Structured Review

TaKaRa gc buffer i
Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gc buffer i/product/TaKaRa
Average 99 stars, based on 71 article reviews
Price from $9.99 to $1999.99
gc buffer i - by Bioz Stars, 2020-02
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The bands were excised, cloned into pGL3 basic vector (Promega) via restriction endonuclease MluI sites, and sequenced.

Amplification:

Article Title: Characterization of Four Type IV Pilin Homologues in Stigmatella aurantiaca DSM17044 by Heterologous Expression in Myxococcus xanthus
Article Snippet: Paragraph title: Amplification of the S . aurantiaca DSM17044 genes homologous to pilA by polymerase chain reaction (PCR) ... For PCR, a 50 µl-volume reaction solution was prepared by mixing 1 µl of template DNA (20 ng/µl), 1 µl of each primer (50 µM), 4 µl of dNTPs (2.5 mM), 1 µl of pfu DNA polymerase (2.5 U/µl, Fermentas), 25 µl of 2×GC Buffer I (Takara Bio) and 17 µl of ddH2 O.

Article Title: High frequency of Machado-Joseph disease identified in Southeastern Chinese kindreds with spinocerebellar ataxia
Article Snippet: .. The PCR amplification was performed in a total volume of 25 μL containing 0.10 μg of genomic DNA, 0.10 μmol/L of each primer, 50 μmol/L of each dNTP and 1.25 units of LA Taq polymerase with 12.5 μL 2× GC buffer I (TaKaRa, Chiba, Japan). .. PCR products were generated using a Mini-Cycler PCR system (Applied Biosystems, Foster City, CA, USA).

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: .. PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA. .. The PCR cycling program was set at 95°C for 2 min, followed by 11 cycles of 94°C for 20 s, 65°C (decreased 0.5°C per cycle) for 40 s, 72°C for 1.5 min, and then 24 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 1.5 min, and a final extension at 72°C for 2 min. Then shrimp alkaline phosphatase (Promega, USA) and Exonuclease I (Epicenter, USA) were added into the PCR products for purification.

Article Title: Combination of Single Nucleotide Polymorphism and Variable-Number Tandem Repeats for Genotyping a Homogenous Population of Mycobacterium tuberculosis Beijing Strains in China
Article Snippet: .. The three hypervariable loci were amplified in 1× GC buffer I (Takara Biotech Co. Ltd., Dalian, China) with an extension time of 1.5 min at 72°C. .. The sizes of amplicons were analyzed on 1.0 or 1.5% agarose gels for 1.5 to 2 h at 150 V with 50-bp ladder and 100-bp high-ladder size standards (CoWin Biotech Co. Ltd., Beijing, China).

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: .. The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min. .. The PCR products were purified using an AxyPrep™ DNA Gel Extraction Kit (Axygen Biosciences, Union, CA), and directly sequenced with the reverse primer by Life Technologies (Shanghai, China).

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: .. DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: Rapid Method for Identification of Six Common Species of Mycobacteria Based on Multiplex SNP Analysis ▿
Article Snippet: .. PCR amplification was performed in 20 μl of a reaction mixture containing 1× GC buffer I (Takara), 3.0 mM Mg2+ , a 0.3 mM concentration of each deoxynucleoside triphosphate (dNTP), a 0.1 μM concentration of each primer, 1 U of Hotstar Taq polymerase (Qiagen Inc.), and 1 μl of template DNA. .. The PCR cycling conditions were 95°C for 15 min; 12 cycles of 94°C for 20 s, 65°C for 40 s (decreasing 0.5°C/cycle), and 72°C for 100 s; 23 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 90 s; and a final step at 72°C for 2 min.

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: .. Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The 5′-RACE PCR products were resolved on a 1% agarose gel and stained by EtBr.

Article Title: Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Article Snippet: ARQ and ARG were amplified by applying the following primer sets: ARhf (5′-TCCAGAATCTGTTCCAGAGCGTGC-3′) and ARhr (5′-GCTGTGAGGGTTGCTGTTCCTCAT-3′) for ARQ , and ARGF (5′-CAGTGCCGCTATGGGGACCTGGCGA-3′) and ARGR (5′-GGACTGGGATAGGGCACTCTGCTCACC-3′) for ARG ( ). .. A 10 μl PCR reaction contained 2 μl DNA with a concentration of > 150 pg/μl (Step 3 in Table S1 in ), 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U LA Taq polymerase, 400 μM of each of the dNTP and GC buffer I (TaKaRa, Shiga, Japan).

