Structured Review

BioGenes GmbH geneclean iii kit
Geneclean Iii Kit, supplied by BioGenes GmbH, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/geneclean iii kit/product/BioGenes GmbH
Average 86 stars, based on 1 article reviews
Price from $9.99 to $1999.99
geneclean iii kit - by Bioz Stars, 2020-04
86/100 stars

Images

Related Articles

Amplification:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ).

Agarose Gel Electrophoresis:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ). .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

Ligation:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ).

Purification:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ). .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

Polymerase Chain Reaction:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ). .. Purified fragments were sequenced with primer U5 SIV LTRs 1 by Geneart (Regensburg, Germany) using standard procedures.

Nested PCR:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: A nested PCR was performed with the outer primers “adapter 1 G” (5′ GTAATACGACTCACTATAGGGC 3′) and “U5 SIV LTRs 0” (5′ CTGGTCAACTCGGTACTCAATA 3′) under the following conditions: 300 nM primer, 2 mM MgCl2 , 200 μM of each deoxynucleoside triphosphate, and 1 U Platinium Taq DNA polymerase (Invitrogen) in 1× PCR buffer. .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ).

Plasmid Preparation:

Article Title: Viral Determinants of Integration Site Preferences of Simian Immunodeficiency Virus-Based Vectors
Article Snippet: KpnI digestion of the ligation reaction was used to avoid amplification of an internal vector fragment by ligation-mediated (LM)-PCR. .. Cycling conditions were as follows: 95°C for 2 min; 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min; and 1 cycle at 72°C for 10 min. PCR products were separated by agarose gel electrophoresis, and the DNA bands were excised and the DNA purified with a BioGene Geneclean III kit or the freeze-and-squeeze method ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    BioGenes GmbH geneclean iii kit
    Geneclean Iii Kit, supplied by BioGenes GmbH, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneclean iii kit/product/BioGenes GmbH
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    geneclean iii kit - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results