPA Blood PCR Kit (KAPA Biosystems, Woburn, MA), and Omni Klentaq (DNA Polymerase Technology, St. Louis, MO) were all designed for PCR amplification in blood and other inhibitory samples. .. Phire Hot Start DNA Polymerase (New England Biolabs) was an enhanced DNA polymerase, and Terra PCR Direct Polymerase Mix (Clontech, Mountain View, CA) was used for use with tissues and crude samples.

    Article Title: The maternal and early embryonic transcriptome of the milkweed bug Oncopeltus fasciatus
    Article Snippet: Contrary to some expectations, SuperScript III reverse transcriptase (Invitrogen) may be substituted in this protocol with equivalent results (data not shown). .. To maximize yield during cDNA amplification, the first round of amplification was conducted using a 2:2:1 mix (v:v:v) of Hemo KlenTaq (New England Biolabs), Phusion (New England Biolabs), and PfuTurbo (Stratagene) polymerases. .. This mixture of enzymes was determined empirically to provide the highest yield of cDNA with a range of input first-strand concentrations.

    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: ACB‐PCR reactions were performed in 96‐well PCR plates (Thermo Fisher Scientific, Waltham, MA) using three primers: a fluorescein‐labeled mutant‐specific primer (MSP), a non‐extendable blocker primer (BP, to reduce background amplification of WT PIK3CA ), and an upstream/downstream primer [Myers et al., ]. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB).

    SYBR Green Assay:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration. .. Hemo KlenTaq (HKT) polymerase and 5× buffer were obtained from New England Biolabs and used in the manufacturer recommended amount.

    Quantitation Assay:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: However, initial attempts to adopt these enzymes for qPCR of miRNAs using TaqMan failed (see B at ). .. It is likely that for Hemo KlenTaq, quantitation was compromised by production of multiple spurious bands in addition to the correct band ( A; see also at ). .. We tested whether this lack of specificity is a general property of Hemo KlenTaq by evaluating the purity of amplifying miR-16 released from BeWo cells in culture.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Stripping Membranes:

    Article Title: Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
    Article Snippet: The capture master mix ( ) for 30 reactions (450 μl) contained 75 μl 10 × Ampligase DNA ligase buffer (Epicentre/Illumina, Madison, WI, USA), 9.9 μl of the phosphorylated smMIP pool (0.833 μM diluted 1:625), 0.96 μl dNTPs (0.25 mM, diluted from 100 mM, Invitrogen/Thermo Fisher Scientific, Carlsbad, CA, USA), 9.6 μl Hemo Klentaq (10 units μl−1 , New England Biolabs), 0.30 μl Ampligase DNA ligase (100 units μl−1 , Epicentre/Illumina) and 354.3 μl H2 O (added to get to total volume). .. The capture master mix ( ) for 30 reactions (450 μl) contained 75 μl 10 × Ampligase DNA ligase buffer (Epicentre/Illumina, Madison, WI, USA), 9.9 μl of the phosphorylated smMIP pool (0.833 μM diluted 1:625), 0.96 μl dNTPs (0.25 mM, diluted from 100 mM, Invitrogen/Thermo Fisher Scientific, Carlsbad, CA, USA), 9.6 μl Hemo Klentaq (10 units μl−1 , New England Biolabs), 0.30 μl Ampligase DNA ligase (100 units μl−1 , Epicentre/Illumina) and 354.3 μl H2 O (added to get to total volume).

    Article Title: Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs)
    Article Snippet: ABgene 8-Flat-Cap Strip Tubes. .. Hemo Klentaq (New England Biolabs).

    Activity Assay:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: This phenomenon may be a consequence of lack of the editing and proofreading 5′- > 3′ exonuclease domain in Hemo KlenTaq. .. To overcome the limitations of Hemo KlenTaq, we tested whether the reduced proof-reading activity of Hemo KlenTaq could be complemented by an intact Taq polymerase. .. It was observed that Hemo KlenTaq in combination with intact Taq polymerases amplified specific PCR products suitable for qPCR using SYBR Green or TaqMan ( , B and C; see also A at ).