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: Paragraph title: Amplification of SSU rRNA gene and pyrosequencing ... The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP.

Article Title: Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Article Snippet: The PCR was performed in a total volume of 25 μl containing 1× GC buffer I (TaKaRa), 100–200 ng of genomic DNA, 187.5 μM of each dNTP (TaKaRa), 0.25 μM of each primer, and 1 U of Taq polymerase (TaKaRa), and subjected to a program of initial denaturation at 94 °C for 4 min, followed by 10 cycles of 45 s at 94 °C, 45 s at 62 °C, and 1 min at 72 °C, then 25 cycles of 45 s at 94 °C, 45 s at 58–60 °C, and 1 min at 72 °C, and a final extension at 72 °C for 10 min. .. The amplified product (341 bp) specific to the TiERF1 gene was resolved on a 1% (w/v) agarose gel and visualized by ethidium bromide staining.

Synthesized:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Briefly, cDNA was synthesized by using the MC-let-7a-1 ∼ let-7d specific primers GSP1-1 or GSP1-2 ( ). .. Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa).

Quantitative RT-PCR:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Paragraph title: Real-Time RT-PCR ... The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

SYBR Green Assay:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Incubation:

Article Title: Rapid Method for Identification of Six Common Species of Mycobacteria Based on Multiplex SNP Analysis ▿
Article Snippet: PCR amplification was performed in 20 μl of a reaction mixture containing 1× GC buffer I (Takara), 3.0 mM Mg2+ , a 0.3 mM concentration of each deoxynucleoside triphosphate (dNTP), a 0.1 μM concentration of each primer, 1 U of Hotstar Taq polymerase (Qiagen Inc.), and 1 μl of template DNA. .. Following PCR, 15 μl of the PCR product was incubated with 5 units of shrimp alkaline phosphatase (SAP; Applied Biosystems) and 2 units of ExoI (Applied Biosystems) for 60 min at 37°C, followed by 15 min at 75°C for enzyme inactivation.

Article Title: Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Article Snippet: A 10 μl PCR reaction contained 2 μl DNA with a concentration of > 150 pg/μl (Step 3 in Table S1 in ), 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U LA Taq polymerase, 400 μM of each of the dNTP and GC buffer I (TaKaRa, Shiga, Japan). .. Following the initial incubation at 95 °C for 2 min, PCR amplification was performed for 35 cycles of 95 °C for 30 s, 60 °C (ARQ ) or 65 °C (ARG ) for 1 min and 75 °C for 2 min for AR loci , while 35 cycles (MAin2 ) or 40 cycles (MBin2 ) of 95 °C for 30 s, 50 °C for 1 min and 75 °C for 2 min for MAOA and MAOB loci .

Expressing:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Real-Time RT-PCR The relative mRNA expression of RBMY (RNA binding motif protein, Y-linked) in the CBSCs-injected heart tissues was examined via real-time RT-PCR after total RNA was isolated from heart samples using an RNeasy RNA isolation kit (Qiagen, Hilden, Germany). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

RNA Binding Assay:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: Real-Time RT-PCR The relative mRNA expression of RBMY (RNA binding motif protein, Y-linked) in the CBSCs-injected heart tissues was examined via real-time RT-PCR after total RNA was isolated from heart samples using an RNeasy RNA isolation kit (Qiagen, Hilden, Germany). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Concentration Assay:

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The appropriate quantity and concentration of isolated RNA was detected using a Nanodrop 2000 (Thermo Fisher Scientific, Madison, WI, USA). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Article Title: Rapid Method for Identification of Six Common Species of Mycobacteria Based on Multiplex SNP Analysis ▿
Article Snippet: .. PCR amplification was performed in 20 μl of a reaction mixture containing 1× GC buffer I (Takara), 3.0 mM Mg2+ , a 0.3 mM concentration of each deoxynucleoside triphosphate (dNTP), a 0.1 μM concentration of each primer, 1 U of Hotstar Taq polymerase (Qiagen Inc.), and 1 μl of template DNA. .. The PCR cycling conditions were 95°C for 15 min; 12 cycles of 94°C for 20 s, 65°C for 40 s (decreasing 0.5°C/cycle), and 72°C for 100 s; 23 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 90 s; and a final step at 72°C for 2 min.

