geneamp rna pcr kit  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher geneamp rna pcr kit
    <t>RT-PCR</t> analysis of expression of pluripotency factors. A baboon ESC cell line and each biPSC line expressed the three pluripotency genes OCT4 , NANOG , and SOX2 at the <t>RNA</t> level.
    Geneamp Rna Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp rna pcr kit/product/Thermo Fisher
    Average 94 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    geneamp rna pcr kit - by Bioz Stars, 2020-08
    94/100 stars

    Images

    1) Product Images from "Derivation of Induced Pluripotent Stem Cells from the Baboon: A Nonhuman Primate Model for Preclinical Testing of Stem Cell Therapies"

    Article Title: Derivation of Induced Pluripotent Stem Cells from the Baboon: A Nonhuman Primate Model for Preclinical Testing of Stem Cell Therapies

    Journal: Cellular Reprogramming

    doi: 10.1089/cell.2012.0093

    RT-PCR analysis of expression of pluripotency factors. A baboon ESC cell line and each biPSC line expressed the three pluripotency genes OCT4 , NANOG , and SOX2 at the RNA level.
    Figure Legend Snippet: RT-PCR analysis of expression of pluripotency factors. A baboon ESC cell line and each biPSC line expressed the three pluripotency genes OCT4 , NANOG , and SOX2 at the RNA level.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing

    2) Product Images from "Follicular Dendritic Cells and Human Immunodeficiency Virus Type 1 Transcription in CD4+ T Cells ▿"

    Article Title: Follicular Dendritic Cells and Human Immunodeficiency Virus Type 1 Transcription in CD4+ T Cells ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.01652-08

    FDC augmentation of virus transcription was mediated by a soluble factor. In vitro-infected CD4 + T cells were cultured with FDCs or supernatant (FDCsup; 10%, vol/vol) obtained from 6-day cultures of FACS-sorted FDCs. (A) Viral RNA was harvested from the culture supernatants at the times indicated and examined using quantitative RT-PCR. (B) The supernatant fluid from the same cultures was harvested and examined for HIV p24 production at the times indicated. Error bars represent the standard deviations for replicate cultures. These data are representative of three independent experiments using different sources of primary CD4 + T cells and FDCs.
    Figure Legend Snippet: FDC augmentation of virus transcription was mediated by a soluble factor. In vitro-infected CD4 + T cells were cultured with FDCs or supernatant (FDCsup; 10%, vol/vol) obtained from 6-day cultures of FACS-sorted FDCs. (A) Viral RNA was harvested from the culture supernatants at the times indicated and examined using quantitative RT-PCR. (B) The supernatant fluid from the same cultures was harvested and examined for HIV p24 production at the times indicated. Error bars represent the standard deviations for replicate cultures. These data are representative of three independent experiments using different sources of primary CD4 + T cells and FDCs.

    Techniques Used: In Vitro, Infection, Cell Culture, FACS, Quantitative RT-PCR

    3) Product Images from "NFATc1 Regulates Programmed Death-1 Expression Upon T Cell Activation 1"

    Article Title: NFATc1 Regulates Programmed Death-1 Expression Upon T Cell Activation 1

    Journal: Journal of immunology (Baltimore, Md. : 1950)

    doi:

    Analysis of PD-1 transcription in murine cell lines and primary T cells (A) Expression levels of pdcd1 transcripts were determined in cell lines by quantitative reverse transcriptase (qRT)-PCR. Where indicated, EL4 cells were treated with PMA/ionomycin overnight (+P/I). Expression levels were normalized to qRT-PCR values obtained for 18s ribosomal RNA. (B) CD8 T cells were isolated as described under Materials and Methods and left untreated or treated with PMA/ionomycin overnight. Following incubation, the cells were harvested and the levels of PD-1 mRNA were determined as above. The data are expressed as fold PD-1 expression over untreated/control CD8 T cells. Each experiment was performed a minimum of three times and standard error bars were calculated.
    Figure Legend Snippet: Analysis of PD-1 transcription in murine cell lines and primary T cells (A) Expression levels of pdcd1 transcripts were determined in cell lines by quantitative reverse transcriptase (qRT)-PCR. Where indicated, EL4 cells were treated with PMA/ionomycin overnight (+P/I). Expression levels were normalized to qRT-PCR values obtained for 18s ribosomal RNA. (B) CD8 T cells were isolated as described under Materials and Methods and left untreated or treated with PMA/ionomycin overnight. Following incubation, the cells were harvested and the levels of PD-1 mRNA were determined as above. The data are expressed as fold PD-1 expression over untreated/control CD8 T cells. Each experiment was performed a minimum of three times and standard error bars were calculated.

    Techniques Used: Expressing, Quantitative RT-PCR, Isolation, Incubation

    4) Product Images from "Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay"

    Article Title: Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay

    Journal: Journal of Virological Methods

    doi: 10.1016/j.jviromet.2008.05.016

    Coefficients (CVs) of variation intra-assay and inter-assay over the dynamic range of the BCoV real-time RT-PCR assay. Field samples containing approximately 2 × 10 2 , 3 × 10 3 , 3 × 10 4 , 2 × 10 5 and 7 × 10 7 BCoV RNA copies were tested 10 times in the same run (CVs intra-assay) or in 10 consecutive runs (CVs inter-assay).
    Figure Legend Snippet: Coefficients (CVs) of variation intra-assay and inter-assay over the dynamic range of the BCoV real-time RT-PCR assay. Field samples containing approximately 2 × 10 2 , 3 × 10 3 , 3 × 10 4 , 2 × 10 5 and 7 × 10 7 BCoV RNA copies were tested 10 times in the same run (CVs intra-assay) or in 10 consecutive runs (CVs inter-assay).

    Techniques Used: Intra Assay, Inter Assay, Quantitative RT-PCR

    5) Product Images from "ABCG2 Transporter Identifies a Population of Clonogenic Human Limbal Epithelial Cells"

    Article Title: ABCG2 Transporter Identifies a Population of Clonogenic Human Limbal Epithelial Cells

    Journal: Stem cells (Dayton, Ohio)

    doi: 10.1634/stemcells.2004-0093

    RNA Isolation and Semiquantitative RT-PCR
    Figure Legend Snippet: RNA Isolation and Semiquantitative RT-PCR

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    6) Product Images from "The Origin of the RB1 Imprint"

    Article Title: The Origin of the RB1 Imprint

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0081502

    Allele-specific methylation and independent monoallelic expression of the retrocopy on chromosome 4 in marmoset. (A) A SNP (C/G) was used to distinguish the alleles. The mean methylation in the 15 heterozygous individuals was 30-69%, the G allele showed 5-15% methylation and the C allele showed 53-83% methylation. The 5 individuals homozygous for the C allele showed a mean methylation level of 34-66%. The individual homozygous for the G allele (100707) showed no methylation. Thus, the methylation pattern of the retrocopy on marmoset chromosome 4 is allele-specific. red, methylated; blue, unmethylated. (B) By RT-PCR and sequencing, a transcript specific for this retrocopy was identified in 6 heterozygous individuals (no RNA was available from the other heterozygous individuals). This transcript is monoallelically expressed and its expression is not regulated by DNA methylation as transcripts from methylated or unmethylated alleles were obtained.
    Figure Legend Snippet: Allele-specific methylation and independent monoallelic expression of the retrocopy on chromosome 4 in marmoset. (A) A SNP (C/G) was used to distinguish the alleles. The mean methylation in the 15 heterozygous individuals was 30-69%, the G allele showed 5-15% methylation and the C allele showed 53-83% methylation. The 5 individuals homozygous for the C allele showed a mean methylation level of 34-66%. The individual homozygous for the G allele (100707) showed no methylation. Thus, the methylation pattern of the retrocopy on marmoset chromosome 4 is allele-specific. red, methylated; blue, unmethylated. (B) By RT-PCR and sequencing, a transcript specific for this retrocopy was identified in 6 heterozygous individuals (no RNA was available from the other heterozygous individuals). This transcript is monoallelically expressed and its expression is not regulated by DNA methylation as transcripts from methylated or unmethylated alleles were obtained.

    Techniques Used: Methylation, Expressing, Reverse Transcription Polymerase Chain Reaction, Sequencing, DNA Methylation Assay

    7) Product Images from "Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism"

    Article Title: Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0308615100

    Differential expression of L1 transcripts in HPV16-containing cell lines grown as undifferentiated monolayers or as differentiated organotypic epithelial tissues. Total RNAs were isolated and HPV16 L1 RNAs were quantified by using RT-PCR and real-time quantitative PCR. HPV16 L1 transcripts were normalized to those of GAPDH. L1 RNA quantities are shown for HPV16 infected cervical keratinocytes at similar passage. Shaded bars represent copies of L1 in a clonal population (C-9), and unshaded bars represent L1 in total population (C-100). ( A ) RNA isolated from undifferentiated cells grown as a monolayer. ( B ) RNA isolated from cells grown as differentiated epithelial raft tissues.
    Figure Legend Snippet: Differential expression of L1 transcripts in HPV16-containing cell lines grown as undifferentiated monolayers or as differentiated organotypic epithelial tissues. Total RNAs were isolated and HPV16 L1 RNAs were quantified by using RT-PCR and real-time quantitative PCR. HPV16 L1 transcripts were normalized to those of GAPDH. L1 RNA quantities are shown for HPV16 infected cervical keratinocytes at similar passage. Shaded bars represent copies of L1 in a clonal population (C-9), and unshaded bars represent L1 in total population (C-100). ( A ) RNA isolated from undifferentiated cells grown as a monolayer. ( B ) RNA isolated from cells grown as differentiated epithelial raft tissues.

    Techniques Used: Expressing, Isolation, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Infection

    Quantification of virion production and analysis of reinfection in HaCaT cells. ( A ) Virions were extracted from organotypic tissues and analyzed by dot blot hybridization. Copy number control HPV16 DNA from cloned genomes ranging from 10 5 to 10 8 vge and 10 or 20 μl of virion preparations were denatured with sodium hydroxide, transferred to a nylon membrane, and then hybridized with a radioactively labeled HPV16 genome probe and exposed to a phosphorimage screen for quantification. ( B ) HPV16 virions isolated from a cloned line (C-9), a total cell population (C-100), and W12-E cells grown as raft tissues were used to infect HaCaT cells. The HaCaT cells were harvested 2 days after infection. Total RNAs (3 μg) were reverse-transcribed. ( Upper ) RNAs were analyzed from W12-E cells known to contain E1^E4 message (+, lane 9); mock-infected HaCaT cells (mock, lanes 7-8); HaCaT cells infected with a multiplicity of infection corresponding to ≈10 and 5 vge per cell, respectively, from C-9 (lanes 1-2); C-100 (lanes 3-4); and W12-E (lanes 5-6). No RNA input (Ø, lane 10) served as a negative amplification control. ( Lower ) β-actin primers were used to detect a 641-bp amplimer derived from spliced β-actin RNA in one round of PCR. The input RNA corresponded to 2.7 μg for HPV16 E1^E4 and 0.3 μg for β-actin. Molecular size standards (100-bp ladder) are shown in the lateral lanes.
    Figure Legend Snippet: Quantification of virion production and analysis of reinfection in HaCaT cells. ( A ) Virions were extracted from organotypic tissues and analyzed by dot blot hybridization. Copy number control HPV16 DNA from cloned genomes ranging from 10 5 to 10 8 vge and 10 or 20 μl of virion preparations were denatured with sodium hydroxide, transferred to a nylon membrane, and then hybridized with a radioactively labeled HPV16 genome probe and exposed to a phosphorimage screen for quantification. ( B ) HPV16 virions isolated from a cloned line (C-9), a total cell population (C-100), and W12-E cells grown as raft tissues were used to infect HaCaT cells. The HaCaT cells were harvested 2 days after infection. Total RNAs (3 μg) were reverse-transcribed. ( Upper ) RNAs were analyzed from W12-E cells known to contain E1^E4 message (+, lane 9); mock-infected HaCaT cells (mock, lanes 7-8); HaCaT cells infected with a multiplicity of infection corresponding to ≈10 and 5 vge per cell, respectively, from C-9 (lanes 1-2); C-100 (lanes 3-4); and W12-E (lanes 5-6). No RNA input (Ø, lane 10) served as a negative amplification control. ( Lower ) β-actin primers were used to detect a 641-bp amplimer derived from spliced β-actin RNA in one round of PCR. The input RNA corresponded to 2.7 μg for HPV16 E1^E4 and 0.3 μg for β-actin. Molecular size standards (100-bp ladder) are shown in the lateral lanes.

