glyceraldehyde 3 phosphate dehydrogenase gapdh expression  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Millipore glyceraldehyde 3 phosphate dehydrogenase gapdh expression
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Expression, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh expression/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh expression - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Diagnostic Assay:

    Article Title: Neonatal Androgenization Exacerbates Alcohol-Induced Liver Injury in Adult Rats, an Effect Abrogated by Estrogen
    Article Snippet: For Western blot analyses, antibodies against cytochrome P450 2E1 (CYP2E1), cytochrome P450 1A2 (CYP1A2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Millipore (Billerica, MA). .. For Western blot analyses, antibodies against cytochrome P450 2E1 (CYP2E1), cytochrome P450 1A2 (CYP1A2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Millipore (Billerica, MA).

    Amplification:

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. Following reverse transcription with oligo(dT) primer and Stratascript reverse transcriptase (Stratagene), ERp57 cDNA was amplified by PCR using the following primers: mE57 forward, 5′-CGCGGATCC-GCCATGCGCTTCAGCTGCCTAGC; mE57 reverse, 5′-TTCCTTTTTTGCGGCCGCTTAGAGGTCCTCTTGTGCCTTCTTCTTCTTCTTAGG.

    Stable Transfection:

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse L cells stably expressing the class I molecules, H-2Kb or H-2Dd , were cultured in DMEM supplemented with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    Blocking Assay:

    Article Title: Anti-TNF certolizumab pegol induces antioxidant response in human monocytes via reverse signaling
    Article Snippet: Nrf2 (H300) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), anti-rabbit IgG horse radish peroxidase (HRP)-linked antibodies, Alexa Fluor 488 F(ab’)2 anti-rabbit IgG, tatabox binding protein (TBP) and HO-1 (P249) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ABS16) antibodies were purchased from Millipore (Temecula, CA, USA). .. Blocking antibodies against TNF receptor 1 (TNFR1) (clone #16805) and TNFR2 (clone #22210) were purchased from R & D Systems (Minneapolis, MN, USA).

    Article Title: Tau Reduction Prevents Disease in a Mouse Model of Dravet Syndrome
    Article Snippet: .. After blocking for 1 hour in 5% bovine serum albumin diluted in Tris-buffered saline (BSA-TBS), membranes were incubated overnight at 4°C in anti-Nav 1.1 (1:1,000; Alomone Labs, Jerusalem, Israel), anti–pan-sodium channel (Pan Nav, 1:1,000; Sigma), anti–glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:10,000; Millipore, Billerica, MA), anti-tau clone Tau-5 (1:3,000; Life Technologies), anti-tau clone EP2456Y (1:1,000; Millipore), anti–phospho-tau Ser 396/404 clone PHF-1 (1:3,000, a gift from Dr P. Davies), anti–phospho-tau Thr231 clone CP9 (1:25, a gift from Dr P. Davies), or anti–phospho-PHF-tau pSer202+Thr205 clone AT8 (1:80; Thermo Scientific, Waltham, MA). ..

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: .. After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20. .. The membranes were then incubated with peroxidase-labeled secondary antibody diluted 1∶10000 in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20 for 1 h at room temperature.

    Electrophoresis:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Western Blot Preparation of tissue lysates and electrophoresis were carried out with caution to minimize the effect of temperature on protein degradation. .. Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: After electrophoresis, the samples were electrotransferred onto polyvinylidene difluoride membranes (Immobilon-P, Millipore). .. After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20.

    Incubation:

    Article Title: Sphingosine-1-Phosphate Prevents Egress of Hematopoietic Stem Cells From Liver to Reduce Fibrosis
    Article Snippet: .. The primary antibody was either anti-SphK1 (1:500; Abcam) or anti–glyceraldehyde-3-phosphate dehydrogenase (1:2000; Sigma) incubated overnight and horseradish-peroxidase–conjugated goat anti-rabbit IgG antibody (1:10,000; Sigma) secondary antibody incubated for 30 minutes. .. Pierce chemiluminescent peroxidase substrate and Hyperfilm ECL were used to visualize protein expression.

