Structured Review

TaKaRa gc buffer i
Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gc buffer i/product/TaKaRa
Average 99 stars, based on 68 article reviews
Price from $9.99 to $1999.99
gc buffer i - by Bioz Stars, 2020-01
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: .. Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Amplification:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: SSU rRNA genes were amplified by LA Taq polymerase (Takara Bio, Kusatsu, Japan) using a universal primer set of U530F and U907R ( ). .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). ..

Article Title: Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Article Snippet: For Dip2a LacZ knockin genotyping, a short LacZ sequence of 250bp (LacZ-F: ACCACACCTCCTGCCTGTATAAC, and LacZ-R: ACGACGGGATCATCGCGAGCCAT), was amplified. .. Due to the extreme high GC% content in the 5’ Arm, we use GC buffer I (Takara) and slowdown PCR program [ ].

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: .. DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: The indica nitrate reductase gene OsNR2 allele enhances rice yield potential and nitrogen use efficiency
Article Snippet: .. To obtain the OsNR2 genomic DNA sequence, a 3026-bp region of the OsNR2 gene from the start ATG to the TGA was amplified with LA Taq DNA polymerase in GC buffer I (Takara), using PCR sequencing primers NR3-NR8 (Supplementary Table ). .. The PCR products were purified with a purification kit (Tiangen Company).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: .. Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). ..

Reporter Assay:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: Paragraph title: 4.7. Dual Reporter Assay ... To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan).

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

TA Cloning:

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Quantitative RT-PCR:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Paragraph title: Real-Time RT-PCR ... The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

SYBR Green Assay:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Expressing:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Real-Time RT-PCR The relative mRNA expression of RBMY (RNA binding motif protein, Y-linked) in the CBSCs-injected heart tissues was examined via real-time RT-PCR after total RNA was isolated from heart samples using an RNeasy RNA isolation kit (Qiagen, Hilden, Germany). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Knock-In:

Article Title: Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Article Snippet: For Dip2a LacZ knockin genotyping, a short LacZ sequence of 250bp (LacZ-F: ACCACACCTCCTGCCTGTATAAC, and LacZ-R: ACGACGGGATCATCGCGAGCCAT), was amplified. .. Due to the extreme high GC% content in the 5’ Arm, we use GC buffer I (Takara) and slowdown PCR program [ ].

RNA Binding Assay:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Real-Time RT-PCR The relative mRNA expression of RBMY (RNA binding motif protein, Y-linked) in the CBSCs-injected heart tissues was examined via real-time RT-PCR after total RNA was isolated from heart samples using an RNeasy RNA isolation kit (Qiagen, Hilden, Germany). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Transformation Assay:

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. Briefly, each amplicon was inserted into a plasmid vector (pCR 2.1TM-TOPO vector) and transformed into competent cells (TOP10 cells) according to the manufacturer’s instructions.

Countercurrent Chromatography:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: The Illumina adaptor sequence (5′-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-3′; Illumina, San Diego, CA, United States) and Illumina Multiplexing PCR Primer 2.0 (5′-GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC T-3′; Illumina) were added at the 5′ ends of both primers (U530F and U907R). .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Ligation:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. The PCR products were digested with XhoI and BglII, which was followed by ligation into the same restriction sites of pGL4.10 [luc2].

Article Title: A rapid improved multiplex ligation detection reaction method for the identification of gene mutations in hereditary hearing loss
Article Snippet: We applied the iMLDR technique to genotype 32 SNP loci in one ligation reaction. .. The 20 μl PCR reaction mixture contained 1 x GC Buffer I (Takara), 3.0 mM Mg2+ , 0.3 mM dNTPs, 1 U of Hot-Start Taq DNA polymerase (Takara), 1 μl of primer mixture, and 20 ng of genomic DNA.

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. The PCR products were digested with XhoI and BglII, which was followed by ligation into the same restriction sites of pGL4.10 [luc2].

DNA Sequencing:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. The promoter sequence was confirmed by DNA sequencing.