    Techniques Used: Dot Blot, Hybridization, Clone Assay, Labeling, Isolation, Infection, Amplification, Derivative Assay, Polymerase Chain Reaction

    8) Product Images from "Thrombopoietin initiates demethylation-based transcription of GP6 during megakaryocyte differentiation"

    Article Title: Thrombopoietin initiates demethylation-based transcription of GP6 during megakaryocyte differentiation

    Journal: Blood

    doi: 10.1182/blood-2004-08-3109

    (A, i-ii) TPO induced expression of GPVI on UT-7/EPO Mpl cells. Total RNA was extracted from cells treated with 10 ng/mL TPO for 3, 5, or 9 days or with 10 μM 5-aza-dC for 48 hours. GPVI (i) and GAPDH (ii) mRNA were then amplified by RT-PCR. By
    Figure Legend Snippet: (A, i-ii) TPO induced expression of GPVI on UT-7/EPO Mpl cells. Total RNA was extracted from cells treated with 10 ng/mL TPO for 3, 5, or 9 days or with 10 μM 5-aza-dC for 48 hours. GPVI (i) and GAPDH (ii) mRNA were then amplified by RT-PCR. By

    Techniques Used: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction

    9) Product Images from "DETECTION OF THE WOLBACHIA-ENCODED DNA BINDING PROTEIN, HU beta, IN MOSQUITO GONADS"

    Article Title: DETECTION OF THE WOLBACHIA-ENCODED DNA BINDING PROTEIN, HU beta, IN MOSQUITO GONADS

    Journal: Insect biochemistry and molecular biology

    doi: 10.1016/j.ibmb.2012.12.007

    RT PCR analysis of the hup B transcript in pooled decapitated mosquitoes and uninfected mosquito cells. M is a DNA marker. Lanes 1 and 11 are RNA extracted from uninfected C7–10 mosquito cells. Lanes 3, 4, and 12 are total RNA extracted from Culex
    Figure Legend Snippet: RT PCR analysis of the hup B transcript in pooled decapitated mosquitoes and uninfected mosquito cells. M is a DNA marker. Lanes 1 and 11 are RNA extracted from uninfected C7–10 mosquito cells. Lanes 3, 4, and 12 are total RNA extracted from Culex

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Marker

    10) Product Images from "Deleted in liver cancer 2 (DLC2) suppresses cell transformation by means of inhibition of RhoA activity"

    Article Title: Deleted in liver cancer 2 (DLC2) suppresses cell transformation by means of inhibition of RhoA activity

    Journal:

    doi: 10.1073/pnas.0504501102

    Down-regulation of DLC2-enhanced cell motility. ( A ) RNA of DLC2 siRNA and control siRNA-transfected and -nontransfected HepG2 cells were extracted before and after migration. Real-time PCR was performed to measure the expression level of DLC2. Expression
    Figure Legend Snippet: Down-regulation of DLC2-enhanced cell motility. ( A ) RNA of DLC2 siRNA and control siRNA-transfected and -nontransfected HepG2 cells were extracted before and after migration. Real-time PCR was performed to measure the expression level of DLC2. Expression

    Techniques Used: Transfection, Migration, Real-time Polymerase Chain Reaction, Expressing

    11) Product Images from "Expression Analysis in Multiple Muscle Groups and Serum Reveals Complexity in the MicroRNA Transcriptome of the mdx Mouse with Implications for Therapy"

    Article Title: Expression Analysis in Multiple Muscle Groups and Serum Reveals Complexity in the MicroRNA Transcriptome of the mdx Mouse with Implications for Therapy

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1038/mtna.2012.26

    Pip6e-phosphorodiamidate morpholino oligonucleotide (PMO) treatment normalizes serum dystromir abundance. Twelve-week-old mdx mice were injected with a single 12.5 mg/kg dose of Pip6e-PMO intravenously and harvested 2 weeks later. Serum samples were analyzed for the expression of ( a ) miR-1, ( b ) miR-133a, and ( c ) miR-206 by small RNA TaqMan RT-qPCR. miRNA levels were normalized to miR-223 expression and fold changes presented relative to the wild-type C57 average. ( d ) Representative immunofluorescence images of tibialis anterior muscle showing restoration of dystrophin at the sarcolemma in mdx mice following treatment with Pip6e-PMO. Samples were co-stained with laminin to indicate muscle fibers. ( e ) RT-PCR shows skipping of dystrophin exon 23 across various muscle groups. Values are mean ± SEM, n = 4, * P
    Figure Legend Snippet: Pip6e-phosphorodiamidate morpholino oligonucleotide (PMO) treatment normalizes serum dystromir abundance. Twelve-week-old mdx mice were injected with a single 12.5 mg/kg dose of Pip6e-PMO intravenously and harvested 2 weeks later. Serum samples were analyzed for the expression of ( a ) miR-1, ( b ) miR-133a, and ( c ) miR-206 by small RNA TaqMan RT-qPCR. miRNA levels were normalized to miR-223 expression and fold changes presented relative to the wild-type C57 average. ( d ) Representative immunofluorescence images of tibialis anterior muscle showing restoration of dystrophin at the sarcolemma in mdx mice following treatment with Pip6e-PMO. Samples were co-stained with laminin to indicate muscle fibers. ( e ) RT-PCR shows skipping of dystrophin exon 23 across various muscle groups. Values are mean ± SEM, n = 4, * P

    Techniques Used: Mouse Assay, Injection, Expressing, Quantitative RT-PCR, Immunofluorescence, Staining, Reverse Transcription Polymerase Chain Reaction

    Reverse transcription-quantitative PCR (RT-qPCR) analysis of dystromir expression. Tibialis anterior (TA), triceps, quadriceps, diaphragm, heart, and serum from 8-week-old C57/Bl10 [wild type (WT)] and mdx mice were harvested and small RNA TaqMan reverse transcriptase-quantitative PCR (RT-qPCR) performed to determine relative expression of the following dystromirs: ( a ) miR-1, ( b ) miR-21, ( c ) miR-29c, ( d ) miR-31, ( e ) miR-34c, ( f ) miR-133a, ( g ) miR-146b, ( h ) miR-199a-3p, ( i ) miR-206, ( j ) miR-221, ( k ) miR-223. Gray bars represent WT samples and black bars represent mdx samples. Relative fold changes were determined by the Pfaffl method. Tissue microRNA (miRNA) expression was normalized to miR-16 and serum miRNA expression normalized to miR-223 (consequently serum expression of miR-223 is omitted from panel (k)). All values are mean + SEM. * P
    Figure Legend Snippet: Reverse transcription-quantitative PCR (RT-qPCR) analysis of dystromir expression. Tibialis anterior (TA), triceps, quadriceps, diaphragm, heart, and serum from 8-week-old C57/Bl10 [wild type (WT)] and mdx mice were harvested and small RNA TaqMan reverse transcriptase-quantitative PCR (RT-qPCR) performed to determine relative expression of the following dystromirs: ( a ) miR-1, ( b ) miR-21, ( c ) miR-29c, ( d ) miR-31, ( e ) miR-34c, ( f ) miR-133a, ( g ) miR-146b, ( h ) miR-199a-3p, ( i ) miR-206, ( j ) miR-221, ( k ) miR-223. Gray bars represent WT samples and black bars represent mdx samples. Relative fold changes were determined by the Pfaffl method. Tissue microRNA (miRNA) expression was normalized to miR-16 and serum miRNA expression normalized to miR-223 (consequently serum expression of miR-223 is omitted from panel (k)). All values are mean + SEM. * P

    Techniques Used: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Expressing, Mouse Assay

    12) Product Images from "A specific FMNL2 isoform is up-regulated in invasive cells"

    Article Title: A specific FMNL2 isoform is up-regulated in invasive cells

    Journal: BMC Cell Biology

    doi: 10.1186/s12860-016-0110-z

    A specific FMNL2 isoform is over-represented in invasive cells. a RT-PCR was performed on total RNA harvested from SW480, SW620 and A375 cells. Specific primers were used to demonstrate the presence of four alternatively spliced FMNL2 isoforms identified in an initial RT-PCR analysis (see Results ). b The four alternatively spliced mRNA are predicted to encode proteins differing only at amino acid residues C-terminal to the DAD domain. c qPCR was used to assess the levels of expression of each isoform in comparison to total FMNL2 in the indicated colorectal and melanoma cell-lines as well as in non-transformed primary endothelial cells and melanocytes. The TQS isoform was predominant in all the invasive cell-lines that were assessed. We were unable to obtain reliable qPCR data for the PMR isoform. d Isoform specific antibodies were raised against peptides corresponding to the unique domain of each C-terminal tail. Full-length derivatives of the indicated FMNL2 isoforms bearing N-terminal myc epitope tags were expressed in U2OS cells by transient transfection and the resulting cell lysates were immunoblotted with the indicated antibodies. Total FMNL2 protein was detected using an antibody directed against FMNL2 codons 599–1045. Equivalent samples were loaded on a separate gel and probed with α-myc antibodies. The α-FMNL2 blot was stripped and re-probed with α-TQS antibody; the α-myc blot was stripped and re-probed with α-PMR antibody. Equivalent samples were loaded on separate gels to detect ITM and YHY e Immunoblot analysis using antibodies directed against the C-terminal tails of each of the predicted FMNL2 isoforms confirms the qPCR analysis. Total FMNL2 protein was detected using pan FMNL2 antibody shown in 1D. Isoform specific antibodies were raised against peptides corresponding to the unique domain of each C-terminal tail. Equivalent samples were loaded on separate gels to eliminate concerns regarding incomplete stripping. The pan-FMNL2 blot was stripped and re-probed with anti α-tubulin for a loading control
    Figure Legend Snippet: A specific FMNL2 isoform is over-represented in invasive cells. a RT-PCR was performed on total RNA harvested from SW480, SW620 and A375 cells. Specific primers were used to demonstrate the presence of four alternatively spliced FMNL2 isoforms identified in an initial RT-PCR analysis (see Results ). b The four alternatively spliced mRNA are predicted to encode proteins differing only at amino acid residues C-terminal to the DAD domain. c qPCR was used to assess the levels of expression of each isoform in comparison to total FMNL2 in the indicated colorectal and melanoma cell-lines as well as in non-transformed primary endothelial cells and melanocytes. The TQS isoform was predominant in all the invasive cell-lines that were assessed. We were unable to obtain reliable qPCR data for the PMR isoform. d Isoform specific antibodies were raised against peptides corresponding to the unique domain of each C-terminal tail. Full-length derivatives of the indicated FMNL2 isoforms bearing N-terminal myc epitope tags were expressed in U2OS cells by transient transfection and the resulting cell lysates were immunoblotted with the indicated antibodies. Total FMNL2 protein was detected using an antibody directed against FMNL2 codons 599–1045. Equivalent samples were loaded on a separate gel and probed with α-myc antibodies. The α-FMNL2 blot was stripped and re-probed with α-TQS antibody; the α-myc blot was stripped and re-probed with α-PMR antibody. Equivalent samples were loaded on separate gels to detect ITM and YHY e Immunoblot analysis using antibodies directed against the C-terminal tails of each of the predicted FMNL2 isoforms confirms the qPCR analysis. Total FMNL2 protein was detected using pan FMNL2 antibody shown in 1D. Isoform specific antibodies were raised against peptides corresponding to the unique domain of each C-terminal tail. Equivalent samples were loaded on separate gels to eliminate concerns regarding incomplete stripping. The pan-FMNL2 blot was stripped and re-probed with anti α-tubulin for a loading control

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Expressing, Transformation Assay, Transfection, Stripping Membranes

    13) Product Images from "EGFR regulation of colon cancer stem-like cells during aging and in response to the colonic carcinogen dimethylhydrazine"

    Article Title: EGFR regulation of colon cancer stem-like cells during aging and in response to the colonic carcinogen dimethylhydrazine

    Journal: American Journal of Physiology - Gastrointestinal and Liver Physiology

    doi: 10.1152/ajpgi.00323.2011

    Isolation of RNA and quantitative RT-PCR analysis.
    Figure Legend Snippet: Isolation of RNA and quantitative RT-PCR analysis.