Article Title: Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Article Snippet: .. A 10 μl PCR reaction contained 2 μl DNA with a concentration of > 150 pg/μl (Step 3 in Table S1 in ), 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U LA Taq polymerase, 400 μM of each of the dNTP and GC buffer I (TaKaRa, Shiga, Japan). .. Following the initial incubation at 95 °C for 2 min, PCR amplification was performed for 35 cycles of 95 °C for 30 s, 60 °C (ARQ ) or 65 °C (ARG ) for 1 min and 75 °C for 2 min for AR loci , while 35 cycles (MAin2 ) or 40 cycles (MBin2 ) of 95 °C for 30 s, 50 °C for 1 min and 75 °C for 2 min for MAOA and MAOB loci .

Cell Culture:

Article Title: Phenylacetyl Coenzyme A Is an Effector Molecule of the TetR Family Transcriptional Repressor PaaR from Thermus thermophilusHB8 ▿HB8 ▿ †
Article Snippet: Total RNA, isolated from the wild-type T. thermophilus HB8 strain cultured for 11.3 h in rich medium, was treated with DNase I, followed by ethanol precipitation, as described previously ( ). .. The PCR analysis involved 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 3.5 min in GC buffer I (Takara Bio).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Phenylacetyl Coenzyme A Is an Effector Molecule of the TetR Family Transcriptional Repressor PaaR from Thermus thermophilusHB8 ▿HB8 ▿ †
Article Snippet: Paragraph title: RT-PCR. ... The PCR analysis involved 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 3.5 min in GC buffer I (Takara Bio).

Generated:

Article Title: High frequency of Machado-Joseph disease identified in Southeastern Chinese kindreds with spinocerebellar ataxia
Article Snippet: The PCR amplification was performed in a total volume of 25 μL containing 0.10 μg of genomic DNA, 0.10 μmol/L of each primer, 50 μmol/L of each dNTP and 1.25 units of LA Taq polymerase with 12.5 μL 2× GC buffer I (TaKaRa, Chiba, Japan). .. PCR products were generated using a Mini-Cycler PCR system (Applied Biosystems, Foster City, CA, USA).

Sequencing:

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min. .. Genotypes of PxNav for individual larvae were identified according to their sequence chromatograms.

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: .. DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP. .. The DNA amplification condition was 5 min of denaturation at 96°C, and 25 cycles at 96°C for 20 s, 48°C for 70 s and 72°C for 30 s. Each of the ‘530F’ and ‘907R’ oligonucleotide primers harbored 24 bases of non-palindromic sequencing “key” sequences ‘CCATCTGTTCCCTCCCTGTCTCAG’ and ‘CCTATCCCCTGTTGCGTGTCTCAG’ for pyrosequencing at their 5′ terminal end, respectively.

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: Paragraph title: Sanger sequencing of candidate genes ... Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China).

DNA Extraction:

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: Paragraph title: DNA Extraction and Genotyping ... PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA.

Isolation:

Article Title: Characterization of Four Type IV Pilin Homologues in Stigmatella aurantiaca DSM17044 by Heterologous Expression in Myxococcus xanthus
Article Snippet: The DSM17044 genomic DNA was isolated and purified as described previously [ ]. .. For PCR, a 50 µl-volume reaction solution was prepared by mixing 1 µl of template DNA (20 ng/µl), 1 µl of each primer (50 µM), 4 µl of dNTPs (2.5 mM), 1 µl of pfu DNA polymerase (2.5 U/µl, Fermentas), 25 µl of 2×GC Buffer I (Takara Bio) and 17 µl of ddH2 O.

Article Title: Phenylacetyl Coenzyme A Is an Effector Molecule of the TetR Family Transcriptional Repressor PaaR from Thermus thermophilusHB8 ▿HB8 ▿ †
Article Snippet: Total RNA, isolated from the wild-type T. thermophilus HB8 strain cultured for 11.3 h in rich medium, was treated with DNase I, followed by ethanol precipitation, as described previously ( ). .. The PCR analysis involved 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 3.5 min in GC buffer I (Takara Bio).

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: The appropriate quantity and concentration of isolated RNA was detected using a Nanodrop 2000 (Thermo Fisher Scientific, Madison, WI, USA). .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan).