    Article Title: Tau Reduction Prevents Disease in a Mouse Model of Dravet Syndrome
    Article Snippet: .. After blocking for 1 hour in 5% bovine serum albumin diluted in Tris-buffered saline (BSA-TBS), membranes were incubated overnight at 4°C in anti-Nav 1.1 (1:1,000; Alomone Labs, Jerusalem, Israel), anti–pan-sodium channel (Pan Nav, 1:1,000; Sigma), anti–glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:10,000; Millipore, Billerica, MA), anti-tau clone Tau-5 (1:3,000; Life Technologies), anti-tau clone EP2456Y (1:1,000; Millipore), anti–phospho-tau Ser 396/404 clone PHF-1 (1:3,000, a gift from Dr P. Davies), anti–phospho-tau Thr231 clone CP9 (1:25, a gift from Dr P. Davies), or anti–phospho-PHF-tau pSer202+Thr205 clone AT8 (1:80; Thermo Scientific, Waltham, MA). ..

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: .. After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20. .. The membranes were then incubated with peroxidase-labeled secondary antibody diluted 1∶10000 in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20 for 1 h at room temperature.

    Expressing:

    Article Title: Sphingosine-1-Phosphate Prevents Egress of Hematopoietic Stem Cells From Liver to Reduce Fibrosis
    Article Snippet: The primary antibody was either anti-SphK1 (1:500; Abcam) or anti–glyceraldehyde-3-phosphate dehydrogenase (1:2000; Sigma) incubated overnight and horseradish-peroxidase–conjugated goat anti-rabbit IgG antibody (1:10,000; Sigma) secondary antibody incubated for 30 minutes. .. Pierce chemiluminescent peroxidase substrate and Hyperfilm ECL were used to visualize protein expression.

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse L cells stably expressing the class I molecules, H-2Kb or H-2Dd , were cultured in DMEM supplemented with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    BIA-KA:

    Article Title: Neonatal Androgenization Exacerbates Alcohol-Induced Liver Injury in Adult Rats, an Effect Abrogated by Estrogen
    Article Snippet: A BCA kit to measure protein concentrations was purchased from Pierce Biotechnology, Inc (Santa Cruz, CA) and 540 nm absorbance was measured on a BioTek Synergy HT Multi-Detection Microplate Reader (BioTek Instruments, Winooski, VT) using Gen5 Analysis Software. .. For Western blot analyses, antibodies against cytochrome P450 2E1 (CYP2E1), cytochrome P450 1A2 (CYP1A2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Millipore (Billerica, MA).

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: The protein concentration in each sample was measured using the BCA protein assay kit (Pierce). .. After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20.

    Western Blot:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Paragraph title: Western Blot ... Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Total protein extracts were prepared ( ) from postnatal day 1 skeletal muscle and separated on a 3–8% NuPAGE Tris-acetate gel (Invitrogen) and subjected to Western blot analysis using polyclonal antibodies against nebulin domain M161–165 (1:50; provided by S. Labeit, Universitätsklinikum Mannheim, Mannheim, Germany) according to the manufacturer's instructions. .. Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Article Title: Neonatal Androgenization Exacerbates Alcohol-Induced Liver Injury in Adult Rats, an Effect Abrogated by Estrogen
    Article Snippet: .. For Western blot analyses, antibodies against cytochrome P450 2E1 (CYP2E1), cytochrome P450 1A2 (CYP1A2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Millipore (Billerica, MA). .. Antibody against 4-Hydroxynonenal (4-HNE) was purchased from Alpha Diagnostic Intl (San Antonio, TX).

    Article Title: Sphingosine-1-Phosphate Prevents Egress of Hematopoietic Stem Cells From Liver to Reduce Fibrosis
    Article Snippet: Paragraph title: Western Blot ... The primary antibody was either anti-SphK1 (1:500; Abcam) or anti–glyceraldehyde-3-phosphate dehydrogenase (1:2000; Sigma) incubated overnight and horseradish-peroxidase–conjugated goat anti-rabbit IgG antibody (1:10,000; Sigma) secondary antibody incubated for 30 minutes.

    Article Title: Tau Reduction Prevents Disease in a Mouse Model of Dravet Syndrome
    Article Snippet: Paragraph title: Western Blotting ... After blocking for 1 hour in 5% bovine serum albumin diluted in Tris-buffered saline (BSA-TBS), membranes were incubated overnight at 4°C in anti-Nav 1.1 (1:1,000; Alomone Labs, Jerusalem, Israel), anti–pan-sodium channel (Pan Nav, 1:1,000; Sigma), anti–glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:10,000; Millipore, Billerica, MA), anti-tau clone Tau-5 (1:3,000; Life Technologies), anti-tau clone EP2456Y (1:1,000; Millipore), anti–phospho-tau Ser 396/404 clone PHF-1 (1:3,000, a gift from Dr P. Davies), anti–phospho-tau Thr231 clone CP9 (1:25, a gift from Dr P. Davies), or anti–phospho-PHF-tau pSer202+Thr205 clone AT8 (1:80; Thermo Scientific, Waltham, MA).