    Techniques Used: Isolation, Quantitative RT-PCR

    14) Product Images from "AIRE deficiency in thymus of 2 patients with Omenn syndrome"

    Article Title: AIRE deficiency in thymus of 2 patients with Omenn syndrome

    Journal: Journal of Clinical Investigation

    doi: 10.1172/JCI200523087

    AIRE expression in thymi from Omenn syndrome and SCID patients. ( A ) Real-time PCR analysis of cDNA prepared from RNA isolated from normal thymi and from thymi of Omenn syndrome patients (Pt1 and Pt2) and 1 SCID patient (Pt3). The levels of AIRE mRNA were calculated as a percentage of those in normal thymus from control subject 1 and are expressed as average of triplicates ± SE. Data are representative of 1 of 5 experiments. * P
    Figure Legend Snippet: AIRE expression in thymi from Omenn syndrome and SCID patients. ( A ) Real-time PCR analysis of cDNA prepared from RNA isolated from normal thymi and from thymi of Omenn syndrome patients (Pt1 and Pt2) and 1 SCID patient (Pt3). The levels of AIRE mRNA were calculated as a percentage of those in normal thymus from control subject 1 and are expressed as average of triplicates ± SE. Data are representative of 1 of 5 experiments. * P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Isolation

    15) Product Images from "Apolipoprotein M Gene (APOM) Polymorphism Modifies Metabolic and Disease Traits in Type 2 Diabetes"

    Article Title: Apolipoprotein M Gene (APOM) Polymorphism Modifies Metabolic and Disease Traits in Type 2 Diabetes

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0017324

    Tissue expression of human APOM1 and APOM5 . (A) Commercial human tissue RNA panels were used for cDNA synthesis by the GeneAmp RNA PCR kit. Primers specific to APOM transcripts or GAPDH (details provided in Materials and Methods ) were used for cDNA amplfication. The molecular sizes of DNA markers and PCR products are indicated on the left and right side of the panel, respectively. Primer positions are indicated by arrowheads in the schematic representations of APOM 1 transcript (B), and APOM 5 transcript (C). Positions of coding exons (black boxes), introns (fold lines), untranslated region (white boxes) are indicated.
    Figure Legend Snippet: Tissue expression of human APOM1 and APOM5 . (A) Commercial human tissue RNA panels were used for cDNA synthesis by the GeneAmp RNA PCR kit. Primers specific to APOM transcripts or GAPDH (details provided in Materials and Methods ) were used for cDNA amplfication. The molecular sizes of DNA markers and PCR products are indicated on the left and right side of the panel, respectively. Primer positions are indicated by arrowheads in the schematic representations of APOM 1 transcript (B), and APOM 5 transcript (C). Positions of coding exons (black boxes), introns (fold lines), untranslated region (white boxes) are indicated.

    Techniques Used: Expressing, Polymerase Chain Reaction

    16) Product Images from "PldB, a Putative Phospholipase D Homologue in Dictyostelium discoideum Mediates Quorum Sensing during Development"

    Article Title: PldB, a Putative Phospholipase D Homologue in Dictyostelium discoideum Mediates Quorum Sensing during Development

    Journal:

    doi: 10.1128/EC.4.4.694-702.2005

    Overexpression of pldB in wild-type and pldB − cells. RNA from vegetative wild-type and pldB − cells, with or without the pldB overexpression plasmid, were collected, and RT-PCR with pldB -specific primers was performed. Simultaneous reactions
    Figure Legend Snippet: Overexpression of pldB in wild-type and pldB − cells. RNA from vegetative wild-type and pldB − cells, with or without the pldB overexpression plasmid, were collected, and RT-PCR with pldB -specific primers was performed. Simultaneous reactions

    Techniques Used: Over Expression, Plasmid Preparation, Reverse Transcription Polymerase Chain Reaction

    17) Product Images from "Nuclear Outsourcing of RNA Interference Components to Human Mitochondria"

    Article Title: Nuclear Outsourcing of RNA Interference Components to Human Mitochondria

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0020746

    Isolation of mitochondrial and cytosolic miRNA. A. Schematic workflow of the experimental design. B. Integrity, quality and purity analyses of RNA fractions. Electrophoretic images of mitochondrial and cytosolic RNAs were retrieved from analysis using the Agilent 2100 Bioanalyzer. Bands corresponding to ribosomal RNAs (rRNAs) 16S, 12S, 28S and 18S are indicated when present. Representative image is shown of three independent experiments. C. Purity assessment of mitochondrial RNA fraction. 16S rRNA and GAPDH were amplified by RT-PCR in each fraction as shown by electrophoretic image. GAPDH was assessed in the mitochondrial fraction to check for cytoplasmic contaminant relatively to mitochondrial 16S ribosomal RNA. Representative image is shown of three independent experiments. The density of bands was measured using the ImageJ software and is represented as a relative intensity. Values are means±SD of three independent experiments.
    Figure Legend Snippet: Isolation of mitochondrial and cytosolic miRNA. A. Schematic workflow of the experimental design. B. Integrity, quality and purity analyses of RNA fractions. Electrophoretic images of mitochondrial and cytosolic RNAs were retrieved from analysis using the Agilent 2100 Bioanalyzer. Bands corresponding to ribosomal RNAs (rRNAs) 16S, 12S, 28S and 18S are indicated when present. Representative image is shown of three independent experiments. C. Purity assessment of mitochondrial RNA fraction. 16S rRNA and GAPDH were amplified by RT-PCR in each fraction as shown by electrophoretic image. GAPDH was assessed in the mitochondrial fraction to check for cytoplasmic contaminant relatively to mitochondrial 16S ribosomal RNA. Representative image is shown of three independent experiments. The density of bands was measured using the ImageJ software and is represented as a relative intensity. Values are means±SD of three independent experiments.

    Techniques Used: Isolation, Amplification, Reverse Transcription Polymerase Chain Reaction, Software

    Evidence for a mitochondrial miRNA signature in HeLa cells. A. Heatmap showing the 57 miRNAs differentially expressed in HeLa cells from mitochondrial and cytosolic RNA. Three independent microarray profiling experiments (microarray n1, n2 and n3) are shown and reproducibly revealed 13 miRNAs enriched in mitochondrial RNA. Log2 Hy5/Hy3 ratios are color scaled in gradient from green (low levels) to red (high levels) as indicated by the scale bar. B. Validation of microarray data by RT-PCR. Five genes (hsa-miR-494, hsa-miR-1974, hsa-miR-1275, 16S rRNA and GAPDH ) were selected for microarray data validation of differential expression in either subcellular compartment. 16S rRNA was used as a positive mitochondrial control, while GAPDH as a negative mitochondrial control. Quantitative analysis of band intensities are shown for three independent RT-PCR experiments and indicated as arbitrary units (a.u.) in either mitochondria (grey) or cytosol (black). Error bars represent the standard error of the mean. Asteriscs indicate statistically significant differences as compared to the cytosol (hsa-miR-494, p-value = 3.32×10 −5 ; hsa-miR-1974, p-value = 0.02; hsa-miR-1275, p-value = 6×10 −4 ; 16S rRNA, p-value = 0.03).
    Figure Legend Snippet: Evidence for a mitochondrial miRNA signature in HeLa cells. A. Heatmap showing the 57 miRNAs differentially expressed in HeLa cells from mitochondrial and cytosolic RNA. Three independent microarray profiling experiments (microarray n1, n2 and n3) are shown and reproducibly revealed 13 miRNAs enriched in mitochondrial RNA. Log2 Hy5/Hy3 ratios are color scaled in gradient from green (low levels) to red (high levels) as indicated by the scale bar. B. Validation of microarray data by RT-PCR. Five genes (hsa-miR-494, hsa-miR-1974, hsa-miR-1275, 16S rRNA and GAPDH ) were selected for microarray data validation of differential expression in either subcellular compartment. 16S rRNA was used as a positive mitochondrial control, while GAPDH as a negative mitochondrial control. Quantitative analysis of band intensities are shown for three independent RT-PCR experiments and indicated as arbitrary units (a.u.) in either mitochondria (grey) or cytosol (black). Error bars represent the standard error of the mean. Asteriscs indicate statistically significant differences as compared to the cytosol (hsa-miR-494, p-value = 3.32×10 −5 ; hsa-miR-1974, p-value = 0.02; hsa-miR-1275, p-value = 6×10 −4 ; 16S rRNA, p-value = 0.03).

    Techniques Used: Microarray, Reverse Transcription Polymerase Chain Reaction, Expressing

    Co-immunoprecipitation of AGO2 and mitochondrial transcripts. Either AGO2, or SLUG, which serves as a negative control were co-immunoprecipitated with associated mRNAs in HeLa protein extracts. Coimmunoprecipitated RNA was extracted with Trizol and subjected to RT-PCR amplification with the indicated primers: cytochrome c oxidase III ( COX3 ), cytochrome b ( cyt b ) and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ). Results are indicative of three independent experiments.
    Figure Legend Snippet: Co-immunoprecipitation of AGO2 and mitochondrial transcripts. Either AGO2, or SLUG, which serves as a negative control were co-immunoprecipitated with associated mRNAs in HeLa protein extracts. Coimmunoprecipitated RNA was extracted with Trizol and subjected to RT-PCR amplification with the indicated primers: cytochrome c oxidase III ( COX3 ), cytochrome b ( cyt b ) and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ). Results are indicative of three independent experiments.