Labeling:

Article Title: Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Article Snippet: A 10 μl PCR reaction contained 2 μl DNA with a concentration of > 150 pg/μl (Step 3 in Table S1 in ), 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U LA Taq polymerase, 400 μM of each of the dNTP and GC buffer I (TaKaRa, Shiga, Japan). .. For all loci PCR amplification was followed by a final extension at 74 °C for 10 min. For genotyping we applied the ABI 3130xl Genetic Analyzer (Applied Biosystems, Foster City, California, USA) according to the manufacturer's instructions by using labeled primers.

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP. .. The amplified SSU rRNA gene fragments that were purified by agarose gel electrophoresis were applied to another 3 rounds of amplification to add the sequence for emulsion PCR and labeling biotin required for 454 pyrosequencing.

Purification:

Article Title: Characterization of Four Type IV Pilin Homologues in Stigmatella aurantiaca DSM17044 by Heterologous Expression in Myxococcus xanthus
Article Snippet: The DSM17044 genomic DNA was isolated and purified as described previously [ ]. .. For PCR, a 50 µl-volume reaction solution was prepared by mixing 1 µl of template DNA (20 ng/µl), 1 µl of each primer (50 µM), 4 µl of dNTPs (2.5 mM), 1 µl of pfu DNA polymerase (2.5 U/µl, Fermentas), 25 µl of 2×GC Buffer I (Takara Bio) and 17 µl of ddH2 O.

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA. .. The PCR cycling program was set at 95°C for 2 min, followed by 11 cycles of 94°C for 20 s, 65°C (decreased 0.5°C per cycle) for 40 s, 72°C for 1.5 min, and then 24 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 1.5 min, and a final extension at 72°C for 2 min. Then shrimp alkaline phosphatase (Promega, USA) and Exonuclease I (Epicenter, USA) were added into the PCR products for purification.

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min. .. The PCR products were purified using an AxyPrep™ DNA Gel Extraction Kit (Axygen Biosciences, Union, CA), and directly sequenced with the reverse primer by Life Technologies (Shanghai, China).

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA. .. The cycling program included 95°C for 2 min; 35 cycles of 96°C for 10 s and 68°C for 1 min; and a 4°C hold. (1) PCR Purification Using SAP and Exo I .

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP. .. The amplified SSU rRNA gene fragments that were purified by agarose gel electrophoresis were applied to another 3 rounds of amplification to add the sequence for emulsion PCR and labeling biotin required for 454 pyrosequencing.

Polymerase Chain Reaction:

Article Title: Characterization of Four Type IV Pilin Homologues in Stigmatella aurantiaca DSM17044 by Heterologous Expression in Myxococcus xanthus
Article Snippet: .. For PCR, a 50 µl-volume reaction solution was prepared by mixing 1 µl of template DNA (20 ng/µl), 1 µl of each primer (50 µM), 4 µl of dNTPs (2.5 mM), 1 µl of pfu DNA polymerase (2.5 U/µl, Fermentas), 25 µl of 2×GC Buffer I (Takara Bio) and 17 µl of ddH2 O. .. The conditions for the PCR amplification were as follows: the initial denaturation step was at 94°C for 3 min, annealing was at 65°C for 1 min, polymerization was at 72°C for 1 min, subsequent denaturation was at 94°C for 1 min, and there were 30 cycles.

Article Title: High frequency of Machado-Joseph disease identified in Southeastern Chinese kindreds with spinocerebellar ataxia
Article Snippet: .. The PCR amplification was performed in a total volume of 25 μL containing 0.10 μg of genomic DNA, 0.10 μmol/L of each primer, 50 μmol/L of each dNTP and 1.25 units of LA Taq polymerase with 12.5 μL 2× GC buffer I (TaKaRa, Chiba, Japan). .. PCR products were generated using a Mini-Cycler PCR system (Applied Biosystems, Foster City, CA, USA).

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: .. PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA. .. The PCR cycling program was set at 95°C for 2 min, followed by 11 cycles of 94°C for 20 s, 65°C (decreased 0.5°C per cycle) for 40 s, 72°C for 1.5 min, and then 24 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 1.5 min, and a final extension at 72°C for 2 min. Then shrimp alkaline phosphatase (Promega, USA) and Exonuclease I (Epicenter, USA) were added into the PCR products for purification.

Article Title: Phenylacetyl Coenzyme A Is an Effector Molecule of the TetR Family Transcriptional Repressor PaaR from Thermus thermophilusHB8 ▿HB8 ▿ †
Article Snippet: .. The PCR analysis involved 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 3.5 min in GC buffer I (Takara Bio). ..