Sequencing:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: Paragraph title: Small Subunit (SSU) rRNA Gene Tag Sequencing ... The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. The promoter sequence was confirmed by DNA sequencing.

Article Title: A rapid improved multiplex ligation detection reaction method for the identification of gene mutations in hereditary hearing loss
Article Snippet: The sequence of the two allele-specific 5’ probes differs at the 3’ end and will ligate to the 3’ probe when bound to the corresponding allele DNA template. .. The 20 μl PCR reaction mixture contained 1 x GC Buffer I (Takara), 3.0 mM Mg2+ , 0.3 mM dNTPs, 1 U of Hot-Start Taq DNA polymerase (Takara), 1 μl of primer mixture, and 20 ng of genomic DNA.

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: Paragraph title: Sanger sequencing of candidate genes ... Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China).

Article Title: Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Article Snippet: For Dip2a LacZ knockin genotyping, a short LacZ sequence of 250bp (LacZ-F: ACCACACCTCCTGCCTGTATAAC, and LacZ-R: ACGACGGGATCATCGCGAGCCAT), was amplified. .. Due to the extreme high GC% content in the 5’ Arm, we use GC buffer I (Takara) and slowdown PCR program [ ].

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: .. DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: The indica nitrate reductase gene OsNR2 allele enhances rice yield potential and nitrogen use efficiency
Article Snippet: .. To obtain the OsNR2 genomic DNA sequence, a 3026-bp region of the OsNR2 gene from the start ATG to the TGA was amplified with LA Taq DNA polymerase in GC buffer I (Takara), using PCR sequencing primers NR3-NR8 (Supplementary Table ). .. The PCR products were purified with a purification kit (Tiangen Company).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: .. Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Multiplexing:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: The Illumina adaptor sequence (5′-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-3′; Illumina, San Diego, CA, United States) and Illumina Multiplexing PCR Primer 2.0 (5′-GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC T-3′; Illumina) were added at the 5′ ends of both primers (U530F and U907R). .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Isolation:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The appropriate quantity and concentration of isolated RNA was detected using a Nanodrop 2000 (Thermo Fisher Scientific, Madison, WI, USA). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Subcloning:

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Purification:

Article Title: A rapid improved multiplex ligation detection reaction method for the identification of gene mutations in hereditary hearing loss
Article Snippet: The 20 μl PCR reaction mixture contained 1 x GC Buffer I (Takara), 3.0 mM Mg2+ , 0.3 mM dNTPs, 1 U of Hot-Start Taq DNA polymerase (Takara), 1 μl of primer mixture, and 20 ng of genomic DNA. .. The PCR products were equally mixed and purified by digestion with 1 U of shrimp alkaline phosphatase at 37°C for 1 hr, followed by deactivation of the phosphatase at 75°C for 15 min.

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: The indica nitrate reductase gene OsNR2 allele enhances rice yield potential and nitrogen use efficiency
Article Snippet: To obtain the OsNR2 genomic DNA sequence, a 3026-bp region of the OsNR2 gene from the start ATG to the TGA was amplified with LA Taq DNA polymerase in GC buffer I (Takara), using PCR sequencing primers NR3-NR8 (Supplementary Table ). .. The PCR products were purified with a purification kit (Tiangen Company).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA. .. The cycling program included 95°C for 2 min; 35 cycles of 96°C for 10 s and 68°C for 1 min; and a 4°C hold. (1) PCR Purification Using SAP and Exo I .

Polymerase Chain Reaction:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA. ..

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). ..

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: A rapid improved multiplex ligation detection reaction method for the identification of gene mutations in hereditary hearing loss
Article Snippet: .. The 20 μl PCR reaction mixture contained 1 x GC Buffer I (Takara), 3.0 mM Mg2+ , 0.3 mM dNTPs, 1 U of Hot-Start Taq DNA polymerase (Takara), 1 μl of primer mixture, and 20 ng of genomic DNA. ..

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: .. Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China). .. The PCR products were directly sequenced in an ABI Prism 3730xl Automated Sequencer (Applied Biosystems, Foster City, CA, USA), and sequences were analyzed with CodonCode Aligner software (CodonCode Corp., Dedham, MA, USA).

