pentr 1a dual selection vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Gateway pENTR 1A Dual Selection Vector
    Description:
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    Catalog Number:
    a10462
    Price:
    None
    Applications:
    Cloning|Entry Vectors & Kits|Gateway Cloning
    Category:
    DNA Vectors Clones Purified Nucleic Acids Libraries
    Buy from Supplier


    Structured Review

    Thermo Fisher pentr 1a dual selection vector
    Gateway entry vectors are designed to clone DNA sequences using restriction endonucleases and ligase to create a Gateway entry clone The entry clone is ready for recombination with a destination vector to create an expression clone New pENTR Dual Selection vectors The Gateway entry vectors Table 1 offer the following • attL1 and attL2 sites for site specific recombination of the entry clone with a Gateway destination vector to ensure cloning of the gene of interest in the correct orientation for expression• Kozak consensus sequence for efficient translation initiation in eukaryotic systems• Ribosome binding site for efficient translation initiation in prokaryotic systems pENTR 1A Dual Selection pENTR 3C Dual Selection and pENTR 11 Dual Selection vectors only • rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli • pUC origin for high copy replication and maintenance of the plasmid in E coli• Kanamycin resistance gene for selection in E coli• The ccdB⁄chloramphenicol fusion gene located between the two attL sites for o negative selection ando Chloramphenicol selection in E coli• Kanamycin resistance gene for selection in E coli
    https://www.bioz.com/result/pentr 1a dual selection vector/product/Thermo Fisher
    Average 90 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    pentr 1a dual selection vector - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. This vector has then been used as mother plasmid for subsequent cloning.

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Cloning primer sequences are available upon request.

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: .. The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites. .. After sequencing confirmation, the genes in pENTR1A were transferred into the adenoviral expression vector pAd/CMV/V5-DEST (Invitrogen) by recombination following the manufacturer's instructions.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: Briefly, double-stranded rat Nrf2 miRNA (miNrf2) (5′-TACACAGGGACAGATCACAGC-3′) was cloned into pcDNA 6.2-GW/EmGFP-miR expression vector using T4 DNA ligase. .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00).

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Amplification:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: A Prdm14 -IRES-nls-EGFP fragment was then amplified from pBGT-Prdm14 . .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites.

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: To generate the UAS-hobbit transgene, the full-length hobbit coding sequence was amplified from w1118 cDNA using the following primers: 5′-AAAAGGTACCATGATGCTACAGCTACTTCTATTCTGCCTGG-3′ and 5′-AAAAAAGCGGCCGCTCAATCATTTCCCGATCTCTTTCCG-3′. .. The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: Full-length cDNA was amplified by PCR using primers with restriction enzyme sites for Xho I at the 5′-end and Kpn I at the 3′-end. .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen).

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: Full-length cDNA of APOBEC-1, ACF, CUGBP2, GRY-RBP, hnRNP-C1, hnRNP-A1, ABBP1, and ABBP2 from human small intestine; KSRP from Caco-2 cells; and BAG4 from BAG4-pCMV6-XL5 (Origene) were RT-PCR amplified by AccuPrime Pfx DNA polymerase (Invitrogen) with primers containing a restriction enzyme cutting site at the end ( ). .. The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: The cDNA encoding h JMJD1A was amplified by PCR from a human KIAA clone (KIAA0742). .. The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing.

    Polymerase Chain Reaction:

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: PCR fragments were subcloned into the pGEM-T Easy vector. .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen).

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: .. For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template. .. The mutation was introduced into ß4 integrin cDNA one by one.

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: .. To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I. .. The resultant plasmid was mixed with CS-IV-TRE-RfA-UbC-Puro or CS-IV-TRE-RfA-UbC-Hygro vector, and reacted with Gateway LR clonase to generate the lentivirus plasmid.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: .. The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing. .. To generate an expression vector, the entry clone was transferred into a Gateway-compatible pCMV-HA (hemagglutinin) vector.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The ES cell clones with homologous recombination were selected on hypoxanthine-aminopterin-thymidine–supplemented (HAT-supplemented) medium, and genotyping of HAT-resistant ES cell clones was performed by PCR analysis of genomic DNA using primers in the RIP140 gene and in the poly (A) sequence (Supplemental Table 1).

    Construct:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: Paragraph title: Generation of the ROSA26 targeting construct ... This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites.