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: Paragraph title: Western Blot ... After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20.

    Transfection:

    Article Title: Direct Interaction between SET8 and Proliferating Cell Nuclear Antigen Couples H4-K20 Methylation with DNA Replication *
    Article Snippet: Horseradish peroxidase-conjugated GST was from Santa Cruz Biotechnology Inc. Anti-PCNA (PC10) and anti-glyceraldehyde-3-phosphate dehydrogenase antibodies were from Chemicon. .. Cell Culture and Transfection —HeLa and 293T cells were cultured in RPMI 1640 medium supplemented with 5% fetal calf serum, 5% bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin and maintained in 5% CO2 at 37 °C.

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Wild type (K41) and Crt knock-out (K42) mouse embryonic fibroblasts ( ) as well as K42 cells transfected with various mutant Crt constructs were maintained in RPMI 1640 medium with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    Cell Culture:

    Article Title: Direct Interaction between SET8 and Proliferating Cell Nuclear Antigen Couples H4-K20 Methylation with DNA Replication *
    Article Snippet: Horseradish peroxidase-conjugated GST was from Santa Cruz Biotechnology Inc. Anti-PCNA (PC10) and anti-glyceraldehyde-3-phosphate dehydrogenase antibodies were from Chemicon. .. Cell Culture and Transfection —HeLa and 293T cells were cultured in RPMI 1640 medium supplemented with 5% fetal calf serum, 5% bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin and maintained in 5% CO2 at 37 °C.

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse L cells stably expressing the class I molecules, H-2Kb or H-2Dd , were cultured in DMEM supplemented with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: Reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA was isolated from the kidney-derived cultured stem cells using an RNeasy Mini Kit (Qiagen, Hilden, Germany) following the standard manufacturer protocol, and stored at −70°C. .. PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction (RT-PCR) analysis ... PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich).

    Protein Concentration:

    Article Title: Matrix Metalloproteinases Regulate the Formation of Dendritic Spine Head Protrusions during Chemically Induced Long-Term Potentiation
    Article Snippet: The protein concentration in each sample was measured using the BCA protein assay kit (Pierce). .. After blocking, the membranes were incubated at 4°C overnight with anti-β-dystroglycan (NCL-b-DG, 1∶500, Novocastra) and anti-glyceraldehyde-3-phosphate-dehydrogenase (GAPDH; MAB 374, 1∶2000, Chemicon) diluted in 10% nonfat milk in Tris-buffered saline with 0.1% Tween 20.

    Polymerase Chain Reaction:

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Offspring from intercrosses were genotyped by PCR analysis using mouse tail DNA and wild-type (forward, ATGGCATATGGAAAGTTTGTAGGT; reverse, AACATGAAACATGCCTTCTTTGTA) and mutant allele-specific primers (forward, GTTCGCAAGAACCTGATGCACA; reverse, CTAGAGCCTGTTTTGCACGTTC). .. Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. Following reverse transcription with oligo(dT) primer and Stratascript reverse transcriptase (Stratagene), ERp57 cDNA was amplified by PCR using the following primers: mE57 forward, 5′-CGCGGATCC-GCCATGCGCTTCAGCTGCCTAGC; mE57 reverse, 5′-TTCCTTTTTTGCGGCCGCTTAGAGGTCCTCTTGTGCCTTCTTCTTCTTCTTAGG.

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: .. PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich). .. PCR cycles were run under standard conditions in the T100™ Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. PCR products were resolved in 2% agarose gel containing ethidium bromide (both Sigma-Aldrich), and were then observed and documented using a gel documentation unit (Gel Doc™ EZ System; Bio-Rad Laboratories, Inc.).

    Sonication:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Neocortex from the middle temporal gyrus of the frozen human cerebral hemispheres and frontal cortex from frozen mouse brains were sampled in the chamber of cryostat, then homogenized on ice by sonication in T-PER extraction buffer (Pierce, Rockford, IL, USA) containing protease inhibitors (Roche, Indianapolis, IN, USA). .. Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Binding Assay:

    Article Title: Anti-TNF certolizumab pegol induces antioxidant response in human monocytes via reverse signaling
    Article Snippet: .. Nrf2 (H300) antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), anti-rabbit IgG horse radish peroxidase (HRP)-linked antibodies, Alexa Fluor 488 F(ab’)2 anti-rabbit IgG, tatabox binding protein (TBP) and HO-1 (P249) antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (ABS16) antibodies were purchased from Millipore (Temecula, CA, USA). .. Blocking antibodies against TNF receptor 1 (TNFR1) (clone #16805) and TNFR2 (clone #22210) were purchased from R & D Systems (Minneapolis, MN, USA).

