genechip wt plus reagent kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    GeneChip WT PLUS Reagent Kit
    Description:
    Gene transcripts profiling using GeneChip trade WT arrays is a well proven technique for expression research and biomarker discovery GeneChip WT PLUS Reagent Kit WT PLUS Kit with its high sensitivity and specificity offers a robust WT assay to unravel the transcription signatures in your samples at both gene and exon levels WT PLUS Kit uses a reverse transcription priming method that primes the entire length of each RNA transcript including both poly A and non poly A mRNA to provide complete and unbiased coverage of the transcriptome The kit efficiently generates amplified and biotinylated sense stranded DNA targets avoiding loss of specificity due to antisense strand interference The kit includes the amplification module coupled with the GeneChip WT Terminal Labeling and Controls Kit for preparing hybridization ready targets from 50 ng to 500 ng of total RNA Features and benefits • A complete target prep kit with proven sensitivity and specificity resulting from an optimized design for WT arrays • A low sample input requirement of 50 ng The kit works with a variety of sample types including fresh frozen tissues cell lines and whole blood • StreamLined workflow with no ribosomal RNA depletion requirement or a globin reduction step for blood samples • Opportunities to bundle WT arrays with WT reagents offering exceptional cost savings • Convenient single source for ordering and support Related LinksGeneChip HT WT PLUS Reagent KitHT WT PLUS Consumables for Biomek FXP Target Prep Express
    Catalog Number:
    902280
    Price:
    None
    Applications:
    DNA & RNA Microarray Analysis|Microarray Analysis
    Category:
    Microarrays PCR Arrays
    Buy from Supplier


    Structured Review

    Thermo Fisher genechip wt plus reagent kit
    Gene transcripts profiling using GeneChip trade WT arrays is a well proven technique for expression research and biomarker discovery GeneChip WT PLUS Reagent Kit WT PLUS Kit with its high sensitivity and specificity offers a robust WT assay to unravel the transcription signatures in your samples at both gene and exon levels WT PLUS Kit uses a reverse transcription priming method that primes the entire length of each RNA transcript including both poly A and non poly A mRNA to provide complete and unbiased coverage of the transcriptome The kit efficiently generates amplified and biotinylated sense stranded DNA targets avoiding loss of specificity due to antisense strand interference The kit includes the amplification module coupled with the GeneChip WT Terminal Labeling and Controls Kit for preparing hybridization ready targets from 50 ng to 500 ng of total RNA Features and benefits • A complete target prep kit with proven sensitivity and specificity resulting from an optimized design for WT arrays • A low sample input requirement of 50 ng The kit works with a variety of sample types including fresh frozen tissues cell lines and whole blood • StreamLined workflow with no ribosomal RNA depletion requirement or a globin reduction step for blood samples • Opportunities to bundle WT arrays with WT reagents offering exceptional cost savings • Convenient single source for ordering and support Related LinksGeneChip HT WT PLUS Reagent KitHT WT PLUS Consumables for Biomek FXP Target Prep Express
    https://www.bioz.com/result/genechip wt plus reagent kit/product/Thermo Fisher
    Average 99 stars, based on 164 article reviews
    Price from $9.99 to $1999.99
    genechip wt plus reagent kit - by Bioz Stars, 2021-01
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Identification of mTOR inhibitor-resistant genes in cutaneous squamous cell carcinoma
    Article Snippet: .. Briefly, cDNA was synthesized using the GeneChip WT (Whole Transcript) Amplification kit (Thermo Fisher Scientific) as described by the manufacturer. .. The sense cDNA was then fragmented and biotin labeled with TdT using the GeneChip WT Terminal Labeling Kit (Thermo Fisher Scientific).

    In Vitro:

    Article Title: Multiple Roles of Integrin-Linked Kinase in Epidermal Development, Maturation and Pigmentation Revealed by Molecular Profiling
    Article Snippet: .. For probe preparation, cDNA synthesis and in vitro transcription from 5 µg total RNA were done with an Ambion WT Expression Kit for Affimetrix GeneChip Whole Transcript WT Expression Arrays (Ambion, Foster City, CA), as per manufacturer's protocols. .. Microarray hybridization and bioinformatics analyses Probes corresponding to RNA samples isolated from five diferent K14Cre; Ilkf/f and five K14Cre; Ilkf/+ mice were used to hybridize a total of ten GeneChip Mouse Gene 1.0 ST Arrays (Affymetrix, Foster City, CA).

    Synthesized:

    Article Title: Identification of mTOR inhibitor-resistant genes in cutaneous squamous cell carcinoma
    Article Snippet: .. Briefly, cDNA was synthesized using the GeneChip WT (Whole Transcript) Amplification kit (Thermo Fisher Scientific) as described by the manufacturer. .. The sense cDNA was then fragmented and biotin labeled with TdT using the GeneChip WT Terminal Labeling Kit (Thermo Fisher Scientific).