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template. .. The final construct was recombined from pENTR1A to the LZRS blast retroviral vector, including a Gateway cassette, using the LR clonase II Enzyme mix (Invitrogen) by a recombination reaction.

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: .. To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I. .. The resultant plasmid was mixed with CS-IV-TRE-RfA-UbC-Puro or CS-IV-TRE-RfA-UbC-Hygro vector, and reacted with Gateway LR clonase to generate the lentivirus plasmid.

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: Paragraph title: Adenoviral constructs and expression preparation ... The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: K14-CYLDm (HA-CYLD.932) expression construct was generated with the PCR-product with pcDNA.HA-CYLD as a template . .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. This construct contained two regions of homology with the HPRT gene, which allowed insertion of the transgene at this locus.

    HAT Assay:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The ES cell clones with homologous recombination were selected on hypoxanthine-aminopterin-thymidine–supplemented (HAT-supplemented) medium, and genotyping of HAT-resistant ES cell clones was performed by PCR analysis of genomic DNA using primers in the RIP140 gene and in the poly (A) sequence (Supplemental Table 1).

    Expressing:

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: Paragraph title: Functional Analysis of LsNCED by Heterologous Expression ... The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen).

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: Paragraph title: Expression Vectors ... For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template.

    Article Title: Glucose-stimulated Single Pancreatic Islets Sustain Increased Cytosolic ATP Levels during Initial Ca2+ Influx and Subsequent Ca2+ Oscillations *
    Article Snippet: Adenovirus for the expression of GO-ATeam biosensors was generated using the ViraPowerTM adenoviral expression system (Invitrogen) according to the manufacturer's instructions. .. For construction of the adenoviral vector encoding GO-ATeam, the XhoI-PmeI fragment of pcDNA-GO-ATeam1 or pcDNA-mit-GO-ATeam1 ( ) was subcloned into the pENTR-1A vector (Invitrogen), digested with SalI and EcoRV, and then recombined into the pAd/CMV/V5-DEST destination vector.

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I. .. Plasmids expressing hCas9 and sgRNA were prepared by ligating oligos for the targeting site (mouse Fbxo22 exon1-163-185) into the BbsI site of pX330.

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: Paragraph title: Adenoviral constructs and expression preparation ... The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites.

    Article Title: Reciprocal t(9;22) ABL/BCR Fusion Proteins: Leukemogenic Potential and Effects on B Cell Commitment
    Article Snippet: All retroviral expression vectors used in this study were based on the bi-cistronic vectors PINCO or PAULO, with or without an internal ribosomal entry site (IRES) to drive translation of the two transgenes. .. All related inserts were available in the Gateway® entry-vector (pENTR1A) for recombination into the destination vectors by using the “LR-clonase” enzyme kit (Invitrogen) .

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: K14-CYLDm (HA-CYLD.932) expression construct was generated with the PCR-product with pcDNA.HA-CYLD as a template . .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice.

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00). .. Briefly, human Atg5 cDNA (pCMV-myc-Atg5, addgen 24922) and human Nrf2 cDNA (NCBI Reference Sequence: NM_006164.4) were cloned into a Topo blunt zero vector, respectively, to generate a Tope-Atg5 and a Topo-Nrf2 vector.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: The relative fold change in expression of each mRNA was calculated using the ΔΔCt method relative to 18S rRNA or human large ribosomal protein (hRPLPO) mRNA. .. The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing.

    Modification:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: .. Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. This vector has then been used as mother plasmid for subsequent cloning.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Derivative Assay:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Electroporation:

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The plasmids were introduced into Agrobacterium tumefaciens by electroporation.

    Transfection:

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites. .. The resultant pAd/CMV plasmids containing the target genes were linearized by Pac I digestion and were transfected into 293A cells by lipofectamine-2000 (Invitrogen).

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: Transfection of the expression clone into 293A cells was performed to produce Ad-miNrf2 stock. .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00).

    Ligation:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: Generation of the ROSA26 targeting construct Mouse Prdm14 was amplified from MIGR1-Prdm14 ( ) using Platinum Pfx polymerase (Life Technologies, Carlsbad, CA) followed by ligation into the IRES-nls-EGFP-containing vector pBTG (Addgene plasmid 15037) using the Nhe I and Xho I restriction sites. .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites.

    Infection:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. AIM2−/− iBMDMs were infected with AIM2-expressing lentiviruses, and iBMDM were infected with TREX1-expressing lentiviruses.

