geneamp xl long range pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    Extensor Long Range PCR Polymerase Blend Kits and Master Mixes
    Description:

    Catalog Number:
    AB-0792/B
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher geneamp xl long range pcr kit

    https://www.bioz.com/result/geneamp xl long range pcr kit/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    geneamp xl long range pcr kit - by Bioz Stars, 2021-06
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Transcription of the three HMG-CoA reductase genes of Mucor circinelloides
    Article Snippet: DNA was isolated using the MasterPure Yeast DNA Purification Kit (Epicentre), while RNA was purified using the E.Z.N.A Total RNA Kit II (Omega Bio-Tek). .. The genes were amplified by PCR using the Long PCR Kit (Thermo Scientific) and cloned into pBluescript II SK (Stratagene). .. Sequence analysis of the putative HmgR proteins Programs used to analyse the amino acid sequences of the putative HmgR proteins were accessed through the Swiss Expasy Server ( http://www.expasy.ch ).

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: Identification of a t(3;4)(p1.3;q1.5) translocation breakpoint in pigs using somatic cell hybrid mapping and high-resolution mate-pair sequencing
    Article Snippet: Primers were selected using Primer3 software, and PCR conditions were determined for each STS ( ). .. Sequencing of the t(3;4) breakpoint Junction fragments across the t(3;4) breakpoint were amplified by long-range PCR using the GeneAmp ® XL PCR Kit (Life Technologies). .. Products from these reactions were purified by incubation with 10 units of Exonuclease I and 0.5 unit of SAP at 37 C during 45 min followed by heat inactivation (80 C during 30 min).

    Polymerase Chain Reaction:

    Article Title: Transcription of the three HMG-CoA reductase genes of Mucor circinelloides
    Article Snippet: DNA was isolated using the MasterPure Yeast DNA Purification Kit (Epicentre), while RNA was purified using the E.Z.N.A Total RNA Kit II (Omega Bio-Tek). .. The genes were amplified by PCR using the Long PCR Kit (Thermo Scientific) and cloned into pBluescript II SK (Stratagene). .. Sequence analysis of the putative HmgR proteins Programs used to analyse the amino acid sequences of the putative HmgR proteins were accessed through the Swiss Expasy Server ( http://www.expasy.ch ).

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: Silencing of MUC20 suppresses the malignant character of pancreatic ductal adenocarcinoma cells through inhibition of the HGF/MET pathway
    Article Snippet: MUC20 overexpression and its mock control cells were established by transfection of MUC20/pcDNA3.1 A plasmid or pcDNA3.1 A vector, respectively, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. .. Human wild-type MUC20 (NCBI Accession No. NM_001282506.1) and truncated MUC20 were cloned using PCR kit (Invitrogen). ..

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder
    Article Snippet: The selection of candidate genes was based on known X-linked human genodermatoses , and included ATP7A , DKC1 , EBP , EDA , EFNB1 , IKBKG , MBTPS2 , NSDHL , PORCN , SAT1 , and STS . .. PCR, fragment length analysis, and Sanger sequencing To confirm the presence of the large heterozygous deletion in the two affected dogs, and its absence in the nonaffected control dogs, we performed a long-range PCR using the three primers NSDHL_F: TGCCATGAACATCTGGAGAG, NSDHL_R1: ACCCCAAACAACGAATCCT, NSDHL_R2: ACAGCTTCCCCTGCTAAGGT, and SequalPrep long range polymerase (Thermo Fisher). .. In heterozygous dogs, this resulted in PCR products with sizes of 753 bp for the wildtype and 1166 bp for the deletion allele.

    Article Title: Differential expression of microRNAs during melanoma progression: miR-200c, miR-205 and miR-211 are downregulated in melanoma and act as tumour suppressors
    Article Snippet: Gene expression assays Both miRNA and mRNA expressions were determined by TaqMan assays. .. Assays for individual miRNAs and mRNAs, reverse transcription and PCR kits were all obtained from Applied Biosystems (Carlsbad, CA, USA). .. The miRNA expression was standardised against the miR-92 control and mRNAs were standardised against β -actin.

