pcmv6 entry vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Gateway pENTR 1A Dual Selection Vector
    Description:
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    Catalog Number:
    a10462
    Price:
    None
    Applications:
    Cloning|Entry Vectors & Kits|Gateway Cloning
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier


    Structured Review

    Thermo Fisher pcmv6 entry vector
    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with <t>pCMV6-MEN1</t> vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    https://www.bioz.com/result/pcmv6 entry vector/product/Thermo Fisher
    Average 99 stars, based on 315 article reviews
    Price from $9.99 to $1999.99
    pcmv6 entry vector - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation"

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2016.10.021

    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P
    Figure Legend Snippet: Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Techniques Used: Expressing, Plasmid Preparation, Marker, Real-time Polymerase Chain Reaction, Flow Cytometry, Migration, Wound Healing Assay, Boyden Chamber Assay

    Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P
    Figure Legend Snippet: Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Knock-Out

    2) Product Images from "Phosphorylation of the phytosulfokine peptide receptor PSKR1 controls receptor activity"

    Article Title: Phosphorylation of the phytosulfokine peptide receptor PSKR1 controls receptor activity

    Journal: Journal of Experimental Botany

    doi: 10.1093/jxb/erx030

    Mutation of the calmodulin binding site abolishes PSKR1 kinase activity. A conserved tryptophan (W831) in the calmodulin binding site of PSKR1-KD was mutated to a serine. Included as controls were the wild-type (wt), the inactive K762E, and two isoforms in which G923 within the predicted guanylyl cyclase center was mutated to lysine or glutamate. (A) Schematic drawing of PSKR1-KD highlighting the point mutations analyzed. (B) The kinase isoforms (0.25 µg) were incubated with 32 P-ATP and and 0.5 µg of the substrate MBP. The autoradiograph (top) visualizes auto- and transphosphorylation activities of the isoforms (KD*). The Coomassie-stained gel (bottom) shows protein loading. M indicates the size marker in kDa. (C) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng –1 kinase isoform or ng – MBP. Results are means ±SE from three independent experiments with two replicates each. Significantly different values (Kruskal–Wallis, P
    Figure Legend Snippet: Mutation of the calmodulin binding site abolishes PSKR1 kinase activity. A conserved tryptophan (W831) in the calmodulin binding site of PSKR1-KD was mutated to a serine. Included as controls were the wild-type (wt), the inactive K762E, and two isoforms in which G923 within the predicted guanylyl cyclase center was mutated to lysine or glutamate. (A) Schematic drawing of PSKR1-KD highlighting the point mutations analyzed. (B) The kinase isoforms (0.25 µg) were incubated with 32 P-ATP and and 0.5 µg of the substrate MBP. The autoradiograph (top) visualizes auto- and transphosphorylation activities of the isoforms (KD*). The Coomassie-stained gel (bottom) shows protein loading. M indicates the size marker in kDa. (C) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng –1 kinase isoform or ng – MBP. Results are means ±SE from three independent experiments with two replicates each. Significantly different values (Kruskal–Wallis, P

    Techniques Used: Mutagenesis, Binding Assay, Activity Assay, Incubation, Autoradiography, Staining, Marker

    Phosphorylations at the JM domain and CT differentially affect PSKR1 receptor activity in roots and shoots. Full-length PSKR1 receptor isoforms as indicated were expressed in the pskr1-3 pskr2-1 receptor null background, with different numbers indicating independent lines. (A) Length of main root of 5-d-old seedlings grown under sterile conditions ( n =35–94). (B) Plant height of 6-week-old soil-grown plants ( n =18–27). (C) Projected rosette area of 4-week-old soil-grown plants ( n =19–27). Values are means from three independent biological experiments. Significant differences compared to the wild-type (wt) are indicated by * and significant differences compared to pskr1-3 pskr2-1 ( r1 r2 ) are indicated by ° (Kruskal–Wallis with Dunn’s test as post-hoc ; P
    Figure Legend Snippet: Phosphorylations at the JM domain and CT differentially affect PSKR1 receptor activity in roots and shoots. Full-length PSKR1 receptor isoforms as indicated were expressed in the pskr1-3 pskr2-1 receptor null background, with different numbers indicating independent lines. (A) Length of main root of 5-d-old seedlings grown under sterile conditions ( n =35–94). (B) Plant height of 6-week-old soil-grown plants ( n =18–27). (C) Projected rosette area of 4-week-old soil-grown plants ( n =19–27). Values are means from three independent biological experiments. Significant differences compared to the wild-type (wt) are indicated by * and significant differences compared to pskr1-3 pskr2-1 ( r1 r2 ) are indicated by ° (Kruskal–Wallis with Dunn’s test as post-hoc ; P