    Techniques Used: Immunoprecipitation, Negative Control, Reverse Transcription Polymerase Chain Reaction, Amplification

    18) Product Images from "Cripto-1 contributes to stemness in hepatocellular carcinoma by stabilizing Dishevelled-3 and activating Wnt/β-catenin pathway"

    Article Title: Cripto-1 contributes to stemness in hepatocellular carcinoma by stabilizing Dishevelled-3 and activating Wnt/β-catenin pathway

    Journal: Cell Death and Differentiation

    doi: 10.1038/s41418-018-0059-x

    Cripto-1 levels in HCC clinical samples carry prognostic significance and are correlated with AXIN2 expressions. a Cripto-1 was significantly upregulated in HCC tumor tissues (T) versus the corresponding non-tumorous liver tissues (NT) from both in-house RNA sequencing dataset ( n = 16) and the TCGA database ( n = 50). b Cripto-1 level was significantly upregulated in HCC tumor (T) versus non-tumorous liver (NT) tissues by qRT-PCR ( n = 77, ** p
    Figure Legend Snippet: Cripto-1 levels in HCC clinical samples carry prognostic significance and are correlated with AXIN2 expressions. a Cripto-1 was significantly upregulated in HCC tumor tissues (T) versus the corresponding non-tumorous liver tissues (NT) from both in-house RNA sequencing dataset ( n = 16) and the TCGA database ( n = 50). b Cripto-1 level was significantly upregulated in HCC tumor (T) versus non-tumorous liver (NT) tissues by qRT-PCR ( n = 77, ** p

    Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR

    19) Product Images from "Human Papillomavirus Type 31b Infection of Human Keratinocytes and the Onset of Early Transcription"

    Article Title: Human Papillomavirus Type 31b Infection of Human Keratinocytes and the Onset of Early Transcription

    Journal: Journal of Virology

    doi: 10.1128/JVI.76.22.11291-11300.2002

    RT-PCR analysis of HPV31b transcripts following infection of various cell lines. Subconfluent cell monolayers were inoculated with serial 10-fold dilutions of an HPV31b stock. Total RNAs were extracted and treated with DNase I. RT was preformed on 3 μg of RNA for each sample. Each cell line was mock-infected (lanes M), or infected with HPV31b doses corresponding to 0.1, 1.0, and 10 vDNA-containing particles per cell. CIN-612 9E monolayers (9E) and no RNA input (Ø) served as positive and negative amplification controls, respectively. (A) Primers E7.3A and E4.3B target a 498-bp amplimer arising from spliced HPV31b E1∧E4 RNA. The input RNA corresponded to 2.7 μg for each PCR. (B) Primers β-actin OA and β-actin OB detect a 641-bp amplimer derived from spliced cellular β-actin RNA. The input RNA corresponded to 0.3 μg. Molecular size standards (100-bp ladder, New England Biolabs) are shown at the edges of each panel.
    Figure Legend Snippet: RT-PCR analysis of HPV31b transcripts following infection of various cell lines. Subconfluent cell monolayers were inoculated with serial 10-fold dilutions of an HPV31b stock. Total RNAs were extracted and treated with DNase I. RT was preformed on 3 μg of RNA for each sample. Each cell line was mock-infected (lanes M), or infected with HPV31b doses corresponding to 0.1, 1.0, and 10 vDNA-containing particles per cell. CIN-612 9E monolayers (9E) and no RNA input (Ø) served as positive and negative amplification controls, respectively. (A) Primers E7.3A and E4.3B target a 498-bp amplimer arising from spliced HPV31b E1∧E4 RNA. The input RNA corresponded to 2.7 μg for each PCR. (B) Primers β-actin OA and β-actin OB detect a 641-bp amplimer derived from spliced cellular β-actin RNA. The input RNA corresponded to 0.3 μg. Molecular size standards (100-bp ladder, New England Biolabs) are shown at the edges of each panel.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Infection, Amplification, Polymerase Chain Reaction, Derivative Assay

    20) Product Images from "Reactive Oxygen Species Are Not Required for an Arsenic Trioxide-induced Antioxidant Response or Apoptosis *Reactive Oxygen Species Are Not Required for an Arsenic Trioxide-induced Antioxidant Response or Apoptosis * S⃞"

    Article Title: Reactive Oxygen Species Are Not Required for an Arsenic Trioxide-induced Antioxidant Response or Apoptosis *Reactive Oxygen Species Are Not Required for an Arsenic Trioxide-induced Antioxidant Response or Apoptosis * S⃞

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M806546200

    MT induction does not protect cells from ATO-induced cell death. A , U266, MM.1s, and 8226/S were treated for 0, 6, 24, and 48 h with 2 μ m ATO, and total RNA was obtained. RT-PCR for MT1 and GAPDH was performed as described under “Materials
    Figure Legend Snippet: MT induction does not protect cells from ATO-induced cell death. A , U266, MM.1s, and 8226/S were treated for 0, 6, 24, and 48 h with 2 μ m ATO, and total RNA was obtained. RT-PCR for MT1 and GAPDH was performed as described under “Materials

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    21) Product Images from "Tregs are Dysfunctional in Vivo in a Spontaneous Murine Model of Crohn's Disease"

    Article Title: Tregs are Dysfunctional in Vivo in a Spontaneous Murine Model of Crohn's Disease

    Journal: Mucosal immunology

    doi: 10.1038/mi.2012.67

    Anti-CD25 Ab treatment increases the severity of spontaneous ileitis in SAMP mice, and increases ileal expression of Th1 and Th2 cytokines (A) Anti-CD25 treated mice developed more severe ileitis with a higher mean total inflammatory score compared with control mAb treated mice; no significant colitis was detected in either group (n=11/group). (B) Representative photomicrographs of H E stained sections, 10× and 20× original magnification. SAMP mice treated with isotype control Ab display minimal inflammatory changes with preservation of the villi morphology; anti-CD25 treated SAMP show increased infiltration of inflammatory cells and villous distortion. (C) Serum TNF-α and IFN-γ levels measured by ELISA were elevated in anti-CD25 treated SAMP mice compared to controls (n=6/group). (D) Total RNA was extracted from ileal tissues from anti-CD25 Ab or isotype control Ab treated SAMP mice, and mRNA was quantified by real-time RT-PCR. Both Th1 and Th2 cytokines were significantly increased in anti-CD25 treated mice. Data are expressed as the mean ± SEM (* P
    Figure Legend Snippet: Anti-CD25 Ab treatment increases the severity of spontaneous ileitis in SAMP mice, and increases ileal expression of Th1 and Th2 cytokines (A) Anti-CD25 treated mice developed more severe ileitis with a higher mean total inflammatory score compared with control mAb treated mice; no significant colitis was detected in either group (n=11/group). (B) Representative photomicrographs of H E stained sections, 10× and 20× original magnification. SAMP mice treated with isotype control Ab display minimal inflammatory changes with preservation of the villi morphology; anti-CD25 treated SAMP show increased infiltration of inflammatory cells and villous distortion. (C) Serum TNF-α and IFN-γ levels measured by ELISA were elevated in anti-CD25 treated SAMP mice compared to controls (n=6/group). (D) Total RNA was extracted from ileal tissues from anti-CD25 Ab or isotype control Ab treated SAMP mice, and mRNA was quantified by real-time RT-PCR. Both Th1 and Th2 cytokines were significantly increased in anti-CD25 treated mice. Data are expressed as the mean ± SEM (* P

    Techniques Used: Mouse Assay, Expressing, Staining, Preserving, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    22) Product Images from "Candesartan Mediated Amelioration of Cisplatin-Induced Testicular Damage Is Associated with Alterations in Expression Patterns of Nephrin and Podocin"

    Article Title: Candesartan Mediated Amelioration of Cisplatin-Induced Testicular Damage Is Associated with Alterations in Expression Patterns of Nephrin and Podocin

    Journal: BioMed Research International

    doi: 10.1155/2015/273784

    Changes in expression levels of nephrin and podocin in the testes of rats following treatment with cisplatin and/or candesartan. (a) Total RNA was extracted from the testes and analyzed for nephrin mRNA levels by real-time RT-PCR. Each column represents the mean value with standard deviation. † , ∗ , and ∗∗ differ from Group 1, Group 3, and Group 5, respectively ( P
    Figure Legend Snippet: Changes in expression levels of nephrin and podocin in the testes of rats following treatment with cisplatin and/or candesartan. (a) Total RNA was extracted from the testes and analyzed for nephrin mRNA levels by real-time RT-PCR. Each column represents the mean value with standard deviation. † , ∗ , and ∗∗ differ from Group 1, Group 3, and Group 5, respectively ( P

    Techniques Used: Expressing, Quantitative RT-PCR, Standard Deviation

    Changes in expression levels of nephrin and podocin in cultured mouse Sertoli cells, line TM4, following treatment with angiotensin-II and/or candesartan. (a) Total RNA was extracted from TM4 cells and analyzed for nephrin mRNA levels by real-time RT-PCR. Each column represents the mean value with standard deviation. ∗ differs from TM4 cells treated with cisplatin alone ( P
    Figure Legend Snippet: Changes in expression levels of nephrin and podocin in cultured mouse Sertoli cells, line TM4, following treatment with angiotensin-II and/or candesartan. (a) Total RNA was extracted from TM4 cells and analyzed for nephrin mRNA levels by real-time RT-PCR. Each column represents the mean value with standard deviation. ∗ differs from TM4 cells treated with cisplatin alone ( P

    Techniques Used: Expressing, Cell Culture, Quantitative RT-PCR, Standard Deviation

    23) Product Images from "Targeted inhibition of p57 and p15 blocks transforming growth factor ?-inhibited proliferation of primary cultured human limbal epithelial cells"

    Article Title: Targeted inhibition of p57 and p15 blocks transforming growth factor ?-inhibited proliferation of primary cultured human limbal epithelial cells

    Journal: Molecular vision

    doi:

    RNA extraction, RT-PCR and real-time PCR
    Figure Legend Snippet: RNA extraction, RT-PCR and real-time PCR

    Techniques Used: RNA Extraction, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    24) Product Images from "Homozygous deletion of the activin A receptor, type IB gene is associated with an aggressive cancer phenotype in pancreatic cancer"

    Article Title: Homozygous deletion of the activin A receptor, type IB gene is associated with an aggressive cancer phenotype in pancreatic cancer

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-13-126

    Expression of ACVR1B and SMAD4 in PC cell lines. (A) mRNA expression levels of the ACVR1B and SMAD4 genes in normal pancreatic tissue (RNA from Clontech) and PC cell lines. The expressions were analyzed using real-time RT-PCR. ACVR1B mRNA was scarcely expressed in the Sui65 and Sui68 cell lines, and SMAD4 mRNA was also scarcely expressed in the Sui65, Sui70, and Sui71 cell lines. Rel mRNA, normalized mRNA expression levels ( ACVR1B or SMAD4 / GAPD × 10 6 ); Columns, mean of independent triplicate experiments; Bars, SD. (B) Western blot analysis of ACVR1B and SMAD4 in PC cell lines. ACVR1B was scarcely expressed in the Sui65 and Sui68 cell lines. SMAD4 was scarcely expressed in the Sui65, Sui70, and Sui71 cell lines. The findings confirmed the array-comparative genomic hybridization results. β-actin was used as an internal control.
    Figure Legend Snippet: Expression of ACVR1B and SMAD4 in PC cell lines. (A) mRNA expression levels of the ACVR1B and SMAD4 genes in normal pancreatic tissue (RNA from Clontech) and PC cell lines. The expressions were analyzed using real-time RT-PCR. ACVR1B mRNA was scarcely expressed in the Sui65 and Sui68 cell lines, and SMAD4 mRNA was also scarcely expressed in the Sui65, Sui70, and Sui71 cell lines. Rel mRNA, normalized mRNA expression levels ( ACVR1B or SMAD4 / GAPD × 10 6 ); Columns, mean of independent triplicate experiments; Bars, SD. (B) Western blot analysis of ACVR1B and SMAD4 in PC cell lines. ACVR1B was scarcely expressed in the Sui65 and Sui68 cell lines. SMAD4 was scarcely expressed in the Sui65, Sui70, and Sui71 cell lines. The findings confirmed the array-comparative genomic hybridization results. β-actin was used as an internal control.