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. With this plasmid as template, the QuikChange II™ site-directed mutagenesis kit (Stratagene) was used to mutate ERp57 residues involved in Cnx or Crt binding and also residues in the -CGHC-active sites.

    Nucleic Acid Electrophoresis:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Extracts containing equal amount of total protein were run in SDS-polyacrylamide gel electrophoresis (PAGE) gels (protein loading and SDS concentration to be detailed along with result description). .. Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Mutagenesis:

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Offspring from intercrosses were genotyped by PCR analysis using mouse tail DNA and wild-type (forward, ATGGCATATGGAAAGTTTGTAGGT; reverse, AACATGAAACATGCCTTCTTTGTA) and mutant allele-specific primers (forward, GTTCGCAAGAACCTGATGCACA; reverse, CTAGAGCCTGTTTTGCACGTTC). .. Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. Following reverse transcription with oligo(dT) primer and Stratascript reverse transcriptase (Stratagene), ERp57 cDNA was amplified by PCR using the following primers: mE57 forward, 5′-CGCGGATCC-GCCATGCGCTTCAGCTGCCTAGC; mE57 reverse, 5′-TTCCTTTTTTGCGGCCGCTTAGAGGTCCTCTTGTGCCTTCTTCTTCTTCTTAGG.

    Isolation:

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. Following reverse transcription with oligo(dT) primer and Stratascript reverse transcriptase (Stratagene), ERp57 cDNA was amplified by PCR using the following primers: mE57 forward, 5′-CGCGGATCC-GCCATGCGCTTCAGCTGCCTAGC; mE57 reverse, 5′-TTCCTTTTTTGCGGCCGCTTAGAGGTCCTCTTGTGCCTTCTTCTTCTTCTTAGG.

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: Reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA was isolated from the kidney-derived cultured stem cells using an RNeasy Mini Kit (Qiagen, Hilden, Germany) following the standard manufacturer protocol, and stored at −70°C. .. PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich).

    Size-exclusion Chromatography:

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich). .. PCR cycles were run under standard conditions in the T100™ Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. PCR products were resolved in 2% agarose gel containing ethidium bromide (both Sigma-Aldrich), and were then observed and documented using a gel documentation unit (Gel Doc™ EZ System; Bio-Rad Laboratories, Inc.).

    Mouse Assay:

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Paragraph title: Generation and genotyping of mice ... Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Transgenic Assay:

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Generation and genotyping of mice One independent homologous recombinant ES clone was microinjected into blastocysts from C57/B6 mice at the Transgenic Core Facility at the University of California, San Diego. .. Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Construct:

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Wild type (K41) and Crt knock-out (K42) mouse embryonic fibroblasts ( ) as well as K42 cells transfected with various mutant Crt constructs were maintained in RPMI 1640 medium with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Extracts containing equal amount of total protein were run in SDS-polyacrylamide gel electrophoresis (PAGE) gels (protein loading and SDS concentration to be detailed along with result description). .. Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Purification:

    Article Title: Synergistic apoptotic response between valproic acid and fludarabine in chronic lymphocytic leukaemia (CLL) cells involves the lysosomal protease cathepsin B
    Article Snippet: Antibodies against glyceraldehyde 3-phosphate dehydrogenase and tubulin were from Sigma (St Louis, MO, USA). .. Purified cathepsin B was purchased from Abcam.

    Plasmid Preparation:

    Article Title: Direct Interaction between SET8 and Proliferating Cell Nuclear Antigen Couples H4-K20 Methylation with DNA Replication *
    Article Snippet: Horseradish peroxidase-conjugated GST was from Santa Cruz Biotechnology Inc. Anti-PCNA (PC10) and anti-glyceraldehyde-3-phosphate dehydrogenase antibodies were from Chemicon. .. Construction of set8 and Its Mutants —The set8 cDNA was obtained from American Type Culture Collection and subcloned into the entry vector pDONR201 (Gateway Technology).

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). .. The resulting cDNA was inserted into the pcDNA 3.1/Hygro(+) vector (Invitrogen).