    Techniques Used: Activity Assay

    Phosphosites in the JM domain and in the N-lobe differentially alter PSKR1 kinase activity. The boxed residues in the juxtamembrane domain (A) and the N-terminal lobe (C) of PSKR1-KD (shown on the top) were point-mutated to either A as phosphoablative or D as phosphomimic mutations, and expressed as soluble PSKR1-KD (KD*) isoforms. A detailed description of the phosphosites is provided in Supplementary Fig. S2. Wild-type kinase (wt) and the inactive K762E variant were included as controls in each assay. (A, C) Kinase isoforms (0.25 µg) were incubated with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) shows auto- and transphosphorylation activities. A Coomassie-stained gel (bottom) shows loading of KD* and MBP, and M indicates the size marker in kDa. (B, D) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng –1 kinase isoform or ng –1 MBP. Results are means ±SE from three independent experiments with two replicates each. Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P
    Figure Legend Snippet: Phosphosites in the JM domain and in the N-lobe differentially alter PSKR1 kinase activity. The boxed residues in the juxtamembrane domain (A) and the N-terminal lobe (C) of PSKR1-KD (shown on the top) were point-mutated to either A as phosphoablative or D as phosphomimic mutations, and expressed as soluble PSKR1-KD (KD*) isoforms. A detailed description of the phosphosites is provided in Supplementary Fig. S2. Wild-type kinase (wt) and the inactive K762E variant were included as controls in each assay. (A, C) Kinase isoforms (0.25 µg) were incubated with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) shows auto- and transphosphorylation activities. A Coomassie-stained gel (bottom) shows loading of KD* and MBP, and M indicates the size marker in kDa. (B, D) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng –1 kinase isoform or ng –1 MBP. Results are means ±SE from three independent experiments with two replicates each. Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P

    Techniques Used: Activity Assay, Variant Assay, Incubation, Autoradiography, Staining, Marker

    PSKR1 kinase activity is not altered by binding of Ca 2+ -CaM2. (A) PSKR1-KD (0.25 µg) was incubated with MaBP-FLAG-CaM2 (1.5 µg) in the presence of 100 µM Ca 2+ or without calcium to allow for Ca 2+ -CaM/PSKR1-KD binding, followed by a kinase assay with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) visualizes auto- and transphosphorylation activities. The Coomassie-stained gel (bottom) shows PSKR1-KD, MaBP-FLAG-CaM2, and MBP; M indicates the size marker in kDa. (B) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng – kinase isoform or ng –1 MBP. Results are means ±SE of three independent biological experiments with two technical replicates each. Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P
    Figure Legend Snippet: PSKR1 kinase activity is not altered by binding of Ca 2+ -CaM2. (A) PSKR1-KD (0.25 µg) was incubated with MaBP-FLAG-CaM2 (1.5 µg) in the presence of 100 µM Ca 2+ or without calcium to allow for Ca 2+ -CaM/PSKR1-KD binding, followed by a kinase assay with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) visualizes auto- and transphosphorylation activities. The Coomassie-stained gel (bottom) shows PSKR1-KD, MaBP-FLAG-CaM2, and MBP; M indicates the size marker in kDa. (B) Incorporated 32 P was quantified by liquid scintillation. Auto- and transphosphorylation activities are shown as cpm ng – kinase isoform or ng –1 MBP. Results are means ±SE of three independent biological experiments with two technical replicates each. Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P

    Techniques Used: Activity Assay, Binding Assay, Incubation, Chick Chorioallantoic Membrane Assay, Kinase Assay, Autoradiography, Staining, Marker

    Homology model of PSKR1. (A) The structure of PSKR1-KD was modeled with Phyre2 and visualized with PyMOL version 1.2. The phosphorylation sites identified by Hartmann et al. (2015) are highlighted in red. (B) αC harbors the phosphosite S783 and the salt bridge-forming E778. (C) The ATP binding cleft is located between the Gly-rich loop and β7. (D) The side-chain of S911 points to the activation segment and is in close proximity to the phosphates of S893 and T894. (E) Phosphorylation of T998 interferes with αE that harbors the CaM binding site. Two leucine residues adjacent to the T998 phosphate may contribute to steric obstruction.
    Figure Legend Snippet: Homology model of PSKR1. (A) The structure of PSKR1-KD was modeled with Phyre2 and visualized with PyMOL version 1.2. The phosphorylation sites identified by Hartmann et al. (2015) are highlighted in red. (B) αC harbors the phosphosite S783 and the salt bridge-forming E778. (C) The ATP binding cleft is located between the Gly-rich loop and β7. (D) The side-chain of S911 points to the activation segment and is in close proximity to the phosphates of S893 and T894. (E) Phosphorylation of T998 interferes with αE that harbors the CaM binding site. Two leucine residues adjacent to the T998 phosphate may contribute to steric obstruction.