    Isolation:

    Article Title: Myeloid Cell Hypoxia-Inducible Factors Promote Resolution of Inflammation in Experimental Colitis
    Article Snippet: .. For macrophages isolated from colon, due to limited amount of mRNA, anti-sense RNA (cRNA) generated in preparation for microarray analysis using GeneChip WT PLUS Reagent Kit (Affymetrix) was used to generate cDNA. .. PCR reactions were performed in a ViiA7 Real-Time PCR system using Sybr Green PCR Master Mix (Invitrogen, Carlsbad, CA) with following primers: mouse Alox15 (Forward 5′ to 3′: GGCTCCAACAACGAGGTCTAC; Reverse 5′ to 3′: AGGTATTCTGACACATCCACCTT), mouse Saa1 (Forward 5′ to 3′: ACACCAGGATGAAGCTACTCACCA; Reverse 5′ to 3′: CCCTTGGAAAGCCTCGTGAACAAA), mouse Saa2 (Forward 5′ to 3″: TGGCTGGAAAGATGGAGACAA; Reverse 5′ to 3′: AAAGCTCTCTCTTGCATCACTG), mouse Saa3 (Forward 5′ to 3″: TGCCATCATTCTTTGCATCTTGA; Reverse 5′ to 3″: CCGTGAACTTCTGAACAGCCT), mouse Ptges1 (Forward 5′ to 3′: GGATGCGCTGAAACGTGGA; Reverse 5′ to 3′: CAGGAATGAGTACACGAAGCC), mouse Ptges2 (Forward 5′ to 3′: AAGGCCATGAATGACCAGGG; Reverse 5′ to 3′: TGTTCGGTACACGTTGGGAG), and mouse Ptgs2 (Forward 5′ to 3′: TTCAACACACTCTATCACTGGC; Reverse 5′ to 3′: AGAAGCGTTTGCGGTACTCAT).

    Labeling:

    Article Title: The Human Placental Sexome Differs between Trophoblast Epithelium and Villous Vessel Endothelium
    Article Snippet: .. Array hybridization and scanning and data pre-processing methods Total RNA was labeled using Ambion WT Expression Kit for Affymetrix GeneChip Whole transcript (WT) Expression Arrays (Life Technologies; Carlsbad, CA, USA). .. Hybridization of all samples to GeneChip Human 1.0 ST arrays was performed according to the manufacturer's instructions (Affymetrix, Santa Clara, CA, USA).

    Article Title: Myeloid Cell Hypoxia-Inducible Factors Promote Resolution of Inflammation in Experimental Colitis
    Article Snippet: .. The cDNA was prepared, labeled, and hybridized to Affymetrix GeneChip, mouse gene 2.0 using GeneChip WT PLUS Reagent Kit (Affymetrix, Santa Clara, CA). .. Hybridized chips were scanned with GeneChip™ Scanner 3000 7G (Affymetrix).

    Microarray:

    Article Title: Myeloid Cell Hypoxia-Inducible Factors Promote Resolution of Inflammation in Experimental Colitis
    Article Snippet: .. For macrophages isolated from colon, due to limited amount of mRNA, anti-sense RNA (cRNA) generated in preparation for microarray analysis using GeneChip WT PLUS Reagent Kit (Affymetrix) was used to generate cDNA. .. PCR reactions were performed in a ViiA7 Real-Time PCR system using Sybr Green PCR Master Mix (Invitrogen, Carlsbad, CA) with following primers: mouse Alox15 (Forward 5′ to 3′: GGCTCCAACAACGAGGTCTAC; Reverse 5′ to 3′: AGGTATTCTGACACATCCACCTT), mouse Saa1 (Forward 5′ to 3′: ACACCAGGATGAAGCTACTCACCA; Reverse 5′ to 3′: CCCTTGGAAAGCCTCGTGAACAAA), mouse Saa2 (Forward 5′ to 3″: TGGCTGGAAAGATGGAGACAA; Reverse 5′ to 3′: AAAGCTCTCTCTTGCATCACTG), mouse Saa3 (Forward 5′ to 3″: TGCCATCATTCTTTGCATCTTGA; Reverse 5′ to 3″: CCGTGAACTTCTGAACAGCCT), mouse Ptges1 (Forward 5′ to 3′: GGATGCGCTGAAACGTGGA; Reverse 5′ to 3′: CAGGAATGAGTACACGAAGCC), mouse Ptges2 (Forward 5′ to 3′: AAGGCCATGAATGACCAGGG; Reverse 5′ to 3′: TGTTCGGTACACGTTGGGAG), and mouse Ptgs2 (Forward 5′ to 3′: TTCAACACACTCTATCACTGGC; Reverse 5′ to 3′: AGAAGCGTTTGCGGTACTCAT).

    Article Title: Chicken interferome: avian interferon-stimulated genes identified by microarray and RNA-seq of primary chick embryo fibroblasts treated with a chicken type I interferon (IFN-α)
    Article Snippet: .. RNA samples were processed for microarray with the GeneChip® Chicken Genome Array (Affymetrix) using the GeneChip® 3′ IVT Express Kit (Affymetrix) or for microarray with the Chicken Gene 1.0 ST Array (Affymetrix) using the Ambion (Paisley, UK) WT Expression Kit for Affymetrix GeneChip® Whole Transcript (WT) Expression Arrays (Ambion) and the GeneChip WT Terminal Labelling and Controls Kit (Ambion), following the manufacturers’ instructions, as described previously [ ]. .. Total RNA (100 ng) was used as input and quality checks were performed using the 2100 Bioanalyzer at all stages suggested by the manufacturer.