    Techniques Used: Expressing, Quantitative RT-PCR, Western Blot, Hybridization

    25) Product Images from "Differences in the epigenetic regulation of MT-3 gene expression between parental and Cd+2 or As+3 transformed human urothelial cells"

    Article Title: Differences in the epigenetic regulation of MT-3 gene expression between parental and Cd+2 or As+3 transformed human urothelial cells

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-11-2

    Expression of MT-3 in parent, Cd +2 and As +3 transformed cells after removal of MS-275 . Cells were cultured with 10 μM MS-275 until they reached confluency after which the drug was removed and the cells were allowed to recover for 24 h following which RNA was extracted from the recovered cells. A. RT-PCR analysis of MT-3 expression in UROtsa parent cells. B. RT-PCR analysis of MT-3 expression in Cd +2 transformed UROtsa cells. C. RT-PCR analysis of MT-3 expression in As +3 transformed UROtsa cells. Graphs represent real time RT-PCR data whereas ethidium bromide stained gels show the semiquantitative PCR analysis data. The expression of MT-3 was normalized to that of β-actin. The determinations were performed in triplicates and the results shown are the mean ± SE.*Statistically significant compared to untreated control cells.
    Figure Legend Snippet: Expression of MT-3 in parent, Cd +2 and As +3 transformed cells after removal of MS-275 . Cells were cultured with 10 μM MS-275 until they reached confluency after which the drug was removed and the cells were allowed to recover for 24 h following which RNA was extracted from the recovered cells. A. RT-PCR analysis of MT-3 expression in UROtsa parent cells. B. RT-PCR analysis of MT-3 expression in Cd +2 transformed UROtsa cells. C. RT-PCR analysis of MT-3 expression in As +3 transformed UROtsa cells. Graphs represent real time RT-PCR data whereas ethidium bromide stained gels show the semiquantitative PCR analysis data. The expression of MT-3 was normalized to that of β-actin. The determinations were performed in triplicates and the results shown are the mean ± SE.*Statistically significant compared to untreated control cells.

    Techniques Used: Expressing, Transformation Assay, Mass Spectrometry, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Staining, Polymerase Chain Reaction

    Effect of Zn +2 on MT-3 levels in the parent and transformed UROtsa cell lines . UROtsa parent and the transformed cell lines were seeded at a 1:10 ratio in the presence of MS-275 until they reached confluency, following which the cells were allowed to recover for 24 h without the drug. The cells were then exposed to 100 μM zinc for 24 h and RNA was extracted. A. Real time RT-PCR analysis of MT-3 expression in UROtsa parent cells. B. Real time RT-PCR analysis of MT-3 expression in Cd +2 transformed UROtsa cells. C. Real time RT-PCR analysis of MT-3 expression in As +3 transformed UROtsa cells. The expression of MT-3 was normalized to that of β-actin. The determinations were performed in triplicates and the results shown are the mean ± SE.*Statistically significant compared to untreated control cells. D. Ethidium bromide stained gel showing the expression of MT-3 in the UROtsa cell lines using semiquantitativePCR.
    Figure Legend Snippet: Effect of Zn +2 on MT-3 levels in the parent and transformed UROtsa cell lines . UROtsa parent and the transformed cell lines were seeded at a 1:10 ratio in the presence of MS-275 until they reached confluency, following which the cells were allowed to recover for 24 h without the drug. The cells were then exposed to 100 μM zinc for 24 h and RNA was extracted. A. Real time RT-PCR analysis of MT-3 expression in UROtsa parent cells. B. Real time RT-PCR analysis of MT-3 expression in Cd +2 transformed UROtsa cells. C. Real time RT-PCR analysis of MT-3 expression in As +3 transformed UROtsa cells. The expression of MT-3 was normalized to that of β-actin. The determinations were performed in triplicates and the results shown are the mean ± SE.*Statistically significant compared to untreated control cells. D. Ethidium bromide stained gel showing the expression of MT-3 in the UROtsa cell lines using semiquantitativePCR.

    Techniques Used: Transformation Assay, Mass Spectrometry, Quantitative RT-PCR, Expressing, Staining

    26) Product Images from "Gene expression profiling analysis of CRTC1-MAML2 fusion oncogene-induced transcriptional program in human mucoepidermoid carcinoma cells"

    Article Title: Gene expression profiling analysis of CRTC1-MAML2 fusion oncogene-induced transcriptional program in human mucoepidermoid carcinoma cells

    Journal: BMC Cancer

    doi: 10.1186/s12885-015-1827-3

    Real-time RT-PCR assays validated a subset of CRTC1-MAML2 fusion-regulated genes identified from microarray analysis. a Lentiviral pLKO.1-based shRNAs targeting various regions of the MAML2 gene were indicated. These shRNAs and scramble control shRNA (shCtl) lentiviruses were used to infect the CRTC1-MAML2 fusion-expressing H3118 MEC cells and the infected cells were processed to isolate protein lysates for Western blotting analysis and RNA for real-time RT-PCR assays. b Western blot analysis showed shM2-1 or shM2-3 led to the knockdown of MAML2 and fusion, whereas that shM2-B1 or shM2-C1 caused MAML2 knockdown only. It is noted that another shRNA, shM2-A1 targeting the exon 1 of MAML2 did not cause MAML2 knockdown. c , d Real-time RT-PCR analyses showed that knockdown of both CRTC1-MAML2 fusion and MAML2 in H3118 MEC cells led to reduced transcripts levels of a known target AREG and a subset of novel fusion target genes, including LINC00473, DMBT1, STC1, PDE4B, RUNX1, PTGS1, TGFB2, ODC1, and CDK6 ( c ), whereas MAML2 knockdown in H3118 MEC cells did not significantly affect their expression ( d ). The level of CRTC1-MAML2 fusion transcript was determined using a primer set that spans the chromosomal translocation breakpoint. The level of MAML2 knockdown was determined using the primers that amplify the exon 1 of MAML2. Data are presented as mean ± S.E. ( n = 3, * p
    Figure Legend Snippet: Real-time RT-PCR assays validated a subset of CRTC1-MAML2 fusion-regulated genes identified from microarray analysis. a Lentiviral pLKO.1-based shRNAs targeting various regions of the MAML2 gene were indicated. These shRNAs and scramble control shRNA (shCtl) lentiviruses were used to infect the CRTC1-MAML2 fusion-expressing H3118 MEC cells and the infected cells were processed to isolate protein lysates for Western blotting analysis and RNA for real-time RT-PCR assays. b Western blot analysis showed shM2-1 or shM2-3 led to the knockdown of MAML2 and fusion, whereas that shM2-B1 or shM2-C1 caused MAML2 knockdown only. It is noted that another shRNA, shM2-A1 targeting the exon 1 of MAML2 did not cause MAML2 knockdown. c , d Real-time RT-PCR analyses showed that knockdown of both CRTC1-MAML2 fusion and MAML2 in H3118 MEC cells led to reduced transcripts levels of a known target AREG and a subset of novel fusion target genes, including LINC00473, DMBT1, STC1, PDE4B, RUNX1, PTGS1, TGFB2, ODC1, and CDK6 ( c ), whereas MAML2 knockdown in H3118 MEC cells did not significantly affect their expression ( d ). The level of CRTC1-MAML2 fusion transcript was determined using a primer set that spans the chromosomal translocation breakpoint. The level of MAML2 knockdown was determined using the primers that amplify the exon 1 of MAML2. Data are presented as mean ± S.E. ( n = 3, * p

    Techniques Used: Quantitative RT-PCR, Microarray, shRNA, Expressing, Infection, Western Blot, Translocation Assay

    27) Product Images from "Effects of hyperglycemia and oxidative stress on the glutamate transporters GLAST and system xc− in mouse retinal M?ller glial cells"

    Article Title: Effects of hyperglycemia and oxidative stress on the glutamate transporters GLAST and system xc− in mouse retinal M?ller glial cells

    Journal: Cell and tissue research

    doi: 10.1007/s00441-008-0742-1

    Effect of oxidative stress on GLAST and system x c − gene expression. Mouse Müller cells were treated 6 h with 70 μM xanthine:14 mU/ml xanthine oxidase, RNA was collected and analyzed by semi-quantitative PCR. Representative gels
    Figure Legend Snippet: Effect of oxidative stress on GLAST and system x c − gene expression. Mouse Müller cells were treated 6 h with 70 μM xanthine:14 mU/ml xanthine oxidase, RNA was collected and analyzed by semi-quantitative PCR. Representative gels

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    28) Product Images from "Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1"

    Article Title: Human PPP1R26P1 Functions as cis-Repressive Element in Mouse Rb1

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0074159

    Transcription at CpG85. A) Expression of the transcript is elevated towards the 3’-end of CpG85. Quantitative RT-PCR with primer / probe assays (localization is shown in Figure 3B top) demonstrates significantly higher expression at the more 3’-end of CpG85. For comparison, expression of Rb1 is shown as measured with assays at exons 4/6 and exons 18/19. Analysis was conducted in six independent clones in two biological and two technical replicates, respectively. Expression levels are normalized to the level of β-actin. The p-value was calculated using the Welch two-sample test. B) RNA polymerase II (RNAPII) is enriched at the 3’ end of CpG85. Presence of initiating and elongating RNAPII at the Rb1 and CpG85 promoters was tested for by ChIP. Top: schemes showing localization of primer / probe assays for qPCR over the Rb1 promoter (three assays) and CpG85 (four assays), as well as the mapped transcriptional start sites in CpG85. Results are depicted as % input and the non-related antibody (against PML protein) control is shown in black. Both types of RNAPII could be found at both promoters. Three independent experiments are shown, one in cells with genotype SNV_ PPP1R26P1 /wt and two in independent clones of genotype SNV / PPP1R26P1 .
    Figure Legend Snippet: Transcription at CpG85. A) Expression of the transcript is elevated towards the 3’-end of CpG85. Quantitative RT-PCR with primer / probe assays (localization is shown in Figure 3B top) demonstrates significantly higher expression at the more 3’-end of CpG85. For comparison, expression of Rb1 is shown as measured with assays at exons 4/6 and exons 18/19. Analysis was conducted in six independent clones in two biological and two technical replicates, respectively. Expression levels are normalized to the level of β-actin. The p-value was calculated using the Welch two-sample test. B) RNA polymerase II (RNAPII) is enriched at the 3’ end of CpG85. Presence of initiating and elongating RNAPII at the Rb1 and CpG85 promoters was tested for by ChIP. Top: schemes showing localization of primer / probe assays for qPCR over the Rb1 promoter (three assays) and CpG85 (four assays), as well as the mapped transcriptional start sites in CpG85. Results are depicted as % input and the non-related antibody (against PML protein) control is shown in black. Both types of RNAPII could be found at both promoters. Three independent experiments are shown, one in cells with genotype SNV_ PPP1R26P1 /wt and two in independent clones of genotype SNV / PPP1R26P1 .

