Structured Review

TaKaRa gc buffer i
Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 99 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gc buffer i/product/TaKaRa
Average 95 stars, based on 99 article reviews
Price from $9.99 to $1999.99
gc buffer i - by Bioz Stars, 2020-07
95/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Loss of genes related to Nucleotide Excision Repair (NER) and implications for reductive genome evolution in symbionts of deep-sea vesicomyid clams
Article Snippet: .. For the PCR, 25 μl of the reaction mixture contained 80 ng of template DNA, 2.5 μl of 10× LA Taq buffer (TaKaRa), 2.5 μl of dNTP mix (TaKaRa), 5 μl each of the 1 pmol/μl forward and reverse primer solutions, 0.13 μl of LA Taq polymerase solution (TaKaRa) and 8.87 μl of pure water was used. .. The gene fragments were amplified with an ABI 9700 Thermal cycler using a protocol; 96°C for 2 min and 30 cycles of 96°C for 20 s, 56°C for 15 s and 72°C for 2 or 5 or 7 min, followed by extension at 72°C for 10 min. After amplification, 2 μl of the reaction product mixture was applied to 1% agarose electrophoresis gel and stained with an ethidium bromide solution to visualize the reaction products.

Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

Article Title: Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas
Article Snippet: .. Then the no bands or weak bands primers were used in the second round PCR reaction using TAKaRa LA Taq polymerase with GC buffer (Code No.: RR02AG, TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. SSRs were amplified on Heijingang Thermal Cycler (Eastwin, Beijing, China).

Nested PCR:

Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
Article Snippet: .. For the first round of nested PCR, 5 μl of restriction enzyme-digested and circularized DNA templates was mixed with 25 μl GC Buffer I (Takara; catalog no. RR02AG), 6 μl dNTP solution (10 mM), 25 pmol forward and reverse primers, 0.5 μl LA Taq DNA polymerase (Takara; catalog no. RR002A), and 11.5 μl DEPC-treated water, in a total reaction volume of 50 μl. ..

Genomic Sequencing:

Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

Amplification:

Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
Article Snippet: .. To detect correct targeting at the 5′ end of ROSA26, we amplified ∼1.5 kb genomic DNA fragment using primers: Rosa3 ( CCACTGACCGCACGGGGATTC ) and Rosa4 ( TCAATGGGCGGGGGTCGTT ), and LA Taq with GC buffer I (Takara, Cat No. RR02AG). .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

Article Title: Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿Discovery and Characterization of Mammalian Endogenous Parvoviruses ▿ †
Article Snippet: .. All reactions for genomic PCR were performed in PCR buffer suitable for amplification of GC-rich genomic sequences as specified by the manufacturer (Takara; catalog no. RR02AG). .. All PCRs for junction and genomic PCRs used conditions similar to those described for inverse PCR below, except that the annealing temperatures for PCRs were 6°C below the average melting temperatures of the two primers.

Variant Assay:

Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa special gc buffer i
    Special Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/special gc buffer i/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    special gc buffer i - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    TaKaRa 1x gc buffer i
    1x Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x gc buffer i/product/TaKaRa
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    1x gc buffer i - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    89
    TaKaRa 2×gc buffer i
    2×Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2×gc buffer i/product/TaKaRa
    Average 89 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    2×gc buffer i - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    90
    TaKaRa gc i buffer
    Gc I Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc i buffer/product/TaKaRa
    Average 90 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    gc i buffer - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    Image Search Results