    Software:

    Article Title: Neonatal Androgenization Exacerbates Alcohol-Induced Liver Injury in Adult Rats, an Effect Abrogated by Estrogen
    Article Snippet: A BCA kit to measure protein concentrations was purchased from Pierce Biotechnology, Inc (Santa Cruz, CA) and 540 nm absorbance was measured on a BioTek Synergy HT Multi-Detection Microplate Reader (BioTek Instruments, Winooski, VT) using Gen5 Analysis Software. .. For Western blot analyses, antibodies against cytochrome P450 2E1 (CYP2E1), cytochrome P450 1A2 (CYP1A2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were purchased from Millipore (Billerica, MA).

    Recombinant:

    Article Title: Nebulin-deficient mice exhibit shorter thin filament lengths and reduced contractile function in skeletal muscle
    Article Snippet: Generation and genotyping of mice One independent homologous recombinant ES clone was microinjected into blastocysts from C57/B6 mice at the Transgenic Core Facility at the University of California, San Diego. .. Glyceraldehyde-3-phosphate dehydrogenase antibodies were used for normalization (1:1,000; Sigma-Aldrich).

    Agarose Gel Electrophoresis:

    Article Title: Identification and isolation of kidney-derived stem cells from transgenic rats with diphtheria toxin-induced kidney damage
    Article Snippet: PCR was performed on 1 µl cDNA using the following primers: Oct-4, forward 5′-CTGTAACCGGCGCCAGAA-3′ and reverse 5′-TGCATGGGAGAGCCCAGA-3′ (Sigma-Aldrich); Pax-2, the SABiosciences RT2 PCR primer set (LOC293992; Qiagen Sciences, LLC); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), forward 5′-TGGAGAGGCCTGCCAAGTA-3′ and reverse 5′-AAGAGTGGGAGTTGCTGTTG-3′ (Sigma-Aldrich). .. PCR cycles were run under standard conditions in the T100™ Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and were as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. PCR products were resolved in 2% agarose gel containing ethidium bromide (both Sigma-Aldrich), and were then observed and documented using a gel documentation unit (Gel Doc™ EZ System; Bio-Rad Laboratories, Inc.).

    In Situ:

    Article Title: A Critical Role for Ceramide Synthase 2 in Liver Homeostasis
    Article Snippet: An anti-p21WAF1/CIP1 antibody was from Santa Cruz Biotechnology; anti-actin was from MP Biomedicals; anti-α-tubulin was from Sigma; and anti-glyceraldehyde-3-phosphate dehydrogenase was from Millipore. .. The ApopTag Red in situ apoptosis detection kit was from Chemicon International (Temecula, CA).

    Knock-Out:

    Article Title: ERp57 Does Not Require Interactions with Calnexin and Calreticulin to Promote Assembly of Class I Histocompatibility Molecules, and It Enhances Peptide Loading Independently of Its Redox Activity
    Article Snippet: Wild type (K41) and Crt knock-out (K42) mouse embryonic fibroblasts ( ) as well as K42 cells transfected with various mutant Crt constructs were maintained in RPMI 1640 medium with fetal bovine serum, glutamine, and antibiotics. .. Mouse anti-Crt mAb (SPA-601) and rabbit anti-PDI polyclonal antibody (SPA-890) were purchased from Assay Designs (Ann Arbor, MI), and mAb directed against glyceraldehyde 3-phosphate dehydrogenase was purchased from Millipore Corp. (Bedford, MA) (MAB374). cDNA Isolation and Mutagenesis —RNA was isolated from mouse C2C12 myoblast cells using the TRIzol reagent according to the manufacturer's protocol (Invitrogen).

    Concentration Assay:

    Article Title: Sortilin Fragments Deposit at Senile Plaques in Human Cerebrum
    Article Snippet: Extracts containing equal amount of total protein were run in SDS-polyacrylamide gel electrophoresis (PAGE) gels (protein loading and SDS concentration to be detailed along with result description). .. Separated protein products were electrotransferred to Trans-Blot pure nitrocellulose membranes, which were immunoblotted with the aforementioned antibodies (rabbit and goat anti-sortilin diluted at 1:2000, 6E10 at 1:4000, BACE1 at 1:2000 and phosphorylated tau at 1:2000; Cai et al., ), and that for loading controls including β-tubulin-III (1:5000, Millipore), β-actin (1:5000, Millipore) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; 1:5000, Millipore).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore glyceraldehyde 3 phosphate dehydrogenase gapdh expression
    Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Expression, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh expression/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    glyceraldehyde 3 phosphate dehydrogenase gapdh expression - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results