    Techniques Used: Expressing, Quantitative RT-PCR, Clone Assay, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction

    29) Product Images from "The Human Retinoblastoma Gene Is Imprinted"

    Article Title: The Human Retinoblastoma Gene Is Imprinted

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1000790

    Allelic expression imbalance of the RB1 gene. Plot of the ratio of allelic expression as determined by SNaPshot primer extension on RT–PCR products obtained from RNA from blood of 14 individuals from 7 families informative for expressed variants ( Table 1 ). The primer extension assay for the variant in exon 3 (family A) only detects the regular transcript whereas the assays for the variants downstream of exon 3 (families B to G) detect transcripts initiated in exon 2B in addition to regular transcripts. Of note, direction and extent of skewing in family A are not different from that in the other families and, therefore, the relative abundance of 2B-transcripts compared to regular transcripts is likely to be low. For each sample 3–5 independent experiments were performed. The top and bottom of the means diamonds represent the 95% confidence intervals for the means. Squares, male individuals; circles, female individuals; filled symbols, bilateral retinoblastoma; half-filled symbols, unilateral retinoblastoma; open symbols, unaffected. Asterisk marks individuals in whom parental origin of alleles is unknown.
    Figure Legend Snippet: Allelic expression imbalance of the RB1 gene. Plot of the ratio of allelic expression as determined by SNaPshot primer extension on RT–PCR products obtained from RNA from blood of 14 individuals from 7 families informative for expressed variants ( Table 1 ). The primer extension assay for the variant in exon 3 (family A) only detects the regular transcript whereas the assays for the variants downstream of exon 3 (families B to G) detect transcripts initiated in exon 2B in addition to regular transcripts. Of note, direction and extent of skewing in family A are not different from that in the other families and, therefore, the relative abundance of 2B-transcripts compared to regular transcripts is likely to be low. For each sample 3–5 independent experiments were performed. The top and bottom of the means diamonds represent the 95% confidence intervals for the means. Squares, male individuals; circles, female individuals; filled symbols, bilateral retinoblastoma; half-filled symbols, unilateral retinoblastoma; open symbols, unaffected. Asterisk marks individuals in whom parental origin of alleles is unknown.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Primer Extension Assay, Variant Assay

    Treatment of lymphoblastoid cells (LCs) with the demethylation drug 5-aza-2′-deoxycytidine (AzadC). (A) Methylation analysis of CpG 85 by methylation-specific PCR (MS-PCR) and quantification of allelic expression imbalance of the RB1 gene. The top chart shows the methylation status of CpG 85 in blood, mock-treated and AzadC-treated LCs. The percentage of MS-PCR products specific for methylated and unmethylated alleles is indicated by black and grey bars, respectively. The bottom plot shows the ratio of allelic expression as determined by SNaPshot primer extension on RT–PCR products obtained from RNA. For each sample 3–8 independent experiments were performed. The top and bottom of the means diamonds represent the 95% confidence interval for the means. In family H, we could not investigate allelic RB1 expression in blood, because we did not have RNA from fresh blood. In this family, a male patient with unilateral retinoblastoma (HII-1) inherited the rare variant from his unaffected mother and transmitted it to his unaffected daughter (HIII-1). (B) Electropherograms of SNaPshot primer extension on RT–PCR products specific for the 2B-transcript. Black and red peaks correspond to C and T alleles, respectively. In A III-1, the C allele is known to be of paternal origin. Numbers next to peaks indicate peak areas. Numbers below electropherograms with two peaks show the ratios of peak areas (T-allele/C-allele).
    Figure Legend Snippet: Treatment of lymphoblastoid cells (LCs) with the demethylation drug 5-aza-2′-deoxycytidine (AzadC). (A) Methylation analysis of CpG 85 by methylation-specific PCR (MS-PCR) and quantification of allelic expression imbalance of the RB1 gene. The top chart shows the methylation status of CpG 85 in blood, mock-treated and AzadC-treated LCs. The percentage of MS-PCR products specific for methylated and unmethylated alleles is indicated by black and grey bars, respectively. The bottom plot shows the ratio of allelic expression as determined by SNaPshot primer extension on RT–PCR products obtained from RNA. For each sample 3–8 independent experiments were performed. The top and bottom of the means diamonds represent the 95% confidence interval for the means. In family H, we could not investigate allelic RB1 expression in blood, because we did not have RNA from fresh blood. In this family, a male patient with unilateral retinoblastoma (HII-1) inherited the rare variant from his unaffected mother and transmitted it to his unaffected daughter (HIII-1). (B) Electropherograms of SNaPshot primer extension on RT–PCR products specific for the 2B-transcript. Black and red peaks correspond to C and T alleles, respectively. In A III-1, the C allele is known to be of paternal origin. Numbers next to peaks indicate peak areas. Numbers below electropherograms with two peaks show the ratios of peak areas (T-allele/C-allele).

    Techniques Used: Methylation, Polymerase Chain Reaction, Mass Spectrometry, Expressing, Reverse Transcription Polymerase Chain Reaction, Variant Assay

    30) Product Images from "HCMV Protein LUNA Is Required for Viral Reactivation from Latently Infected Primary CD14+ Cells"

    Article Title: HCMV Protein LUNA Is Required for Viral Reactivation from Latently Infected Primary CD14+ Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0052827

    LUNA protein expression is not required for lytic gene expression, but does augment the expression of the UL138 transcript. HF cells infected at an MOI = 1 with either FIX-WT, FIX-ΔLUNA and FIX-Rev were harvested at the indicated time points for either RNA or protein analysis. A) Expression of viral RNAs. Total RNA was collected over a 20 d time course together with mock RNA. From all the collected RNA samples cDNA was synthesized and amplified using UL82, UL123, UL81-82ast, UL138 and β-actin specific primers. Negative images were used to visualize weaker bands. B) qRT-PCR analysis was used to assay gene expression of UL138 at the indicated times post infection. Viral mRNA was normalized to actin. Asterisks indicate significant changes (p value
    Figure Legend Snippet: LUNA protein expression is not required for lytic gene expression, but does augment the expression of the UL138 transcript. HF cells infected at an MOI = 1 with either FIX-WT, FIX-ΔLUNA and FIX-Rev were harvested at the indicated time points for either RNA or protein analysis. A) Expression of viral RNAs. Total RNA was collected over a 20 d time course together with mock RNA. From all the collected RNA samples cDNA was synthesized and amplified using UL82, UL123, UL81-82ast, UL138 and β-actin specific primers. Negative images were used to visualize weaker bands. B) qRT-PCR analysis was used to assay gene expression of UL138 at the indicated times post infection. Viral mRNA was normalized to actin. Asterisks indicate significant changes (p value

    Techniques Used: Expressing, Infection, Synthesized, Amplification, Quantitative RT-PCR, Significance Assay

    FIX-ΔLUNA infected CD14+ cells fail to express lytic transcripts following IL6 induced differentiation. A) Diagram of the timeline of infection. Infected cells were collected at 1–20 dpi, IL6 was added at 10 dpi to induce cellular differentiation, after which two additional time points were collected. B) Expression of viral RNAs in FIX-WT, FIX-ΔLUNA and FIX-Rev infected CD14 + cells (MOI = 1). Total RNA was collected over a 20 d time course together with mock RNA. At 10 dpi CD14 + cells were differentiated with IL-6. Five and ten days post differentiation, RNA samples were collected (these samples were termed as 15 d-IL6 and 20 d-IL6). From all the collected RNA samples cDNA was synthesized and amplified using UL82, UL123, UL81-82ast, UL138 and β-actin specific primers. Negative images were used to visualize weaker bands. C) CD14 + cells were infected at an MOI = 1 with FIX-WT, FIX-ΔLUNA or FIX-Rev. D–E) Protein was isolated from infected CD14 + cells at the indicated time points and subjected to western blot analysis. Blots were probed with either a rabbit monoclonal a-LUNA or a mouse monoclonal a-IE1 antibody along with a-Tubulin as a loading control. qRT-PCR analysis was used to assay gene expression of UL138, vIL10 and US28 at the indicated times post infection. Viral mRNA was normalized to actin. All samples were tested in triplicate. Abbreviations used: d, days post infection., Mo; mock. IL6 was added at 10 dpi.
    Figure Legend Snippet: FIX-ΔLUNA infected CD14+ cells fail to express lytic transcripts following IL6 induced differentiation. A) Diagram of the timeline of infection. Infected cells were collected at 1–20 dpi, IL6 was added at 10 dpi to induce cellular differentiation, after which two additional time points were collected. B) Expression of viral RNAs in FIX-WT, FIX-ΔLUNA and FIX-Rev infected CD14 + cells (MOI = 1). Total RNA was collected over a 20 d time course together with mock RNA. At 10 dpi CD14 + cells were differentiated with IL-6. Five and ten days post differentiation, RNA samples were collected (these samples were termed as 15 d-IL6 and 20 d-IL6). From all the collected RNA samples cDNA was synthesized and amplified using UL82, UL123, UL81-82ast, UL138 and β-actin specific primers. Negative images were used to visualize weaker bands. C) CD14 + cells were infected at an MOI = 1 with FIX-WT, FIX-ΔLUNA or FIX-Rev. D–E) Protein was isolated from infected CD14 + cells at the indicated time points and subjected to western blot analysis. Blots were probed with either a rabbit monoclonal a-LUNA or a mouse monoclonal a-IE1 antibody along with a-Tubulin as a loading control. qRT-PCR analysis was used to assay gene expression of UL138, vIL10 and US28 at the indicated times post infection. Viral mRNA was normalized to actin. All samples were tested in triplicate. Abbreviations used: d, days post infection., Mo; mock. IL6 was added at 10 dpi.

    Techniques Used: Infection, Cell Differentiation, Expressing, Synthesized, Amplification, Isolation, Western Blot, Quantitative RT-PCR

    31) Product Images from "A novel mechanism of lncRNA and miRNA interaction: CCAT2 regulates miR-145 expression by suppressing its maturation process in colon cancer cells"

    Article Title: A novel mechanism of lncRNA and miRNA interaction: CCAT2 regulates miR-145 expression by suppressing its maturation process in colon cancer cells

    Journal: Molecular Cancer

    doi: 10.1186/s12943-017-0725-5

    CCAT2 regulates miR-145 expression by directly suppressing its processing. Digoxigenin labeled 200 ng of pri-miR-145 (668 base) containing 1 μg of total RNAs from the CCAT2 overexpressing or knockout (KO) colon cancer cells was incubated at 25 °C for 5 min; 1unit of recombinant Dicer was added and incubated at 37 °C for 60 min. The samples were divided into two parts: ( a ) performed RT-PCR to detect CCAT2, pri-, pre- and mature miR-145. Agarose (3%) chromatography demonstrates changes in PCR products. ( b ) carried out electrophoresis on 8% polyacrylamide-8M urea gel, subsequently transferred onto membrane and the Dig-labeled RNAs detected with anti-digoxigenin antibody. M: 100 bp DNA (A) or RNA ladder (B), Lane-1: pri-miR-145, Lane-2: pri-miR-145 + Dicer, Lane-3: pri-miR-145 + RNA of CR-HT29 + Dicer, Lane-4: pri-miR-145 + RNA of CR-HT29/CCAT2 + Dicer, Lane-5: pri-miR-145 + RNA of HCT-116 + Dicer, Lane-6: pri-miR-145 + RNA of HCT-116/CCAT2 + Dicer, Lane-7: pri-miR-145 + RNA of HCT-116/KO-CCAT2 + Dicer
    Figure Legend Snippet: CCAT2 regulates miR-145 expression by directly suppressing its processing. Digoxigenin labeled 200 ng of pri-miR-145 (668 base) containing 1 μg of total RNAs from the CCAT2 overexpressing or knockout (KO) colon cancer cells was incubated at 25 °C for 5 min; 1unit of recombinant Dicer was added and incubated at 37 °C for 60 min. The samples were divided into two parts: ( a ) performed RT-PCR to detect CCAT2, pri-, pre- and mature miR-145. Agarose (3%) chromatography demonstrates changes in PCR products. ( b ) carried out electrophoresis on 8% polyacrylamide-8M urea gel, subsequently transferred onto membrane and the Dig-labeled RNAs detected with anti-digoxigenin antibody. M: 100 bp DNA (A) or RNA ladder (B), Lane-1: pri-miR-145, Lane-2: pri-miR-145 + Dicer, Lane-3: pri-miR-145 + RNA of CR-HT29 + Dicer, Lane-4: pri-miR-145 + RNA of CR-HT29/CCAT2 + Dicer, Lane-5: pri-miR-145 + RNA of HCT-116 + Dicer, Lane-6: pri-miR-145 + RNA of HCT-116/CCAT2 + Dicer, Lane-7: pri-miR-145 + RNA of HCT-116/KO-CCAT2 + Dicer