    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Targeted sequencing of BRCA1 and BRCA2 using DNA derived from FFPE OCs was performed as previously described [Weren et al., ], using a slightly modified smMIP capture protocol [O'Roak et al., ; Hiatt et al., ]. .. Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O).

    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: The ACB‐PCR measurement of KRAS G12D and G12V was performed as described previously [Myers et al., ]. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB). .. The PIK3CA E545K ACB‐PCR product is 77 bp in length.

    Derivative Assay:

    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Targeted sequencing of BRCA1 and BRCA2 using DNA derived from FFPE OCs was performed as previously described [Weren et al., ], using a slightly modified smMIP capture protocol [O'Roak et al., ; Hiatt et al., ]. .. Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O).


    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: If the extension or ligation arm targeted a common SNP (MAF > 1%), two different smMIPs were designed to recognize and target both alleles. .. Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O).

    TaqMan microRNA Assay:

    Article Title: Sensitive PCR-Based Quantitation of Cell-Free Circulating MicroRNAs
    Article Snippet: Remove TaqMan MicroRNA Assay kit and cDNA from freezer and thaw on Bath Armor Beads or ice. .. Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction. .. It is recommended to measure each sample/primer combination in triplicate.


    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: This phenomenon may be a consequence of lack of the editing and proofreading 5′- > 3′ exonuclease domain in Hemo KlenTaq.

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: This limitation can be overcome with concomitant use of two complementing Taq polymerases: Hemo KlenTaq, which is resistant to blood-borne inhibitors, in combination with another intact polymerase that has effective proofreading ability.

    Article Title: Resolving genomic disorder–associated breakpoints within segmental DNA duplications using massively parallel sequencing
    Article Snippet: Custom oligonucleotide microarrays (Agilent Technologies) Array CGH reagents Microsatellite genotyping reagents Somatic cell hybrid reagents Molecular inversion probes (MIPs, Integrated DNA Technologies) T4 DNA Ligase Buffer with 10 mM ATP (New England BioLabs cat. no. B0202S) T4 polynucleotide kinase (New England BioLabs, cat. no. M0201L) Ampligase buffer (Epicentre, cat. no A1905B) 10 mM dNTP mix (Roche NimbleGen, cat. no. 11581295001) Hemo Klentaq (New England BioLabs, cat. no. M0332L) Ampligase (Epicentre, cat. no. A0110K) Nuclease-free water (Ambion, cat. no. AM9906) Genomic DNA from individuals to be analyzed CAUTION: All human genetic studies must be approved by an institutional review board, and all participating subjects must provide informed consent.

    Article Title: Direct-qPCR Assay for Coupled Identification and Antimicrobial Susceptibility Testing of Neisseria gonorrhoeae
    Article Snippet: Hemo KlenTaq polymerase and Hemo KlenTaq Reaction Buffer were purchased from New England Biolabs (Ipswich, MA USA).


    Article Title: Identifying the targets of aminoacyl-tRNA synthetase inhibitors by primer extension inhibition
    Article Snippet: The reactions were performed by adapting the protocol from the previously available fmol DNA Cycle Sequencing System kit (Promega). .. Approximately 150 ng of the DNA template were combined with 3 pmol of radiolabeled NV1 primer (see earlier in the text) and 1 µl of Hemo KlenTaq DNA polymerase (New England Biolabs) previously diluted 40 times in storage buffer [10 mM Tris–HCl (pH 7.4), 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 0.5% Tween-20 (Sigma), 0.5% IGEPAL CA-630 (Sigma), 50% glycerol] in a total volume of 17 µl of sequencing buffer [50 mM Tris–HCl (pH 9.0) at 25°C, 2 mM MgCl2 ]. .. Four microliters of the mixture were distributed into four different PCR tubes containing 2 µl of the corresponding terminator solution (20 µM of each dNTP (dATP, dTTP, dCTP and 7-deaza-dGTP) and either 30 µM ddGTP, 350 µM ddATP, 600 µM ddTTP or 200 µM ddCTP).

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: PCR validation was performed with a 100-nt single-stranded DNA sequence reported previously as Thr-02, using primers AGCAGCACAGAGGTCAGATG and TTCACGGTAGCACGCATAGG. .. Hemo KlenTaq (HKT) polymerase and 5× buffer were obtained from New England Biolabs and used in the manufacturer recommended amount.