    Techniques Used: Binding Assay, Activation Assay, Chick Chorioallantoic Membrane Assay

    Differential impact of phosphosites in the C-lobe and at the CT on PSKR1 kinase activity. The boxed residues (A, C; top) in the N-lobe of PSKR1-KD were point-mutated to either A or D, and kinase activity was compared to the wild-type and to the inactive K762E isoform. (A, C) The kinase isoforms (0.25 µg) were incubated with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) shows auto- and transphosphorylation activities. A Coomassie-stained gel (bottom) shows loading of KD* and MBP, and M indicates the size marker in kDa. (B, D) 32 P incorporated in PSKR1-KD and MBP was quantified and analyzed as described in the legend for Fig.2B and 2D . Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P
    Figure Legend Snippet: Differential impact of phosphosites in the C-lobe and at the CT on PSKR1 kinase activity. The boxed residues (A, C; top) in the N-lobe of PSKR1-KD were point-mutated to either A or D, and kinase activity was compared to the wild-type and to the inactive K762E isoform. (A, C) The kinase isoforms (0.25 µg) were incubated with 32 P-ATP and 0.5 µg of the substrate MBP. The autoradiograph (top) shows auto- and transphosphorylation activities. A Coomassie-stained gel (bottom) shows loading of KD* and MBP, and M indicates the size marker in kDa. (B, D) 32 P incorporated in PSKR1-KD and MBP was quantified and analyzed as described in the legend for Fig.2B and 2D . Significantly different values are indicated by different lower case letters for autophosphorylation and with capital letters for transphosphorylation (Kruskal–Wallis, P

    Techniques Used: Activity Assay, Incubation, Autoradiography, Staining, Marker

    Phosphorylation in the JM domain and at the CT impair shoot growth. The full-length PSKR1 receptor was mutated as indicated and introduced into the pskr1-3 pskr2-1 receptor null background. Plants were grown on soil for (A) 4 weeks to measure rosette areas, and (B) for 6 weeks to measure plant height. The numbers indicate independently transformed lines. (This figure is available in color at JXB online.)
    Figure Legend Snippet: Phosphorylation in the JM domain and at the CT impair shoot growth. The full-length PSKR1 receptor was mutated as indicated and introduced into the pskr1-3 pskr2-1 receptor null background. Plants were grown on soil for (A) 4 weeks to measure rosette areas, and (B) for 6 weeks to measure plant height. The numbers indicate independently transformed lines. (This figure is available in color at JXB online.)

    Techniques Used: Transformation Assay

    Binding of CaM2 to PSKR1-KD is Ca 2+ -dependent and determined by the phosphorylation state of PSKR1-KD. (A) Western blots with His-tagged (H 6 ) PSKR1-KD (H 6 -PSKR1-KD) or H 6 -PSKR1-KD(W831S) that was bound by maltose binding protein (MaBP)-tagged and FLAG-tagged CaM2 (MaBP-FLAG-CaM2) in the presence of 100 µM CaCl 2 or 100 µM MgCl 2 or without divalent cation. (B) H 6 -PSKR1-KD was incubated with ATP to allow for autophosphorylation or left unphosphorylated prior to pull-down with MBP-FLAG-CaM2 in the presence or absence of 100 µM Ca 2+ . Blots are shown in greyscale and were uniformly adjusted in contrast (–20%) and brightness (+40%). Results were confirmed in independent experiments.
    Figure Legend Snippet: Binding of CaM2 to PSKR1-KD is Ca 2+ -dependent and determined by the phosphorylation state of PSKR1-KD. (A) Western blots with His-tagged (H 6 ) PSKR1-KD (H 6 -PSKR1-KD) or H 6 -PSKR1-KD(W831S) that was bound by maltose binding protein (MaBP)-tagged and FLAG-tagged CaM2 (MaBP-FLAG-CaM2) in the presence of 100 µM CaCl 2 or 100 µM MgCl 2 or without divalent cation. (B) H 6 -PSKR1-KD was incubated with ATP to allow for autophosphorylation or left unphosphorylated prior to pull-down with MBP-FLAG-CaM2 in the presence or absence of 100 µM Ca 2+ . Blots are shown in greyscale and were uniformly adjusted in contrast (–20%) and brightness (+40%). Results were confirmed in independent experiments.

    Techniques Used: Binding Assay, Western Blot, Incubation

    Related Articles

    Clone Assay:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Selection:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Isolation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Construct:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Sequencing:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Modification:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Plasmid Preparation:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation
    Article Snippet: .. The pCMV6-Entry vector without the Men1 insert was used as a control. .. Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Article Title: Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP
    Article Snippet: .. Dicer and Dicer-HisC cDNAs were recloned from pBS plasmids into the pENTR1A vector, using the Gateway system (Life Technologies), yielding pENTR-Dicer and pENTR-Dicer-HisC. .. The non-tagged Dicer cDNA was then switched to the pDEST10 vector by the reaction catalysed by LR Clonase mix (Life Technologies), yielding pDEST10-Dicer, used for expression of the N-terminally His6 -tagged Dicer-HisN.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher gateway pentr 1a dual selection vector
    Gateway Pentr 1a Dual Selection Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gateway pentr 1a dual selection vector/product/Thermo Fisher
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    gateway pentr 1a dual selection vector - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results