    Article Title: A Complex Structural Variation on Chromosome 27 Leads to the Ectopic Expression of HOXB8 and the Muffs and Beard Phenotype in Chickens
    Article Snippet: The whole-genome sequencing data had been deposited in the SRA database at NCBI with a BioProject accession number PRJNA306810. .. Re-sequencing of targeted genomic regions Re-sequencing of the three identified CNVs sequences was performed using long-range PCR and Ion Torrent Technology. ..

    Article Title: Identification of a t(3;4)(p1.3;q1.5) translocation breakpoint in pigs using somatic cell hybrid mapping and high-resolution mate-pair sequencing
    Article Snippet: Primers were selected using Primer3 software, and PCR conditions were determined for each STS ( ). .. Sequencing of the t(3;4) breakpoint Junction fragments across the t(3;4) breakpoint were amplified by long-range PCR using the GeneAmp ® XL PCR Kit (Life Technologies). .. Products from these reactions were purified by incubation with 10 units of Exonuclease I and 0.5 unit of SAP at 37 C during 45 min followed by heat inactivation (80 C during 30 min).

    Clone Assay:

    Article Title: Transcription of the three HMG-CoA reductase genes of Mucor circinelloides
    Article Snippet: DNA was isolated using the MasterPure Yeast DNA Purification Kit (Epicentre), while RNA was purified using the E.Z.N.A Total RNA Kit II (Omega Bio-Tek). .. The genes were amplified by PCR using the Long PCR Kit (Thermo Scientific) and cloned into pBluescript II SK (Stratagene). .. Sequence analysis of the putative HmgR proteins Programs used to analyse the amino acid sequences of the putative HmgR proteins were accessed through the Swiss Expasy Server ( http://www.expasy.ch ).

    Article Title: Silencing of MUC20 suppresses the malignant character of pancreatic ductal adenocarcinoma cells through inhibition of the HGF/MET pathway
    Article Snippet: MUC20 overexpression and its mock control cells were established by transfection of MUC20/pcDNA3.1 A plasmid or pcDNA3.1 A vector, respectively, using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol. .. Human wild-type MUC20 (NCBI Accession No. NM_001282506.1) and truncated MUC20 were cloned using PCR kit (Invitrogen). ..

    Sequencing:

    Article Title: Recurrent duplications of the annexin A1 gene (ANXA1) in autism spectrum disorders
    Article Snippet: .. Breakpoint mapping For breakpoint mapping, ANXA1 duplications were amplified using Long Range PCR and PCR products were sequenced in both directions using fluorescent dye terminators (BigDye Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Forest City, CA, USA) and the same PCR primers on the ABI3730xls DNA Analyzer (Applied Biosystems). ..

    Article Title: A Large Deletion in the NSDHL Gene in Labrador Retrievers with a Congenital Cornification Disorder
    Article Snippet: The selection of candidate genes was based on known X-linked human genodermatoses , and included ATP7A , DKC1 , EBP , EDA , EFNB1 , IKBKG , MBTPS2 , NSDHL , PORCN , SAT1 , and STS . .. PCR, fragment length analysis, and Sanger sequencing To confirm the presence of the large heterozygous deletion in the two affected dogs, and its absence in the nonaffected control dogs, we performed a long-range PCR using the three primers NSDHL_F: TGCCATGAACATCTGGAGAG, NSDHL_R1: ACCCCAAACAACGAATCCT, NSDHL_R2: ACAGCTTCCCCTGCTAAGGT, and SequalPrep long range polymerase (Thermo Fisher). .. In heterozygous dogs, this resulted in PCR products with sizes of 753 bp for the wildtype and 1166 bp for the deletion allele.

    Article Title: Identification of a t(3;4)(p1.3;q1.5) translocation breakpoint in pigs using somatic cell hybrid mapping and high-resolution mate-pair sequencing
    Article Snippet: Primers were selected using Primer3 software, and PCR conditions were determined for each STS ( ). .. Sequencing of the t(3;4) breakpoint Junction fragments across the t(3;4) breakpoint were amplified by long-range PCR using the GeneAmp ® XL PCR Kit (Life Technologies). .. Products from these reactions were purified by incubation with 10 units of Exonuclease I and 0.5 unit of SAP at 37 C during 45 min followed by heat inactivation (80 C during 30 min).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher geneamp xl long range pcr kit
    Geneamp Xl Long Range Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp xl long range pcr kit/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    geneamp xl long range pcr kit - by Bioz Stars, 2021-06
    94/100 stars
      Buy from Supplier

    Image Search Results