    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Paragraph title: Targeted Sequencing of BRCA1 and BRCA2 by smMIPs ... Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O).

    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: Mutant (either PIK3CA E545K, PIK3CA H1047R, KRAS G12D, or KRAS G12V) and WT reference DNA samples were mixed to generate standards with mutant:WT ratios (i.e., MFs) of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the WT sequence), at a concentration of 5 × 107 copies/μl for the PIK3CA E545K mutation or 1 × 108 copies/µl for the PIK3CA H1047R mutation. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB).

    Cellular Antioxidant Activity Assay:

    Article Title: The maternal and early embryonic transcriptome of the milkweed bug Oncopeltus fasciatus
    Article Snippet: Template-switching essential for the SMART technique was achieved using a 5' primer (PD242, 5'-AAG CAG TGG TAT CAA CGC AGA GTG GCC ACG AAG GCC rGrGrG-3') with three RNA nucleotides at its 3' end, which contains an Sfi I site. .. To maximize yield during cDNA amplification, the first round of amplification was conducted using a 2:2:1 mix (v:v:v) of Hemo KlenTaq (New England Biolabs), Phusion (New England Biolabs), and PfuTurbo (Stratagene) polymerases.


    Article Title: Sensitive PCR-Based Quantitation of Cell-Free Circulating MicroRNAs
    Article Snippet: Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction. .. Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction.

    Nucleic Acid Electrophoresis:

    Article Title: Identifying the targets of aminoacyl-tRNA synthetase inhibitors by primer extension inhibition
    Article Snippet: Approximately 150 ng of the DNA template were combined with 3 pmol of radiolabeled NV1 primer (see earlier in the text) and 1 µl of Hemo KlenTaq DNA polymerase (New England Biolabs) previously diluted 40 times in storage buffer [10 mM Tris–HCl (pH 7.4), 100 mM KCl, 1 mM DTT, 0.1 mM EDTA, 0.5% Tween-20 (Sigma), 0.5% IGEPAL CA-630 (Sigma), 50% glycerol] in a total volume of 17 µl of sequencing buffer [50 mM Tris–HCl (pH 9.0) at 25°C, 2 mM MgCl2 ]. .. Sequencing reactions were run in a thermocycler at 95°C for 2 min, then 30 cycles of 95°C for 30 s, 42°C for 30 s and 70°C for 60 s. After completion of the reaction, 3 µl of formamide loading buffer were added, the samples were heated for 2 min at 95°C and 2 µl were loaded on the sequencing gel alongside the toeprinting reactions.


    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: The ACB‐PCR measurement of KRAS G12D and G12V was performed as described previously [Myers et al., ]. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB). .. The PIK3CA E545K ACB‐PCR product is 77 bp in length.

    Size-exclusion Chromatography:

    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O). .. Incubation was followed by exonuclease treatment: 0.5μl exonuclease I (New England Biolabs), 0.5μl exonuclease III (New England Biolabs), 0.2μl 10x ampligase buffer (Illumina), and 0.8μl H2 O was added to the (cooled) capture samples (consecutively incubated at 37°C and 95°C for 45 and 2 min, respectively).

    Article Title: Sensitive PCR-Based Quantitation of Cell-Free Circulating MicroRNAs
    Article Snippet: Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction. .. Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction.

    Polymerase Chain Reaction:

    Article Title: Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
    Article Snippet: This mix was transferred into PCR tubes, and placed in a thermocycler (DNA Engine, Bio-Rad, Hercules, CA, USA) to run the the smMIP phosphorylation program consisting of the following steps: (1) 37 °C for 45 min and (2) 65 °C for 2 min and (3) samples were cooled down to 4 °C ( ). .. The capture master mix ( ) for 30 reactions (450 μl) contained 75 μl 10 × Ampligase DNA ligase buffer (Epicentre/Illumina, Madison, WI, USA), 9.9 μl of the phosphorylated smMIP pool (0.833 μM diluted 1:625), 0.96 μl dNTPs (0.25 mM, diluted from 100 mM, Invitrogen/Thermo Fisher Scientific, Carlsbad, CA, USA), 9.6 μl Hemo Klentaq (10 units μl−1 , New England Biolabs), 0.30 μl Ampligase DNA ligase (100 units μl−1 , Epicentre/Illumina) and 354.3 μl H2 O (added to get to total volume).