    Generated:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: .. Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. This vector has then been used as mother plasmid for subsequent cloning.

    Article Title: Glucose-stimulated Single Pancreatic Islets Sustain Increased Cytosolic ATP Levels during Initial Ca2+ Influx and Subsequent Ca2+ Oscillations *
    Article Snippet: Adenovirus for the expression of GO-ATeam biosensors was generated using the ViraPowerTM adenoviral expression system (Invitrogen) according to the manufacturer's instructions. .. For construction of the adenoviral vector encoding GO-ATeam, the XhoI-PmeI fragment of pcDNA-GO-ATeam1 or pcDNA-mit-GO-ATeam1 ( ) was subcloned into the pENTR-1A vector (Invitrogen), digested with SalI and EcoRV, and then recombined into the pAd/CMV/V5-DEST destination vector.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: K14-CYLDm (HA-CYLD.932) expression construct was generated with the PCR-product with pcDNA.HA-CYLD as a template . .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice.

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00). .. Briefly, human Atg5 cDNA (pCMV-myc-Atg5, addgen 24922) and human Nrf2 cDNA (NCBI Reference Sequence: NM_006164.4) were cloned into a Topo blunt zero vector, respectively, to generate a Tope-Atg5 and a Topo-Nrf2 vector.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: C57BL/6/129 RIP140 transgenic ( RIPTg ) mice were generated using Speedy Mouse Technology (Nucleis) by insertion of a single copy of human RIP140 cDNA at the HPRT locus. .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter.

    DNA Sequencing:

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. All plasmids were sequence verified at Duke DNA sequencing core facility.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: Full-length cDNA of APOBEC-1, ACF, CUGBP2, GRY-RBP, hnRNP-C1, hnRNP-A1, ABBP1, and ABBP2 from human small intestine; KSRP from Caco-2 cells; and BAG4 from BAG4-pCMV6-XL5 (Origene) were RT-PCR amplified by AccuPrime Pfx DNA polymerase (Invitrogen) with primers containing a restriction enzyme cutting site at the end ( ). .. The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites.

    Affinity Purification:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. Enhanced Yellow Fluorescent Protein (EYFP) and Enhanced Cyan Fluorescent Protein (ECFP) were chosen for localization analyses and for in vivo protein-protein interaction studies by FRET, HA and cMyc were selected as epitope tags for immunoprecipitation, and GST and STREP (streptavidin) tags were chosen for affinity purification assays.

    Recombinant:

    Article Title: Glucose-stimulated Single Pancreatic Islets Sustain Increased Cytosolic ATP Levels during Initial Ca2+ Influx and Subsequent Ca2+ Oscillations *
    Article Snippet: Paragraph title: Generation of Recombinant Adenovirus ... For construction of the adenoviral vector encoding GO-ATeam, the XhoI-PmeI fragment of pcDNA-GO-ATeam1 or pcDNA-mit-GO-ATeam1 ( ) was subcloned into the pENTR-1A vector (Invitrogen), digested with SalI and EcoRV, and then recombined into the pAd/CMV/V5-DEST destination vector.

    Molecular Cloning:

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: Paragraph title: Molecular cloning and transgenic animal generation ... The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified.

    In Vivo:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. Enhanced Yellow Fluorescent Protein (EYFP) and Enhanced Cyan Fluorescent Protein (ECFP) were chosen for localization analyses and for in vivo protein-protein interaction studies by FRET, HA and cMyc were selected as epitope tags for immunoprecipitation, and GST and STREP (streptavidin) tags were chosen for affinity purification assays.

    Mutagenesis:

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. T-DNA was transferred into the nced3 mutant T5004 ( ) by the floral dipping method ( ).

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: Expression Vectors The N -glycosylation site-defective mutant cDNA was obtained by PCR using specific primer sets and KOD Plus polymerase (TOYOBO). .. For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing. .. The QuikChange site-directed mutagenesis kit (Stratagene) was used to create JMJD2B(H189G/E191Q) and JMJD1A(H1120G/D1122N).

    Isolation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Purification:

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Sequencing:

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: .. The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified. .. LR Clonase (Invitrogen) was used to recombine the entry clone into the pTW ( Drosophila Genomics Resource Center) destination vector.

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template. .. The cDNA sequence was verified by sequencing at each step.