Article Title: Trop2 Guarantees Cardioprotective Effects of Cortical Bone-Derived Stem Cells on Myocardial Ischemia/Reperfusion Injury
Article Snippet: .. The emerging cDNA was used as a template for the amplification of target genes by PCR using La-Taq and GC buffer I (Takara Bio, Shiga, Japan). .. The PCR amplification products were then analyzed and quantified by LightCycler 480 SYBR Green 1 Master Mix.

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: .. The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min. .. The PCR products were purified using an AxyPrep™ DNA Gel Extraction Kit (Axygen Biosciences, Union, CA), and directly sequenced with the reverse primer by Life Technologies (Shanghai, China).

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. The purified PCR products were used as templates and sequenced using the Big Dye Terminator v3.1 Cycle sequencing kit (Applied Biosystems).

Article Title: Rapid Method for Identification of Six Common Species of Mycobacteria Based on Multiplex SNP Analysis ▿
Article Snippet: .. PCR amplification was performed in 20 μl of a reaction mixture containing 1× GC buffer I (Takara), 3.0 mM Mg2+ , a 0.3 mM concentration of each deoxynucleoside triphosphate (dNTP), a 0.1 μM concentration of each primer, 1 U of Hotstar Taq polymerase (Qiagen Inc.), and 1 μl of template DNA. .. The PCR cycling conditions were 95°C for 15 min; 12 cycles of 94°C for 20 s, 65°C for 40 s (decreasing 0.5°C/cycle), and 72°C for 100 s; 23 cycles of 94°C for 20 s, 59°C for 30 s, and 72°C for 90 s; and a final step at 72°C for 2 min.

Article Title: Clinical Diagnosis of X-Linked Spondyloepiphyseal Dysplasia Tarda and a Novel Missense Mutation in the Sedlin Gene (SEDL)
Article Snippet: Paragraph title: 2.1.2. Polymerase Chain Reaction Amplification and Sequencing ... The reaction mixture (20 μ l) included 1x GC buffer I (TAKARA), 2.5 mM Mg2+ , 0.2 mM dNTPs, 0.2 μ M each primer, 1 U of HotStarTaq polymerase (TAKARA), and 1 μ l of template DNA.

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The 5′-RACE PCR products were resolved on a 1% agarose gel and stained by EtBr.

Article Title: Androgen receptor and monoamine oxidase polymorphism in wild bonobos
Article Snippet: .. A 10 μl PCR reaction contained 2 μl DNA with a concentration of > 150 pg/μl (Step 3 in Table S1 in ), 0.5 μM forward primer, 0.5 μM reverse primer, 0.5 U LA Taq polymerase, 400 μM of each of the dNTP and GC buffer I (TaKaRa, Shiga, Japan). .. Following the initial incubation at 95 °C for 2 min, PCR amplification was performed for 35 cycles of 95 °C for 30 s, 60 °C (ARQ ) or 65 °C (ARG ) for 1 min and 75 °C for 2 min for AR loci , while 35 cycles (MAin2 ) or 40 cycles (MBin2 ) of 95 °C for 30 s, 50 °C for 1 min and 75 °C for 2 min for MAOA and MAOB loci .

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: .. The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP. .. The DNA amplification condition was 5 min of denaturation at 96°C, and 25 cycles at 96°C for 20 s, 48°C for 70 s and 72°C for 30 s. Each of the ‘530F’ and ‘907R’ oligonucleotide primers harbored 24 bases of non-palindromic sequencing “key” sequences ‘CCATCTGTTCCCTCCCTGTCTCAG’ and ‘CCTATCCCCTGTTGCGTGTCTCAG’ for pyrosequencing at their 5′ terminal end, respectively.

Article Title: Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Article Snippet: .. The PCR was performed in a total volume of 25 μl containing 1× GC buffer I (TaKaRa), 100–200 ng of genomic DNA, 187.5 μM of each dNTP (TaKaRa), 0.25 μM of each primer, and 1 U of Taq polymerase (TaKaRa), and subjected to a program of initial denaturation at 94 °C for 4 min, followed by 10 cycles of 45 s at 94 °C, 45 s at 62 °C, and 1 min at 72 °C, then 25 cycles of 45 s at 94 °C, 45 s at 58–60 °C, and 1 min at 72 °C, and a final extension at 72 °C for 10 min. .. The amplified product (341 bp) specific to the TiERF1 gene was resolved on a 1% (w/v) agarose gel and visualized by ethidium bromide staining.