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: The initial denaturation step was 5 minutes at 95°C, followed by 40 cycles of 15 seconds at 95°C, 30 seconds at 50°C, 30 seconds at 72°C, and a final extension of 5 minutes at 73°C. .. Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: PCR validation was performed with a 100-nt single-stranded DNA sequence reported previously as Thr-02, using primers AGCAGCACAGAGGTCAGATG and TTCACGGTAGCACGCATAGG. .. Hemo KlenTaq (HKT) polymerase and 5× buffer were obtained from New England Biolabs and used in the manufacturer recommended amount.

    Article Title: Evaluation of Inhibitor-Resistant Real-Time PCR Methods for Diagnostics in Clinical and Environmental Samples
    Article Snippet: Three different PCR buffers designed for amplification in inhibitory samples were used, including PCRboost (Biomatrica, San Diego, CA), STRboost (Biomatrica), and Ampdirect (Rockland Immunochemicals, Gilbertsville, PA). .. Phusion Blood Direct PCR Kit (New England Biolabs, Ipswich, MA), Hemo KlenTaq (New England Biolabs), KAPA Blood PCR Kit (KAPA Biosystems, Woburn, MA), and Omni Klentaq (DNA Polymerase Technology, St. Louis, MO) were all designed for PCR amplification in blood and other inhibitory samples. .. Phire Hot Start DNA Polymerase (New England Biolabs) was an enhanced DNA polymerase, and Terra PCR Direct Polymerase Mix (Clontech, Mountain View, CA) was used for use with tissues and crude samples.

    Article Title: Profiling of the metabolic transcriptome via single molecule molecular inversion probes
    Article Snippet: The capture reaction was performed with 50 ng of cDNA and an estimated 8000-fold molar excess of the phosphorylated smMIP pool in a 25 μL reaction mixture containing Ampligase buffer (Epicentre, Madison, WI, USA), dNTPs, Hemo KlenTaq enzyme (New England Biolabs, NEB, Ipswich, MA, USA) and thermostable DNA ligase (Ampligase, Epicentre). .. The capture reaction was performed with 50 ng of cDNA and an estimated 8000-fold molar excess of the phosphorylated smMIP pool in a 25 μL reaction mixture containing Ampligase buffer (Epicentre, Madison, WI, USA), dNTPs, Hemo KlenTaq enzyme (New England Biolabs, NEB, Ipswich, MA, USA) and thermostable DNA ligase (Ampligase, Epicentre).

    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O). .. Incubation was followed by exonuclease treatment: 0.5μl exonuclease I (New England Biolabs), 0.5μl exonuclease III (New England Biolabs), 0.2μl 10x ampligase buffer (Illumina), and 0.8μl H2 O was added to the (cooled) capture samples (consecutively incubated at 37°C and 95°C for 45 and 2 min, respectively).

    Article Title: Collection of non-meconium stool on fecal occult blood cards is an effective method for fecal microbiota studies in infants
    Article Snippet: If samples failed QC, library preparation was completed again with the “PCR 1” using Hemo KlenTaq® (New England Biolabs, Ipswich, MA) for the PCR reaction. .. The reason this was done is because Hemo KlenTaq® is known to work well with sample containing PCR inhibitors, especially bilirubin which is highly present in meconium samples. .. If a sample failed QC again after the second round of library preparation, it was not sequenced.

    Article Title: Sensitive PCR-Based Quantitation of Cell-Free Circulating MicroRNAs
    Article Snippet: Remove TaqMan MicroRNA Assay kit and cDNA from freezer and thaw on Bath Armor Beads or ice. .. Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction. .. It is recommended to measure each sample/primer combination in triplicate.

    Article Title: The maternal and early embryonic transcriptome of the milkweed bug Oncopeltus fasciatus
    Article Snippet: Reactions were then heat-inactivated for 15 minutes at 70°C and diluted 1:5 in milliQ water in preparation for PCR amplification. .. To maximize yield during cDNA amplification, the first round of amplification was conducted using a 2:2:1 mix (v:v:v) of Hemo KlenTaq (New England Biolabs), Phusion (New England Biolabs), and PfuTurbo (Stratagene) polymerases.