Article Title: Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Article Snippet: .. Due to the extreme high GC% content in the 5’ Arm, we use GC buffer I (Takara) and slowdown PCR program [ ]. .. None specific integration of plasmid backbone, DONOR plasmid or Cas9 gene were checked with following primer pairs (Amp-F: AGATGCTGAAGATCAGTTGGGTG, Amp-R: GTCATGCCATCCGTAAGATGCTT; pUC-F: CGGATCAAGAGCTACCAACTCTT, pUC-R:GCCTTATCCGGTAACTATCGTCT;Cas9-F1: AAGGTGGACGACAGCTTCTTCCA, Cas9-R1: AACAGCGACGTGGACAAGCTGTT; Cas9-F2: CAGCCAGATCCTGAAAGAACACC, Cas9-R2: CTTTCTCTGGGTAATCAGCTTGG).

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: The indica nitrate reductase gene OsNR2 allele enhances rice yield potential and nitrogen use efficiency
Article Snippet: .. To obtain the OsNR2 genomic DNA sequence, a 3026-bp region of the OsNR2 gene from the start ATG to the TGA was amplified with LA Taq DNA polymerase in GC buffer I (Takara), using PCR sequencing primers NR3-NR8 (Supplementary Table ). .. The PCR products were purified with a purification kit (Tiangen Company).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. Briefly, each amplicon was inserted into a plasmid vector (pCR 2.1TM-TOPO vector) and transformed into competent cells (TOP10 cells) according to the manufacturer’s instructions.

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). ..

Construct:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. A phylogenetic tree was constructed for various Ghd8 alleles using MEGA software ( https://www.megasoftware.net/ ).

Activated Clotting Time Assay:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: The Illumina adaptor sequence (5′-ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT-3′; Illumina, San Diego, CA, United States) and Illumina Multiplexing PCR Primer 2.0 (5′-GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC T-3′; Illumina) were added at the 5′ ends of both primers (U530F and U907R). .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Plasmid Preparation:

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Article Snippet: Due to the extreme high GC% content in the 5’ Arm, we use GC buffer I (Takara) and slowdown PCR program [ ]. .. None specific integration of plasmid backbone, DONOR plasmid or Cas9 gene were checked with following primer pairs (Amp-F: AGATGCTGAAGATCAGTTGGGTG, Amp-R: GTCATGCCATCCGTAAGATGCTT; pUC-F: CGGATCAAGAGCTACCAACTCTT, pUC-R:GCCTTATCCGGTAACTATCGTCT;Cas9-F1: AAGGTGGACGACAGCTTCTTCCA, Cas9-R1: AACAGCGACGTGGACAAGCTGTT; Cas9-F2: CAGCCAGATCCTGAAAGAACACC, Cas9-R2: CTTTCTCTGGGTAATCAGCTTGG).

Article Title: Involvement of MAFB and MAFF in Retinoid-Mediated Suppression of Hepatocellular Carcinoma Invasion
Article Snippet: .. Dual Reporter Assay To construct a human TFPI2 promoter reporter vector, PCR cloning was performed with LA Taq with GC buffer I (TaKaRa Bio, Otsu, Japan). .. In the reaction, genomic DNA isolated from a human immortalized the fibroblast cell line, KMST-6, was used as a template and the following oligoDNAs were used as primers: hTFPI2pro-For, CGTCCTCGAGGTCCACACAAAGCAGCTT; hTFPI2pro-Rev, GTCGAGATCTGGGCAAGGCGTCCGAGAAA.

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. Briefly, each amplicon was inserted into a plasmid vector (pCR 2.1TM-TOPO vector) and transformed into competent cells (TOP10 cells) according to the manufacturer’s instructions.

Software:

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). .. The length of the PCR product was detected by 3130xl Genetic Analyzer and GeneMapper Software (Applied Biosystems, CA, USA).