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: .. Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China). .. The PCR products were directly sequenced in an ABI Prism 3730xl Automated Sequencer (Applied Biosystems, Foster City, CA, USA), and sequences were analyzed with CodonCode Aligner software (CodonCode Corp., Dedham, MA, USA).

Construct:

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. A phylogenetic tree was constructed for various Ghd8 alleles using MEGA software ( https://www.megasoftware.net/ ).

Gel Extraction:

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min. .. The PCR products were purified using an AxyPrep™ DNA Gel Extraction Kit (Axygen Biosciences, Union, CA), and directly sequenced with the reverse primer by Life Technologies (Shanghai, China).

Nested PCR:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: .. Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The 5′-RACE PCR products were resolved on a 1% agarose gel and stained by EtBr.

Plasmid Preparation:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The bands were excised, cloned into pGL3 basic vector (Promega) via restriction endonuclease MluI sites, and sequenced.

Software:

Article Title: A key variant in the cis-regulatory element of flowering gene Ghd8 associated with cold tolerance in rice
Article Snippet: DNA sequence analysis The promoter region of Ghd8 was amplified by using the ExTaq and GC buffer I (Takara) from genomic DNA of the 198 rice accessions. .. All sequences were assembled using Sequencher v4.5 software and aligned against the Nipponbare sequence of Ghd8 (LOC_Os08g07740.1) downloaded from the website http://rice.plantbiology.msu.edu/ .

Article Title: 17p13.3 genomic rearrangement in a Chinese family with split-hand/foot malformation with long bone deficiency: report of a complicated duplication with marked variation in phenotype
Article Snippet: Each polymerase chain reaction (PCR) was conducted in a 25 μl reaction mixture using LA Taq with GC Buffer I (Takara Bio., Dalian, PR China). .. The PCR products were directly sequenced in an ABI Prism 3730xl Automated Sequencer (Applied Biosystems, Foster City, CA, USA), and sequences were analyzed with CodonCode Aligner software (CodonCode Corp., Dedham, MA, USA).

Agarose Gel Electrophoresis:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The 5′-RACE PCR products were resolved on a 1% agarose gel and stained by EtBr.

Article Title: Microbial Diversity in Deep-sea Methane Seep Sediments Presented by SSU rRNA Gene Tag Sequencing
Article Snippet: The PCR mixture contained 0.5 volumes of 2×GC buffer I for LA Taq polymerase (Takara), 0.1 U μL−1 LA Taq, 0.4 pmol μL−1 of each primer mixture and 1.6 nmol μL−1 dNTP. .. The amplified SSU rRNA gene fragments that were purified by agarose gel electrophoresis were applied to another 3 rounds of amplification to add the sequence for emulsion PCR and labeling biotin required for 454 pyrosequencing.

Article Title: Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Article Snippet: The PCR was performed in a total volume of 25 μl containing 1× GC buffer I (TaKaRa), 100–200 ng of genomic DNA, 187.5 μM of each dNTP (TaKaRa), 0.25 μM of each primer, and 1 U of Taq polymerase (TaKaRa), and subjected to a program of initial denaturation at 94 °C for 4 min, followed by 10 cycles of 45 s at 94 °C, 45 s at 62 °C, and 1 min at 72 °C, then 25 cycles of 45 s at 94 °C, 45 s at 58–60 °C, and 1 min at 72 °C, and a final extension at 72 °C for 10 min. .. The amplified product (341 bp) specific to the TiERF1 gene was resolved on a 1% (w/v) agarose gel and visualized by ethidium bromide staining.

Transgenic Assay:

Article Title: Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Article Snippet: PCR detection of TiERF1 in the trangenic wheat plants The presence of the TiERF1 gene in the transgenic wheat plants was monitored by PCR using the gene-specific primers TiE-406F (GAGGCCACGGCGTTCATG) and TiE-746R (GACCCGGACGAGGAGGAG). .. The PCR was performed in a total volume of 25 μl containing 1× GC buffer I (TaKaRa), 100–200 ng of genomic DNA, 187.5 μM of each dNTP (TaKaRa), 0.25 μM of each primer, and 1 U of Taq polymerase (TaKaRa), and subjected to a program of initial denaturation at 94 °C for 4 min, followed by 10 cycles of 45 s at 94 °C, 45 s at 62 °C, and 1 min at 72 °C, then 25 cycles of 45 s at 94 °C, 45 s at 58–60 °C, and 1 min at 72 °C, and a final extension at 72 °C for 10 min.