    Techniques Used: Expressing, Labeling, Knock-Out, Incubation, Recombinant, Reverse Transcription Polymerase Chain Reaction, Chromatography, Polymerase Chain Reaction, Electrophoresis

    Localization of CCAT2 in CR-HT-29 or HCT-116 cells by qRT-PCR and FISH. qRT-PCR was performed with RNA isolated from nuclear and cytoplasmic fraction of stably over-expressing CCAT2 cells to determine its expression in CR-HT-29 and HCT-116 cells ( a and b ). All the data represent means ± SEM, * P
    Figure Legend Snippet: Localization of CCAT2 in CR-HT-29 or HCT-116 cells by qRT-PCR and FISH. qRT-PCR was performed with RNA isolated from nuclear and cytoplasmic fraction of stably over-expressing CCAT2 cells to determine its expression in CR-HT-29 and HCT-116 cells ( a and b ). All the data represent means ± SEM, * P

    Techniques Used: Quantitative RT-PCR, Fluorescence In Situ Hybridization, Isolation, Stable Transfection, Expressing

    32) Product Images from "Phosphorylation of SRSF1 is modulated by replicational stress"

    Article Title: Phosphorylation of SRSF1 is modulated by replicational stress

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkr837

    The alternative splicing of SRSF1 is modified in 46BR.1G1 cells and is regulated in response to UV-light. ( A ) Schematic representation of alternative splicing in the 3′-UTR of SRSF1 transcripts. FL, full-length transcript of SRSF1; NMD + , splicing variant associated with the non-sense mediated mRNA decay pathway. ( B ) Total RNA from 46BR.1G1, 7A3 and MRC.5V1 cell lines was analyzed by RT–PCR with primers that recognized both the FL and NMD + mRNAs of SRSF1 (arrows) and with specific primers for the GAPDH control mRNA. The asterisk indicates an unspecific PCR product. M, DNA size markers. ( C ) Total RNA from the MRC-5V1 control fibroblasts untreated or treated with different damaging agents was analyzed by RT–PCR (30 cycles) as in (B) with primers specific for SRSF1 and GAPDH mRNAs. The asterisk indicates an unspecific PCR product. ( D ) Total RNA was purified from MRC-5V1 3 h after exposure to the indicated UV doses and analyzed by RT–PCR (25 cycles) with primers that recognized both the FL and the NMD + mRNA of SRSF1 (arrows) and with primers for the GAPDH control mRNAs. M, DNA size markers. The ratio between FL and NMD + bands indicated under each line was calculated on the basis of the intensity of the bands quantified with the NIH ImageJ 1.43.
    Figure Legend Snippet: The alternative splicing of SRSF1 is modified in 46BR.1G1 cells and is regulated in response to UV-light. ( A ) Schematic representation of alternative splicing in the 3′-UTR of SRSF1 transcripts. FL, full-length transcript of SRSF1; NMD + , splicing variant associated with the non-sense mediated mRNA decay pathway. ( B ) Total RNA from 46BR.1G1, 7A3 and MRC.5V1 cell lines was analyzed by RT–PCR with primers that recognized both the FL and NMD + mRNAs of SRSF1 (arrows) and with specific primers for the GAPDH control mRNA. The asterisk indicates an unspecific PCR product. M, DNA size markers. ( C ) Total RNA from the MRC-5V1 control fibroblasts untreated or treated with different damaging agents was analyzed by RT–PCR (30 cycles) as in (B) with primers specific for SRSF1 and GAPDH mRNAs. The asterisk indicates an unspecific PCR product. ( D ) Total RNA was purified from MRC-5V1 3 h after exposure to the indicated UV doses and analyzed by RT–PCR (25 cycles) with primers that recognized both the FL and the NMD + mRNA of SRSF1 (arrows) and with primers for the GAPDH control mRNAs. M, DNA size markers. The ratio between FL and NMD + bands indicated under each line was calculated on the basis of the intensity of the bands quantified with the NIH ImageJ 1.43.

    Techniques Used: Modification, Variant Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Purification

    33) Product Images from "Cripto-1 contributes to stemness in hepatocellular carcinoma by stabilizing Dishevelled-3 and activating Wnt/β-catenin pathway"

    Article Title: Cripto-1 contributes to stemness in hepatocellular carcinoma by stabilizing Dishevelled-3 and activating Wnt/β-catenin pathway

    Journal: Cell Death and Differentiation

    doi: 10.1038/s41418-018-0059-x

    Cripto-1 levels in HCC clinical samples carry prognostic significance and are correlated with AXIN2 expressions. a Cripto-1 was significantly upregulated in HCC tumor tissues (T) versus the corresponding non-tumorous liver tissues (NT) from both in-house RNA sequencing dataset ( n = 16) and the TCGA database ( n = 50). b Cripto-1 level was significantly upregulated in HCC tumor (T) versus non-tumorous liver (NT) tissues by qRT-PCR ( n = 77, ** p
    Figure Legend Snippet: Cripto-1 levels in HCC clinical samples carry prognostic significance and are correlated with AXIN2 expressions. a Cripto-1 was significantly upregulated in HCC tumor tissues (T) versus the corresponding non-tumorous liver tissues (NT) from both in-house RNA sequencing dataset ( n = 16) and the TCGA database ( n = 50). b Cripto-1 level was significantly upregulated in HCC tumor (T) versus non-tumorous liver (NT) tissues by qRT-PCR ( n = 77, ** p

    Techniques Used: RNA Sequencing Assay, Quantitative RT-PCR

    34) Product Images from "Combination of dasatinib and curcumin eliminates chemo-resistant colon cancer cells"

    Article Title: Combination of dasatinib and curcumin eliminates chemo-resistant colon cancer cells

    Journal: Journal of Molecular Signaling

    doi: 10.1186/1750-2187-6-7

    Relative expression of various cancer stem cell markers in tumor remnants from APC Min +/- mice treated with dasatinib and/or curcumin as determined by RT-PCR . Tissue was procured from our previous study where Female Min mice (5 weeks; female C57BL/6J- APC Min +/- ) were treated with dasatinib (10 mg/kg body weight) and/or curcumin (250 mg/kg body weight). The treatment was given for five consecutive days per week for 4 weeks. At the end of respective treatments, the mice were euthanized and tumor remnants were obtained as described previously [ 30 ]. RNA isolated from the tissue was analyzed for expression of different CSCs specific markers.
    Figure Legend Snippet: Relative expression of various cancer stem cell markers in tumor remnants from APC Min +/- mice treated with dasatinib and/or curcumin as determined by RT-PCR . Tissue was procured from our previous study where Female Min mice (5 weeks; female C57BL/6J- APC Min +/- ) were treated with dasatinib (10 mg/kg body weight) and/or curcumin (250 mg/kg body weight). The treatment was given for five consecutive days per week for 4 weeks. At the end of respective treatments, the mice were euthanized and tumor remnants were obtained as described previously [ 30 ]. RNA isolated from the tissue was analyzed for expression of different CSCs specific markers.

    Techniques Used: Expressing, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Isolation

    35) Product Images from "A Novel DBL-Domain of the P. falciparum 332 Molecule Possibly Involved in Erythrocyte Adhesion"

    Article Title: A Novel DBL-Domain of the P. falciparum 332 Molecule Possibly Involved in Erythrocyte Adhesion

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0000477

    Structural analysis of the gene encoding Pf332. A. Schematic structure of the Pf332 gene. The gene is composed of a 5′ exon I (PF11_0506) with a size of 1704 bp and a 3′ exon II (PF11_0507), separated by a short intron of 236 bp. The 3′-exon II is the gene fragment previously referred to as the gene coding for the antigen Pf332. The location of the primers is indicated as arrows. B. PCR amplification from cDNA and gDNA across the intron region of the Pf332 gene: Lane 1: PCR amplification with primers UP3 and UP4 from cDNA; lane 2: PCR amplification with the same primer pair from gDNA. C. Northernblot with probes located at 5′-end (UP1–UP2) and across the splicing site (UP3–UP4) of the Pf332 gene. Total RNA from 3D7AH1 iRBC was resolved in an agarose gel (lanes 1 and 3). Lane 2 shows the hybridisation with the first probe (UP1–UP2); lane 4 shows the hybridisation with the second probe (UP3–UP4) revealing a band of the same size as seen in the first hybridization.
    Figure Legend Snippet: Structural analysis of the gene encoding Pf332. A. Schematic structure of the Pf332 gene. The gene is composed of a 5′ exon I (PF11_0506) with a size of 1704 bp and a 3′ exon II (PF11_0507), separated by a short intron of 236 bp. The 3′-exon II is the gene fragment previously referred to as the gene coding for the antigen Pf332. The location of the primers is indicated as arrows. B. PCR amplification from cDNA and gDNA across the intron region of the Pf332 gene: Lane 1: PCR amplification with primers UP3 and UP4 from cDNA; lane 2: PCR amplification with the same primer pair from gDNA. C. Northernblot with probes located at 5′-end (UP1–UP2) and across the splicing site (UP3–UP4) of the Pf332 gene. Total RNA from 3D7AH1 iRBC was resolved in an agarose gel (lanes 1 and 3). Lane 2 shows the hybridisation with the first probe (UP1–UP2); lane 4 shows the hybridisation with the second probe (UP3–UP4) revealing a band of the same size as seen in the first hybridization.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Hybridization

    36) Product Images from "Characterization of RNA in Saliva"

    Article Title: Characterization of RNA in Saliva

    Journal: Clinical Chemistry

    doi: 10.1373/clinchem.2005.063206

    Measurement of RNA from different oral fluids. WS , supernatant of whole saliva; SM , submandibular saliva; SL , sublingual saliva; P , parotid saliva; OEC , oral epithelial cells. ( A ), RT-PCR of oral fluids obtained from 6 participants ( lanes 1–6 ) with β-actin primers. Oral fluids were collected as described in the Materials and Methods . PCR was performed for 45 cycles. ( B ), RNA in oral fluid samples from 1 participant was analyzed by U133 plus 2.0 expression-based microarray (Affymetrix). ▦, total number of genes present in each site; □, numbers of NSCT genes.
    Figure Legend Snippet: Measurement of RNA from different oral fluids. WS , supernatant of whole saliva; SM , submandibular saliva; SL , sublingual saliva; P , parotid saliva; OEC , oral epithelial cells. ( A ), RT-PCR of oral fluids obtained from 6 participants ( lanes 1–6 ) with β-actin primers. Oral fluids were collected as described in the Materials and Methods . PCR was performed for 45 cycles. ( B ), RNA in oral fluid samples from 1 participant was analyzed by U133 plus 2.0 expression-based microarray (Affymetrix). ▦, total number of genes present in each site; □, numbers of NSCT genes.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Expressing, Microarray