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites. .. After sequencing confirmation, the genes in pENTR1A were transferred into the adenoviral expression vector pAd/CMV/V5-DEST (Invitrogen) by recombination following the manufacturer's instructions.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. All plasmids were sequence verified at Duke DNA sequencing core facility.

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00). .. Briefly, human Atg5 cDNA (pCMV-myc-Atg5, addgen 24922) and human Nrf2 cDNA (NCBI Reference Sequence: NM_006164.4) were cloned into a Topo blunt zero vector, respectively, to generate a Tope-Atg5 and a Topo-Nrf2 vector.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: .. The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing. .. To generate an expression vector, the entry clone was transferred into a Gateway-compatible pCMV-HA (hemagglutinin) vector.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Selection:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00). .. Briefly, human Atg5 cDNA (pCMV-myc-Atg5, addgen 24922) and human Nrf2 cDNA (NCBI Reference Sequence: NM_006164.4) were cloned into a Topo blunt zero vector, respectively, to generate a Tope-Atg5 and a Topo-Nrf2 vector.

    Blocking Assay:

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: Adenovirus of miScramble was generated using pcDNA 6.2-GW/EmGFP-miR-neg control plasmid which is provided in the BLOCK-iT Pol II miR RNAi Expression Vector Kits. .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00).

    Mouse Assay:

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: C57BL/6/129 RIP140 transgenic ( RIPTg ) mice were generated using Speedy Mouse Technology (Nucleis) by insertion of a single copy of human RIP140 cDNA at the HPRT locus. .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter.

    Injection:

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified. .. The resulting UAS-hobbit plasmid was then injected into w1118 flies using standard methods (Genetic Services).

    Plasmid Preparation:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: .. Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. This vector has then been used as mother plasmid for subsequent cloning.

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: .. The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified. .. LR Clonase (Invitrogen) was used to recombine the entry clone into the pTW ( Drosophila Genomics Resource Center) destination vector.

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: N-Glycosylation of ss4 Integrin Controls the Adhesion and Motility of Keratinocytes
    Article Snippet: .. For the first PCR, WT ß4 integrin cDNA in pENTR1A vector (Invitrogen) was used as a template. .. The mutation was introduced into ß4 integrin cDNA one by one.

    Article Title: Glucose-stimulated Single Pancreatic Islets Sustain Increased Cytosolic ATP Levels during Initial Ca2+ Influx and Subsequent Ca2+ Oscillations *
    Article Snippet: .. For construction of the adenoviral vector encoding GO-ATeam, the XhoI-PmeI fragment of pcDNA-GO-ATeam1 or pcDNA-mit-GO-ATeam1 ( ) was subcloned into the pENTR-1A vector (Invitrogen), digested with SalI and EcoRV, and then recombined into the pAd/CMV/V5-DEST destination vector. .. Plasma membranes of cells were permeabilized with 100 μg/ml α-hemolysin from Staphylococcus aureus (Sigma) for 30 min. After permeabilization, cells were perfused with intracellular-like medium containing 140 m m KCl, 6 m m NaCl, 1 m m MgCl2 , 0.465 m m CaCl2 , 2 m m EGTA, and 12.5 m m HEPES (pH 7.0) and different concentrations of MgATP.

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: .. To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I. .. The resultant plasmid was mixed with CS-IV-TRE-RfA-UbC-Puro or CS-IV-TRE-RfA-UbC-Hygro vector, and reacted with Gateway LR clonase to generate the lentivirus plasmid.

    Article Title: Hypermutation induced by APOBEC-1 overexpression can be eliminated
    Article Snippet: .. The amplicons were cloned into pENTR1A vector (Invitrogen) using restriction enzyme sites. .. After sequencing confirmation, the genes in pENTR1A were transferred into the adenoviral expression vector pAd/CMV/V5-DEST (Invitrogen) by recombination following the manufacturer's instructions.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Article Title: Nrf2 Deficiency Exaggerates Doxorubicin-Induced Cardiotoxicity and Cardiac Dysfunction
    Article Snippet: .. Adenovirus of Nrf2 (Ad-Nrf2) and Atg5 (Ad-Atg5) was generated using pENTR 1A Dual Selection Vector (Invitrogen, A10462) and ViraPower Adenoviral Promoterless Gateway Expression Kit (Invitrogen, K4940-00). .. Briefly, human Atg5 cDNA (pCMV-myc-Atg5, addgen 24922) and human Nrf2 cDNA (NCBI Reference Sequence: NM_006164.4) were cloned into a Topo blunt zero vector, respectively, to generate a Tope-Atg5 and a Topo-Nrf2 vector.

