gc buffer i  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    TaKaRa LA Taq DNA Polymerase with GC Buffer
    Description:
    TaKaRa LA Taq DNA Polymerase with GC Buffer has the Takara LA Taq DNA Polymerase blend for long and accurate PCR paired with GC optimized buffers to power through difficult to amplify GC rich sequences including genomic DNA The GC optimized Buffers I and II are specifically designed to amplify GC rich DNA templates up to 73 GC content or templates with a significant amount of secondary structure
    Catalog Number:
    rr02ag
    Price:
    None
    Size:
    125 Units
    Category:
    LA Taq DNA polymerase with GC buffers GC rich PCR PCR
    Buy from Supplier


    Structured Review

    TaKaRa gc buffer i
    TaKaRa LA Taq DNA Polymerase with GC Buffer has the Takara LA Taq DNA Polymerase blend for long and accurate PCR paired with GC optimized buffers to power through difficult to amplify GC rich sequences including genomic DNA The GC optimized Buffers I and II are specifically designed to amplify GC rich DNA templates up to 73 GC content or templates with a significant amount of secondary structure
    https://www.bioz.com/result/gc buffer i/product/TaKaRa
    Average 94 stars, based on 99 article reviews
    Price from $9.99 to $1999.99
    gc buffer i - by Bioz Stars, 2020-09
    94/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Visualizing the Distribution of Synapses from Individual Neurons in the Mouse Brain
    Article Snippet: .. To detect correct targeting at the 5′ end of ROSA26, we amplified ∼1.5 kb genomic DNA fragment using primers: Rosa3 ( CCACTGACCGCACGGGGATTC ) and Rosa4 ( TCAATGGGCGGGGGTCGTT ), and LA Taq with GC buffer I (Takara, Cat No. RR02AG). .. To detect the correct targeting at the 3′ end of ROSA26, we amplified ∼6 kb genomic DNA fragment using primers Rosa8 ( GGATCCCCGAATTCTAGATAACTGATCATAATCAGCC ) and Rosa9 ( GGGGAAAATTTTTAATATAAC ), and LA Taq with LA PCR Buffer II (Takara, Cat No. RR002M).

    Article Title: Cloning, expression, and characterization of a new Streptomyces sp. S27 xylanase for which xylobiose is the main hydrolysis product.
    Article Snippet: .. A xylanase gene, xynBS27, was cloned from Streptomyces sp. S27 and consisted of 693 bp encoding a 230-residue protein, including a putative 41-residue signal peptide. ..

    Construct:

    Article Title: Cloning, expression, and characterization of a new Streptomyces sp. S27 xylanase for which xylobiose is the main hydrolysis product.
    Article Snippet: .. A xylanase gene, xynBS27, was cloned from Streptomyces sp. S27 and consisted of 693 bp encoding a 230-residue protein, including a putative 41-residue signal peptide. ..

    Polymerase Chain Reaction:

    Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
    Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

    Article Title: Large-scale microsatellite development in grasspea (Lathyrus sativus L.), an orphan legume of the arid areas
    Article Snippet: .. Then the no bands or weak bands primers were used in the second round PCR reaction using TAKaRa LA Taq polymerase with GC buffer (Code No.: RR02AG, TaKaRa, Dalian, China) according to the manufacturer’s instructions. .. SSRs were amplified on Heijingang Thermal Cycler (Eastwin, Beijing, China).

    other:

    Article Title: A phytoplasma related to 'Candidatus phytoplasma asteri' detected in citrus showing Huanglongbing (yellow shoot disease) symptoms in Guangdong, P. R. China.
    Article Snippet: The reaction mixture contained: 2.5 µl of 10× DNA polymerase buffer, 2.5 µl of dNTPs (2.5 mM of each dNTP), 0.5 µl each of the forward and reverse primers (10 µM), 1 µl of sample DNA, 0.2 µl of Taq DNA polymerase (5 U/µl) and 18.3 µl of H2O.

    Expressing:

    Article Title: Cloning, expression, and characterization of a new Streptomyces sp. S27 xylanase for which xylobiose is the main hydrolysis product.
    Article Snippet: .. A xylanase gene, xynBS27, was cloned from Streptomyces sp. S27 and consisted of 693 bp encoding a 230-residue protein, including a putative 41-residue signal peptide. ..

    Sequencing:

    Article Title: Cloning, expression, and characterization of a new Streptomyces sp. S27 xylanase for which xylobiose is the main hydrolysis product.
    Article Snippet: .. A xylanase gene, xynBS27, was cloned from Streptomyces sp. S27 and consisted of 693 bp encoding a 230-residue protein, including a putative 41-residue signal peptide. ..

    Variant Assay:

    Article Title: Next Generation Sequencing-Based Fetal ABO Blood Group Prediction by Analysis of Cell-Free DNA from Maternal Plasma
    Article Snippet: .. To separate the 2 alleles from the patient with the new variant, a long-range PCR of 5.6 kb covering exons 3–7 was performed using the TaKaRa Taq®RR02AG (TaKaRa Bio Inc., Japan) and the forward primer for exon 3 and reverse primer for exon 7. ..

    Plasmid Preparation:

    Article Title: Cloning, expression, and characterization of a new Streptomyces sp. S27 xylanase for which xylobiose is the main hydrolysis product.
    Article Snippet: .. A xylanase gene, xynBS27, was cloned from Streptomyces sp. S27 and consisted of 693 bp encoding a 230-residue protein, including a putative 41-residue signal peptide. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    TaKaRa special gc buffer i
    Special Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/special gc buffer i/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    special gc buffer i - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    91
    TaKaRa gc buffer i
    Gc Buffer I, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 120 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gc buffer i/product/TaKaRa
    Average 91 stars, based on 120 article reviews
    Price from $9.99 to $1999.99
    gc buffer i - by Bioz Stars, 2020-09
    91/100 stars
      Buy from Supplier

    Image Search Results