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China). .. The PCR products were directly sequenced in an ABI Prism 3730xl Automated Sequencer (Applied Biosystems, Foster City, CA, USA), and sequences were analyzed with CodonCode Aligner software (CodonCode Corp., Dedham, MA, USA).

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. All sequences were assembled using Sequencher v4.5 software and aligned against the Nipponbare sequence of Ghd8 (LOC_Os08g07740.1) downloaded from the website http://rice.plantbiology.msu.edu/ .

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan). .. The length of the PCR product was detected by 3130xl Genetic Analyzer and GeneMapper Software (Applied Biosystems, CA, USA).

Multiplex Assay:

Article Title: A rapid improved multiplex ligation detection reaction method for the identification of gene mutations in hereditary hearing loss
Article Snippet: A multiplex PCR reaction was designed to amplify 18 fragments covering all 32 SNP loci. .. The 20 μl PCR reaction mixture contained 1 x GC Buffer I (Takara), 3.0 mM Mg2+ , 0.3 mM dNTPs, 1 U of Hot-Start Taq DNA polymerase (Takara), 1 μl of primer mixture, and 20 ng of genomic DNA.

DNA Extraction:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: Environmental DNA was extracted from each sediment sample (approximately 5 g) by using a PowerMax Soil DNA Isolation kit (Mo Bio Lab, Carlsbad, CA, United States). .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA.

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: Genotyping A buccal swab from each subject was kept in a 90% ethanol solution until DNA extraction. .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan).

Article Title: The indica nitrate reductase gene OsNR2 allele enhances rice yield potential and nitrogen use efficiency
Article Snippet: Paragraph title: DNA extraction and OsNR2 sequencing ... To obtain the OsNR2 genomic DNA sequence, a 3026-bp region of the OsNR2 gene from the start ATG to the TGA was amplified with LA Taq DNA polymerase in GC buffer I (Takara), using PCR sequencing primers NR3-NR8 (Supplementary Table ).

Article Title: Common marmoset (Callithrix jacchus) personality, subjective well-being, hair cortisol level and AVPR1a, OPRM1, and DAT genotypes
Article Snippet: A buccal swab from each subject was kept in a 90% ethanol solution until DNA extraction. .. PCR amplification was conducted in a 10 μl (the total volume) reaction mixture containing a DNA template, each primer, LA Taq , dNTPs, and GC buffer I (TaKaRa, Shiga, Japan).

Concentration Assay:

Article Title: Quantitative Viral Community DNA Analysis Reveals the Dominance of Single-Stranded DNA Viruses in Offshore Upper Bathyal Sediment from Tohoku, Japan
Article Snippet: .. The PCR mixture contained LA Taq polymerase (final concentration of 0.1 U μl-1 ), 1 × GC Buffer I (Takara Bio), dNTPs (final concentration of 0.25 mM), each primer (final concentration of 0.2 mM), and template DNA. ..

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The appropriate quantity and concentration of isolated RNA was detected using a Nanodrop 2000 (Thermo Fisher Scientific, Madison, WI, USA). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Gel Extraction:

Article Title: Promoter-level transcriptome in primary lesions of endometrial cancer identified biomarkers associated with lymph node metastasis
Article Snippet: Cloning and sequencing of novel isoforms TACC2 The novel TACC2 gene isoforms were amplified by using LA Taq with GC buffer I (Takara Bio Inc., Kusatsu, Japan) with the primers described in Supplementary Table and Supplementary Figure . .. The amplified fragments were isolated using the PureLink Quick Gel Extraction Kit (Invitrogen Ltd., Paisley, UK), and cloned with TOPO TA Cloning Kits for Subcloning (Invitrogen Ltd.).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa la taq tm kit
    La Taq Tm Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/la taq tm kit/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    la taq tm kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    82
    TaKaRa gc buffer i
    Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 82/100, based on 68 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc buffer i/product/TaKaRa
    Average 82 stars, based on 68 article reviews
    Price from $9.99 to $1999.99
    gc buffer i - by Bioz Stars, 2020-01
    82/100 stars
      Buy from Supplier

    Image Search Results