    Generated:

    Article Title: Myeloid Cell Hypoxia-Inducible Factors Promote Resolution of Inflammation in Experimental Colitis
    Article Snippet: .. For macrophages isolated from colon, due to limited amount of mRNA, anti-sense RNA (cRNA) generated in preparation for microarray analysis using GeneChip WT PLUS Reagent Kit (Affymetrix) was used to generate cDNA. .. PCR reactions were performed in a ViiA7 Real-Time PCR system using Sybr Green PCR Master Mix (Invitrogen, Carlsbad, CA) with following primers: mouse Alox15 (Forward 5′ to 3′: GGCTCCAACAACGAGGTCTAC; Reverse 5′ to 3′: AGGTATTCTGACACATCCACCTT), mouse Saa1 (Forward 5′ to 3′: ACACCAGGATGAAGCTACTCACCA; Reverse 5′ to 3′: CCCTTGGAAAGCCTCGTGAACAAA), mouse Saa2 (Forward 5′ to 3″: TGGCTGGAAAGATGGAGACAA; Reverse 5′ to 3′: AAAGCTCTCTCTTGCATCACTG), mouse Saa3 (Forward 5′ to 3″: TGCCATCATTCTTTGCATCTTGA; Reverse 5′ to 3″: CCGTGAACTTCTGAACAGCCT), mouse Ptges1 (Forward 5′ to 3′: GGATGCGCTGAAACGTGGA; Reverse 5′ to 3′: CAGGAATGAGTACACGAAGCC), mouse Ptges2 (Forward 5′ to 3′: AAGGCCATGAATGACCAGGG; Reverse 5′ to 3′: TGTTCGGTACACGTTGGGAG), and mouse Ptgs2 (Forward 5′ to 3′: TTCAACACACTCTATCACTGGC; Reverse 5′ to 3′: AGAAGCGTTTGCGGTACTCAT).

    Expressing:

    Article Title: The Human Placental Sexome Differs between Trophoblast Epithelium and Villous Vessel Endothelium
    Article Snippet: .. Array hybridization and scanning and data pre-processing methods Total RNA was labeled using Ambion WT Expression Kit for Affymetrix GeneChip Whole transcript (WT) Expression Arrays (Life Technologies; Carlsbad, CA, USA). .. Hybridization of all samples to GeneChip Human 1.0 ST arrays was performed according to the manufacturer's instructions (Affymetrix, Santa Clara, CA, USA).

    Article Title: Multiple Roles of Integrin-Linked Kinase in Epidermal Development, Maturation and Pigmentation Revealed by Molecular Profiling
    Article Snippet: .. For probe preparation, cDNA synthesis and in vitro transcription from 5 µg total RNA were done with an Ambion WT Expression Kit for Affimetrix GeneChip Whole Transcript WT Expression Arrays (Ambion, Foster City, CA), as per manufacturer's protocols. .. Microarray hybridization and bioinformatics analyses Probes corresponding to RNA samples isolated from five diferent K14Cre; Ilkf/f and five K14Cre; Ilkf/+ mice were used to hybridize a total of ten GeneChip Mouse Gene 1.0 ST Arrays (Affymetrix, Foster City, CA).

    Article Title: Chicken interferome: avian interferon-stimulated genes identified by microarray and RNA-seq of primary chick embryo fibroblasts treated with a chicken type I interferon (IFN-α)
    Article Snippet: .. RNA samples were processed for microarray with the GeneChip® Chicken Genome Array (Affymetrix) using the GeneChip® 3′ IVT Express Kit (Affymetrix) or for microarray with the Chicken Gene 1.0 ST Array (Affymetrix) using the Ambion (Paisley, UK) WT Expression Kit for Affymetrix GeneChip® Whole Transcript (WT) Expression Arrays (Ambion) and the GeneChip WT Terminal Labelling and Controls Kit (Ambion), following the manufacturers’ instructions, as described previously [ ]. .. Total RNA (100 ng) was used as input and quality checks were performed using the 2100 Bioanalyzer at all stages suggested by the manufacturer.

    Hybridization:

    Article Title: The Human Placental Sexome Differs between Trophoblast Epithelium and Villous Vessel Endothelium
    Article Snippet: .. Array hybridization and scanning and data pre-processing methods Total RNA was labeled using Ambion WT Expression Kit for Affymetrix GeneChip Whole transcript (WT) Expression Arrays (Life Technologies; Carlsbad, CA, USA). .. Hybridization of all samples to GeneChip Human 1.0 ST arrays was performed according to the manufacturer's instructions (Affymetrix, Santa Clara, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher genechip wt
    Genechip Wt, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 165 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genechip wt/product/Thermo Fisher
    Average 99 stars, based on 165 article reviews
    Price from $9.99 to $1999.99
    genechip wt - by Bioz Stars, 2021-01
    99/100 stars
      Buy from Supplier

    Image Search Results