    Integrity measurement of salivary RNA. ( A ), list of 5 NSCT genes, their cDNA length, and expected sizes of PCR amplicons shown in panels B and C . The 3 ′ and 5 ′ in parentheses indicate the location of amplicons on the gene. The m/3 ′ in parentheses for β-actin indicates that the amplification region is located between the middle and the 3′ end of the β-actin mRNA. ( B ), RT-PCR of salivary RNA with primers that yield short PCR amplicons. For RNA isolation, 560 μL of the supernatant phase of saliva was used. PCR was done for 40 cycles. Lanes 1–8 represent salivary RNA from 8 different participants. Lane 3 * contains 5-fold more RNA starting material than lane 3 , and PCR was done for 45 cycles instead of 40 cycles. Lane (–) represents a negative control, for which an equal volume of water was used during the PCR instead of the reverse transcription products. ( C ), salivary RNA from the same participants as in panel B was used for RT-PCR (45 cycles) that yielded long PCR amplicons. The inset indicated by (+) next to the GAPDH gel image shows the result of the positive control, in which RT-PCR was performed with RNA isolated from the MCF7 cell line. SAT product for participant 8 ( lane 8 ) gave triplicate bands, none of which matched the expected PCR size (∗). ( D and E ), RT-qPCR of salivary RNA from 8 participants with β-actin ( D ) and IL8 ( E ) primers that target different regions of β-actin and IL8 mRNAs as indicated. Thick horizontal lines indicate the medians. The boxes represent the interval between the 25th and 75th percentiles. Maximum and minimum values are indicated by the vertical lines .
    Figure Legend Snippet: Integrity measurement of salivary RNA. ( A ), list of 5 NSCT genes, their cDNA length, and expected sizes of PCR amplicons shown in panels B and C . The 3 ′ and 5 ′ in parentheses indicate the location of amplicons on the gene. The m/3 ′ in parentheses for β-actin indicates that the amplification region is located between the middle and the 3′ end of the β-actin mRNA. ( B ), RT-PCR of salivary RNA with primers that yield short PCR amplicons. For RNA isolation, 560 μL of the supernatant phase of saliva was used. PCR was done for 40 cycles. Lanes 1–8 represent salivary RNA from 8 different participants. Lane 3 * contains 5-fold more RNA starting material than lane 3 , and PCR was done for 45 cycles instead of 40 cycles. Lane (–) represents a negative control, for which an equal volume of water was used during the PCR instead of the reverse transcription products. ( C ), salivary RNA from the same participants as in panel B was used for RT-PCR (45 cycles) that yielded long PCR amplicons. The inset indicated by (+) next to the GAPDH gel image shows the result of the positive control, in which RT-PCR was performed with RNA isolated from the MCF7 cell line. SAT product for participant 8 ( lane 8 ) gave triplicate bands, none of which matched the expected PCR size (∗). ( D and E ), RT-qPCR of salivary RNA from 8 participants with β-actin ( D ) and IL8 ( E ) primers that target different regions of β-actin and IL8 mRNAs as indicated. Thick horizontal lines indicate the medians. The boxes represent the interval between the 25th and 75th percentiles. Maximum and minimum values are indicated by the vertical lines .

    Techniques Used: Polymerase Chain Reaction, Amplification, Reverse Transcription Polymerase Chain Reaction, Isolation, Negative Control, Positive Control, Quantitative RT-PCR

    37) Product Images from "Angiotensin-II-induced apoptosis requires regulation of nucleolin and Bcl-xL by SHP-2 in primary lung endothelial cells"

    Article Title: Angiotensin-II-induced apoptosis requires regulation of nucleolin and Bcl-xL by SHP-2 in primary lung endothelial cells

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.063545

    Ang II reduces nucleolin binding to the 3′UTR of Bcl-x L mRNA. ( A ) Total RNA of untreated PAECs was extracted and PCR amplified for all three Bcl-x L AU-rich sites and for GAPDH as a control (top left and right images). RNA-IP of nucleolin was also
    Figure Legend Snippet: Ang II reduces nucleolin binding to the 3′UTR of Bcl-x L mRNA. ( A ) Total RNA of untreated PAECs was extracted and PCR amplified for all three Bcl-x L AU-rich sites and for GAPDH as a control (top left and right images). RNA-IP of nucleolin was also

    Techniques Used: Binding Assay, Polymerase Chain Reaction, Amplification

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Follicular Dendritic Cells and Human Immunodeficiency Virus Type 1 Transcription in CD4+ T Cells ▿
    Article Snippet: .. RNA from equal numbers of cells was reverse transcribed using a GeneAmp RNA PCR kit (Applied Biosystems; Foster City, CA) as directed with oligo(dT) or random hexamer primers (Applied Biosystems). .. PCR amplification was performed in parallel for different numbers of cycles to ensure that comparative analysis occurred during the linear phase of the amplification process.

    Article Title: Thrombopoietin initiates demethylation-based transcription of GP6 during megakaryocyte differentiation
    Article Snippet: .. Total RNA was reverse transcribed using the GeneAmp RNA PCR kit (Applied Biosystems Japan, Tokyo, Japan). .. The PCR primers used were as follows: GPVI forward, 5′-CTCAGGACAGGGCTGAGGAA-3′; GPVI reverse, 5′-GGATGAAGAGGACTGCCTGA-3′; glyceraldehyde phosphate dehydrogenase (GAPDH) forward, 5′-GAAGGTGAAGGTCGGAGT-3′; and GAPDH reverse, 5′-CTTCTACCACTACCCTAAAG-3′.

    Article Title: NFATc1 Regulates Programmed Death-1 Expression Upon T Cell Activation 1
    Article Snippet: .. Two micrograms of total RNA were used for each reverse transcriptase reaction carried out using the GeneAmp RNA PCR kit (Applied Biosystems, Inc., Foster City, CA). .. Real-time PCR was used to quantify the amount of PD-1 mRNA and results were normalized to that of 18S ribosomal RNA.

    Article Title: Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay
    Article Snippet: .. 2.4 Real-time RT-PCR Duplicates of the standard dilutions and RNA templates were subjected simultaneously to reverse transcription with the GeneAmp® RNA PCR kit (Applied Biosystems, Applera Italia, Monza, Italy). .. One microlitre of each duplicate of the standard dilutions or template RNA was reverse transcribed in a 20-μl reaction volume containing PCR buffer 1× (KCl 50 mM, Tris–HCl 10 mM, pH 8.3), MgCl2 5 mM, 1 mM of each deoxynucleotide (dATP, dCTP, dGTP, dTTP), RNase Inhibitor 1 U, MuLV reverse transcriptase 2.5 U, random hexamers 2.5 U. Synthesis of c-DNA was carried out at 42 °C for 30 min, followed by a denaturation step at 99 °C for 5 min. Real-time PCR for the simultaneous detection and quantification of BCoV RNA was performed on a 7500 Real-time PCR System (Applied Biosystems) with iTaq™ Supermix added with ROX (Bio-Rad Laboratories Srl, Milan, Italy).

    Article Title: Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism
    Article Snippet: .. Total RNAs were extracted by using TRIzol reagent (Invitrogen) and reverse-transcribed by using random hexamer primers, and PCR was performed by using a GeneAmp RNA PCR kit and an AmpliTaq Gold DNA polymerase with 2.5 mM MgCl2 (Applied Biosystems). .. For the first round of amplification of E1^E4 cDNAs, the primers were 5′-ACA AGCAGA ACCGGAC-3′ and 5′-CTCTGATCTTGGTCGCTG-3′.

    Article Title: The Origin of the RB1 Imprint
    Article Snippet: .. Expression analysis RT-PCRs were performed with the GeneAmp RNA PCR Kit (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Derivation of Induced Pluripotent Stem Cells from the Baboon: A Nonhuman Primate Model for Preclinical Testing of Stem Cell Therapies
    Article Snippet: .. RNA was dialyzed for 30 min against RNase/DNase-free distilled water. cDNA was synthesized using the GeneAmp RNA PCR kit from Applied Biosciences (Fisher). .. Primers for the individual PCR reactions were: OCT4 , forward, GTGCCGTGAAGCTGGAGAAGGA, reverse, ACCTTCCCAAATAGAACCCCCAGG; SOX2 , forward.

    Random Hexamer Labeling:

    Article Title: Follicular Dendritic Cells and Human Immunodeficiency Virus Type 1 Transcription in CD4+ T Cells ▿
    Article Snippet: .. RNA from equal numbers of cells was reverse transcribed using a GeneAmp RNA PCR kit (Applied Biosystems; Foster City, CA) as directed with oligo(dT) or random hexamer primers (Applied Biosystems). .. PCR amplification was performed in parallel for different numbers of cycles to ensure that comparative analysis occurred during the linear phase of the amplification process.

    Article Title: Propagation of infectious human papillomavirus type 16 by using an adenovirus and Cre/LoxP mechanism
    Article Snippet: .. Total RNAs were extracted by using TRIzol reagent (Invitrogen) and reverse-transcribed by using random hexamer primers, and PCR was performed by using a GeneAmp RNA PCR kit and an AmpliTaq Gold DNA polymerase with 2.5 mM MgCl2 (Applied Biosystems). .. For the first round of amplification of E1^E4 cDNAs, the primers were 5′-ACA AGCAGA ACCGGAC-3′ and 5′-CTCTGATCTTGGTCGCTG-3′.

    Quantitative RT-PCR:

    Article Title: Detection of bovine coronavirus using a TaqMan-based real-time RT-PCR assay
    Article Snippet: .. 2.4 Real-time RT-PCR Duplicates of the standard dilutions and RNA templates were subjected simultaneously to reverse transcription with the GeneAmp® RNA PCR kit (Applied Biosystems, Applera Italia, Monza, Italy). .. One microlitre of each duplicate of the standard dilutions or template RNA was reverse transcribed in a 20-μl reaction volume containing PCR buffer 1× (KCl 50 mM, Tris–HCl 10 mM, pH 8.3), MgCl2 5 mM, 1 mM of each deoxynucleotide (dATP, dCTP, dGTP, dTTP), RNase Inhibitor 1 U, MuLV reverse transcriptase 2.5 U, random hexamers 2.5 U. Synthesis of c-DNA was carried out at 42 °C for 30 min, followed by a denaturation step at 99 °C for 5 min. Real-time PCR for the simultaneous detection and quantification of BCoV RNA was performed on a 7500 Real-time PCR System (Applied Biosystems) with iTaq™ Supermix added with ROX (Bio-Rad Laboratories Srl, Milan, Italy).

    Expressing:

    Article Title: The Origin of the RB1 Imprint
    Article Snippet: .. Expression analysis RT-PCRs were performed with the GeneAmp RNA PCR Kit (Applied Biosystems, Foster City, CA, USA). ..

    Synthesized:

    Article Title: Derivation of Induced Pluripotent Stem Cells from the Baboon: A Nonhuman Primate Model for Preclinical Testing of Stem Cell Therapies
    Article Snippet: .. RNA was dialyzed for 30 min against RNase/DNase-free distilled water. cDNA was synthesized using the GeneAmp RNA PCR kit from Applied Biosciences (Fisher). .. Primers for the individual PCR reactions were: OCT4 , forward, GTGCCGTGAAGCTGGAGAAGGA, reverse, ACCTTCCCAAATAGAACCCCCAGG; SOX2 , forward.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Thermo Fisher geneamp rna pcr core kit
    Geneamp Rna Pcr Core Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp rna pcr core kit/product/Thermo Fisher
    Average 92 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    geneamp rna pcr core kit - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    94
    Thermo Fisher geneamp rna pcr kit
    Geneamp Rna Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 154 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp rna pcr kit/product/Thermo Fisher
    Average 94 stars, based on 154 article reviews
    Price from $9.99 to $1999.99
    geneamp rna pcr kit - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    89
    Thermo Fisher geneamp gold rna pcr reagent kit
    Geneamp Gold Rna Pcr Reagent Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 58 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp gold rna pcr reagent kit/product/Thermo Fisher
    Average 89 stars, based on 58 article reviews
    Price from $9.99 to $1999.99
    geneamp gold rna pcr reagent kit - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    90
    Thermo Fisher geneamp pcr core kit
    Geneamp Pcr Core Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr core kit/product/Thermo Fisher
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr core kit - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    Image Search Results