Ethanol Precipitation:

Article Title: Phenylacetyl Coenzyme A Is an Effector Molecule of the TetR Family Transcriptional Repressor PaaR from Thermus thermophilusHB8 ▿HB8 ▿ †
Article Snippet: Total RNA, isolated from the wild-type T. thermophilus HB8 strain cultured for 11.3 h in rich medium, was treated with DNase I, followed by ethanol precipitation, as described previously ( ). .. The PCR analysis involved 40 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 3.5 min in GC buffer I (Takara Bio).

Spectrophotometry:

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: DNA purity was assessed by spectrophotometry, and DNA samples were stored at -20°C. .. PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA.

Genotyping Assay:

Article Title: Two novel sodium channel mutations associated with resistance to indoxacarb and metaflumizone in the diamondback moth, Plutella xylostella
Article Snippet: Paragraph title: DNA-based genotyping assay for the F1845Y and V1848I mutations of PxNav ... The PCR reaction solution consisted of 12.5 μ L 2×GC Buffer I (Takara, Japan), 1 μ L of each primer (10 μ mol/L), 1 μ L of dNTP mixture (10 mmol/L), 1 μ L template genomic DNA, 8.3 μ L sterile distilled water and 0.2 μ L LA Taq DNA polymerase (Takara, Japan) in a final volume of 25 μ L. The PCR amplification was performed for 35 cycles (94 °C for 30 s, 47 °C for 30 s, and 72 °C for 1 min) with a final extension at 72 °C for 10 min.

DNA Purification:

Article Title: Association of LOX-1 gene polymorphisms with cerebral infarction in northern Chinese Han population
Article Snippet: DNA Extraction and Genotyping Genomic DNA was extracted from EDTA-anticoagulated peripheral blood by a DNA Purification Kit (Promega, Madison, USA). .. PCR amplification was performed in a total volume of 10 μL that contained 1× GC buffer I (Takara, Japan), 3.0 mM Mg2+ (Takara, Japan), 0.3 mM dNTP (Generay Biotech, China), 1 U HotStarTaq polymerase (Qiagen, Germany), 1 μL each primers (Sangon, China) and 1 μL genomic DNA.

Staining:

Article Title: MYC Protein Inhibits Transcription of the MicroRNA Cluster MC-let-7a-1~let-7d via Noncanonical E-box *
Article Snippet: Nested PCR was performed with an abridged universal amplification primer (provided in the kit) and a GSP2-2 ( ) by using TaKaRa LA Taq® with GC Buffer I (TaKaRa). .. The 5′-RACE PCR products were resolved on a 1% agarose gel and stained by EtBr.

Article Title: Overexpression of TiERF1 enhances resistance to sharp eyespot in transgenic wheat
Article Snippet: The PCR was performed in a total volume of 25 μl containing 1× GC buffer I (TaKaRa), 100–200 ng of genomic DNA, 187.5 μM of each dNTP (TaKaRa), 0.25 μM of each primer, and 1 U of Taq polymerase (TaKaRa), and subjected to a program of initial denaturation at 94 °C for 4 min, followed by 10 cycles of 45 s at 94 °C, 45 s at 62 °C, and 1 min at 72 °C, then 25 cycles of 45 s at 94 °C, 45 s at 58–60 °C, and 1 min at 72 °C, and a final extension at 72 °C for 10 min. .. The amplified product (341 bp) specific to the TiERF1 gene was resolved on a 1% (w/v) agarose gel and visualized by ethidium bromide staining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    TaKaRa special gc buffer i
    Special Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/special gc buffer i/product/TaKaRa
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    special gc buffer i - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    87
    TaKaRa 1x gc buffer i
    1x Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 87/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x gc buffer i/product/TaKaRa
    Average 87 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    1x gc buffer i - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    95
    TaKaRa 2×gc buffer i
    2×Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/2×gc buffer i/product/TaKaRa
    Average 95 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    2×gc buffer i - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    99
    TaKaRa gc i buffer
    Gc I Buffer, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc i buffer/product/TaKaRa
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    gc i buffer - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results