    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: The ACB‐PCR measurement of KRAS G12D and G12V was performed as described previously [Myers et al., ]. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB). .. The PIK3CA E545K ACB‐PCR product is 77 bp in length.


    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB). .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB).

    Real-time Polymerase Chain Reaction:

    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: Hemo KlenTaq (New England BioLabs, Inc., Ipswich, MA) PCR was performed in 25-μL volumes according to the manufacturer's instructions, including attempts to reduce nonspecific priming by assembling PCR reactions on ice and transfer of reactions to the thermocycler preheated to 95°C. .. PCR using cocktails containing GoTaq DNA polymerase and Hemo KlenTaq polymerase were performed using GoTaq qPCR Mastermix (Promega Corp.) for SYBR Green quantitation or TaqMan Universal PCR Mastermix (Applied Biosystems, Inc.).

    Article Title: Evaluation of Inhibitor-Resistant Real-Time PCR Methods for Diagnostics in Clinical and Environmental Samples
    Article Snippet: While these reagents were not designed for real-time PCR, the components are resistant to PCR inhibitors. .. Phusion Blood Direct PCR Kit (New England Biolabs, Ipswich, MA), Hemo KlenTaq (New England Biolabs), KAPA Blood PCR Kit (KAPA Biosystems, Woburn, MA), and Omni Klentaq (DNA Polymerase Technology, St. Louis, MO) were all designed for PCR amplification in blood and other inhibitory samples.

    Article Title: Sensitive PCR-Based Quantitation of Cell-Free Circulating MicroRNAs
    Article Snippet: Paragraph title: 3.5. Quantitative PCR (qPCR) ... Produce a master mix composed of TaqMan 2× Universal PCR MM, no UNG, 10.0 µl; Gibco dH2O 7.07 µl; TaqMan MicroRNA Assay (20×) 1.0 µl, Hemo KlenTaq™ [ ] (New England BioLabs, Ipswich, MA, M0332), 0.6 µl; cDNA 0.19 µl in a total volume of 20 µl per reaction.

    Agarose Gel Electrophoresis:

    Article Title: Profiling of the metabolic transcriptome via single molecule molecular inversion probes
    Article Snippet: The capture reaction was performed with 50 ng of cDNA and an estimated 8000-fold molar excess of the phosphorylated smMIP pool in a 25 μL reaction mixture containing Ampligase buffer (Epicentre, Madison, WI, USA), dNTPs, Hemo KlenTaq enzyme (New England Biolabs, NEB, Ipswich, MA, USA) and thermostable DNA ligase (Ampligase, Epicentre). .. The circularized smMIP library was subjected to standard PCR with 2x iProof High-Fidelity DNA Polymerase master Mix (Bio-Rad, Hercules, CA) with a primer set containing a unique barcoded reverse primer for each sample.


    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation
    Article Snippet: It was observed that Hemo KlenTaq in combination with intact Taq polymerases amplified specific PCR products suitable for qPCR using SYBR Green or TaqMan ( , B and C; see also A at ). .. Of importance, the complementing Taq polymerases produced, on average, approximately 30-fold more amplification products from plasma miR-16 than did the intact polymerase alone (see B at ), which suggests that overcoming blood-borne inhibitors of Taq polymerase using Hemo KlenTaq yields an overall increase in detection sensitivity and specificity of circulating miRNAs. .. To test whether overcoming endogenous inhibitors with complementing polymerases provides proportionally higher miRNA quantitation, we analyzed circulating miRNAs in the blood of six healthy individuals (see at ).

    Concentration Assay:

    Article Title: Transformation of Personal Computers and Mobile Phones into Genetic Diagnostic Systems
    Article Snippet: SYBR Green I was obtained from Life Technologies and used at 0.625× concentration, and EvaGreen was obtained from Biotium and used at 1× concentration. .. Hemo KlenTaq (HKT) polymerase and 5× buffer were obtained from New England Biolabs and used in the manufacturer recommended amount.