    Article Title: The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF *The Histone Demethylases JMJD1A and JMJD2B Are Transcriptional Targets of Hypoxia-inducible Factor HIF * S⃞
    Article Snippet: .. The PCR product was inserted into the XhoI and SalI sites of the pENTR1A vector (Invitrogen) and verified by sequencing. .. To generate an expression vector, the entry clone was transferred into a Gateway-compatible pCMV-HA (hemagglutinin) vector.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Functional Assay:

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: Paragraph title: Functional Analysis of LsNCED by Heterologous Expression ... The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen).

    shRNA:

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: Plasmid construction To generate lentivirus-based shRNA constructs, a 19–21 bp shRNA-coding fragment with a 5′-ACGTGTGCTGTCCGT-3′ loop was introduced into pENTR4-H1 digested with Age I/Eco RI. .. To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I.

    Transgenic Assay:

    Article Title: Hobbit regulates intracellular trafficking to drive insulin-dependent growth during Drosophila development
    Article Snippet: Paragraph title: Molecular cloning and transgenic animal generation ... The resulting ∼6.9 kb product was digested with Kpn I and Not I, ligated into the Gateway entry vector pENTR 1A (Invitrogen), and sequence verified.

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: .. The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. LZRS.CYLDWT and LZRS.CYLDm were generated by using the PmeI fragment from pcDNA.HA.CYLD and the PCR-fragment encoding HA-CYLD.932.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: C57BL/6/129 RIP140 transgenic ( RIPTg ) mice were generated using Speedy Mouse Technology (Nucleis) by insertion of a single copy of human RIP140 cDNA at the HPRT locus. .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter.

    Produced:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: CYLD Inhibits Tumorigenesis and Metastasis by Blocking JNK/AP1 Signaling at Multiple Levels
    Article Snippet: The purified PCR product was cloned into the pENTR1A vector (Invitrogen, Carlsbad, CA) and then gateway cloned into pBskII.K14 plasmid , which was then linearlized with KpnI and SmaI for the generation of transgenic mice. .. Retroviruses were produced in phoenix cells as described .

    Immunoprecipitation:

    Article Title: A modified Gateway cloning strategy for overexpressing tagged proteins in plants
    Article Snippet: Results In order to obtain modified Gateway Entry cassettes for epitope tagging, we first generated a pENT-Stop vector by introducing a short fragment into pENTR-1A (Invitrogen) in place of the ccd B toxicity gene (Figure ) to generate a Not I site followed by a stop-codon. .. Enhanced Yellow Fluorescent Protein (EYFP) and Enhanced Cyan Fluorescent Protein (ECFP) were chosen for localization analyses and for in vivo protein-protein interaction studies by FRET, HA and cMyc were selected as epitope tags for immunoprecipitation, and GST and STREP (streptavidin) tags were chosen for affinity purification assays.

    FLAG-tag:

    Article Title: SCFFbxo22-KDM4A targets methylated p53 for degradation and regulates senescence
    Article Snippet: .. To construct Tet-on-inducible lentivirus constructs, the PCR-generated Bam HI/Not I fragments containing cDNA for human/mouse Fbxo22 wild type or the respective mutants, human KDM4A wild type or H188A and human p53 wild type or the respective mutants, were inserted into a pENTR-1A vector (Invitrogen) containing the Flag epitope or EGFP digested with BamH I/Not I. .. The resultant plasmid was mixed with CS-IV-TRE-RfA-UbC-Puro or CS-IV-TRE-RfA-UbC-Hygro vector, and reacted with Gateway LR clonase to generate the lentivirus plasmid.

    FACS:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. GFP-positive cells were FACS-sorted 96 h postinfection.

    Homologous Recombination:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The ES cell clones with homologous recombination were selected on hypoxanthine-aminopterin-thymidine–supplemented (HAT-supplemented) medium, and genotyping of HAT-resistant ES cell clones was performed by PCR analysis of genomic DNA using primers in the RIP140 gene and in the poly (A) sequence (Supplemental Table 1).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Thermo Fisher gateway pentr 1a dual selection vector
    Gateway Pentr 1a Dual Selection Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gateway pentr 1a dual selection vector/product/Thermo Fisher
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gateway pentr 1a dual selection vector - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    Image Search Results