    Article Title: The maternal and early embryonic transcriptome of the milkweed bug Oncopeltus fasciatus
    Article Snippet: Reverse transcription reactions using SuperScript II (Invitrogen) in the manufacturer's recommended buffer were performed for 50 minutes at 42°C using twice the recommended concentration of enzyme, 1 μl of Protector RNAse inhibitor (Roche) to avoid RNA degradation, 2 μl 5' primer (12 μM), 2 μl 10 mM DTT, and 1 μl 10 mM dNTPs. .. To maximize yield during cDNA amplification, the first round of amplification was conducted using a 2:2:1 mix (v:v:v) of Hemo KlenTaq (New England Biolabs), Phusion (New England Biolabs), and PfuTurbo (Stratagene) polymerases.

    Article Title: Variation in organ‐specific PIK3CA and KRAS mutant levels in normal human tissues correlates with mutation prevalence in corresponding carcinomas
    Article Snippet: Mutant (either PIK3CA E545K, PIK3CA H1047R, KRAS G12D, or KRAS G12V) and WT reference DNA samples were mixed to generate standards with mutant:WT ratios (i.e., MFs) of 10−1 , 10−2 , 10−3 , 10−4 , 10−5 , and 0 (containing only the WT sequence), at a concentration of 5 × 107 copies/μl for the PIK3CA E545K mutation or 1 × 108 copies/µl for the PIK3CA H1047R mutation. .. For PIK3CA E545K mutation, each 50 µl ACB‐PCR reaction contained: 1× Universal Taq Buffer [New England BioLabs, Inc. (NEB), Beverly, MA), 1.5 mM MgCl2 , 0.1 mg/ml gelatin, 1.0 mg/ml Triton X‐100, 80 µM dNTPs, 400 nM each primer [MSP, 5′‐fluorescein‐TCCTCTCTCTGAAATCACCA‐3′; BP, 5′‐TCCTCTCTCTGAAATCACCdG′3′ (i.e., 3′‐deoxyG modification); and downstream primer, 5′‐CAGAGAATCTCCATTTTAGC‐3′], 3 ng/µl ET SSB (NEB), 2.8 mU/µl Perfect Match PCR Enhancer (Stratagene, La Jolla, CA), and 0.08 µl Hemo KlenTaq DNA polymerase (NEB).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Novel BRCA1 and BRCA2 Tumor Test as Basis for Treatment Decisions and Referral for Genetic Counselling of Patients with Ovarian Carcinomas
    Article Snippet: Targeted sequencing of BRCA1 and BRCA2 using DNA derived from FFPE OCs was performed as previously described [Weren et al., ], using a slightly modified smMIP capture protocol [O'Roak et al., ; Hiatt et al., ]. .. Briefly, smMIP capture was performed on 10μl of input DNA (20–500ng) supplied with 15μl capture mixture (0.01μl ampligase DNA ligase [100U/μl; Illumina, Madison, WI], 2.5μl 10x ampligase buffer [Illumina], 0.27μl smMIP pool dilution [6.6x105 μM], 0.32μl Hemo Klentaq [10U/μl; New England Biolabs], 0.03μl dNTPs [0.25mM], and 11.9μl H2 O).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    New England Biolabs hemo klentaq
    Mutant TaqDNA polymerase, <t>Hemo</t> <t>KlenTaq</t> improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star
    Hemo Klentaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hemo klentaq/product/New England Biolabs
    Average 97 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    hemo klentaq - by Bioz Stars, 2019-10
    97/100 stars
      Buy from Supplier

    Image Search Results

    Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star


    Article Title: Plasma Components Affect Accuracy of Circulating Cancer-Related MicroRNA Quantitation

    doi: 10.1016/j.jmoldx.2011.09.002

    Figure Lengend Snippet: Mutant TaqDNA polymerase, Hemo KlenTaq improves the sensitivity of miRNA detection. A: Hemo KlenTaq (HK) was used to detect miR-16 ( arrows ) in 200, 50, and 10 μL plasma and serum (see C). Additional PCR products are indicated by a star

    Article Snippet: To overcome the limitations of Hemo KlenTaq, we tested whether the reduced proof-reading activity of Hemo KlenTaq could be complemented by an intact Taq polymerase.

    Techniques: Mutagenesis, Polymerase Chain Reaction