gateway pdonr221 vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Name:
    Gateway pDONR221 Vector
    Description:
    Gateway Technology enables rapid cloning of one or more genes into virtually any protein expression system. Once you have an entry clone, you can recombine your gene of interest into a variety of expression vectors adapted for use in Gateway Technology. The PCR product is directionally cloned with efficiencies typically >99%. The pDONR221 vector has a pUC origin for high plasmid yields and universal M13 sequencing sites for ease of use.
    Catalog Number:
    12536017
    Price:
    None
    Applications:
    Cloning|Donor Vectors|Gateway Cloning
    Size:
    6 µg
    Category:
    DNA Vectors, Clones, Purified Nucleic Acids & Libraries, DNA Vectors, Gateway Donor Vectors - pDONR
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher gateway pdonr221 vector
    Gateway Technology enables rapid cloning of one or more genes into virtually any protein expression system. Once you have an entry clone, you can recombine your gene of interest into a variety of expression vectors adapted for use in Gateway Technology. The PCR product is directionally cloned with efficiencies typically >99%. The pDONR221 vector has a pUC origin for high plasmid yields and universal M13 sequencing sites for ease of use.
    https://www.bioz.com/result/gateway pdonr221 vector/product/Thermo Fisher
    Average 96 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    gateway pdonr221 vector - by Bioz Stars, 2020-01
    96/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: First, the region containing the hU6 promoter, Bbs I cloning sites, gRNA scaffold, PGK promoter, and selectable markers Puromycin and BFP (Blue Fluorescent protein) (hU6-gRNA-PGK-Puro-T2A-BFP) was amplified by PCR from the pKLV-U6gRNA-PGKpuro2ABFP plasmid using the Platinum Pfx Kit (Invitrogen, Cat. 11708-013) and the primers aTTB Fw and aTTB Rv (Supplementary Table ). .. The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions.

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Primers for truncated MEF2D were designed to amplify from the N terminus of MEF2D to the last amino acid fused to BCL9 with a stop codon inserted at the fusion point. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher). .. Truncated MEF2D -pDONR221 vector was shuttled into a Gateway-compatible MSCV-IRES-GFP vector using the LR Clonase enzyme (Thermo Fisher).

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: GLS shRNA stable cell lines were selected in media containing puromycin (1μg/mL). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. Gateway technology (Thermo Fisher Scientific) was utilized to produce the constructs in pLenti 6.3 cV5_DEST and pLCMVhyg-wpre_DEST expression vectors for KGA and GAC, respectively.

    Article Title: Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes
    Article Snippet: RGP proteins seem to be more amenable to this than other CWGTs tested here, and we have successfully produced ~1 mg of > 90% pure Arabidopsis thaliana RGP1 that has the expected mutase and autoglycosylation activities. .. CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA). .. In a round-bottomed 96-well plate, 1 μl of each donor vector was mixed with 1 μl of expression vector and 0.25 μl LR Clonase II (Thermo Fisher Scientific, cat# 11791100) and incubated 2 h at room temperature.

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. See supplementary files for detailed digital plasmid maps of these vectors.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen).

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Entry clones were verified using sequence analysis and then recombined into pHYGREX5, which placed each cDNA between the Cauliflower mosiac virus (CaMV) 35S promoter and the ocs 3ʹ transcriptional terminator. pHYGREX5, a Gateway-adapted version of the binary vector pCAMBIA1300 was constructed by isolating the 3.9kb 35S-att R1-Cm-ccd B-att R2-OCS cassette from pHEX2 ( ) by Sac I/Sac II digestion, gel purification, and ligation into Sma I-digested pCAMBIA1300.

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: To construct Pdat-1 ::CFP::CL-1 transgenic worms, pPD133.48, a CFP containing plasmid (gift from Andy Fire) was used as a template to amplify CFP::CL-1 using a CFP specific forward primer and a reverse primer that incorporated the last few nucleotides of CFP and the entire CL-1 sequence (sequences available upon request). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 . .. 10 µg each of Pdat-1 ::CFP::CL-1 plasmid DNA and an unc-119 rescuing vector (pDP#MM016B) were co-introduced into unc-119 worms by biolistic bombardment using a Bio-Rad Biolistic PDS-1000/He particle delivery system .

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The vesicles markers Ypt1, Ypt31, Sec4, Ypt6, Vps21, Ypt52 and Ypt7 used on fluorescence microscopy experiments were constructed by Gitler and co-workers and were obtained from Addgene (pAG416GPD-Cerulean-YPT1 , 18848; pAG416GPD-Cerulean-YPT31 , 18849; pAG416GPD-Cerulean-SEC4 , 18844; pAG416GPD-Cerulean-YPT6 , 18845; pAG416GPD-Cerulean-VPS21 , 18842; pAG416GPD-Cerulean-YPT52 , 18843; pAG416GPD-Cerulean-YPT7 , 18847). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen). .. These clones were then used to generate new integrative vectors in the pAG305 GPD-Cerulean-ccdB vector which were verified by DNA sequencing.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The 35S:GFP-KRP6 -containing plant transformation vector pK7WGF2-KRP6 was obtained by Gateway LR reaction (Invitrogen) of pEntryL1L2-KRP6 with the destination vector pK7WGF2 ( ). .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. Using the primer pair CTACATCCCT C TGGGACTGAGGACTG and CAGTCCTCAGTCCCA G AGGGATGTAG (altered nucleotides underlined), the active-site Cys178 codon was changed to that for serine by the Quickchange method (Stratagene, La Jolla, CA).

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: Restriction enzymes (NEB) and T4 ligase (NEB) were used to digest and ligate the DNA fragments, respectively. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Gibson one-pot, isothermal DNA assembly was conducted at 10 μl scale by incubating T5 exonuclease (NEB), Phusion polymerase (NEB), Taq ligase (NEB) and 50 ng of each DNA fragment at 50 °C for 1 h to assemble multiple DNA fragments into one circular plasmid.

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PCR product was digested with BsrGI and NotI (New England Laboratories, Ipswich, MA, USA) and cloned into the pIRESpuro-GLUE vector [ ]. .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. A synthetic, codon-optimized gene for human IP6K2 was assembled and subsequently amplified by PCR using primers 5’-GGGTGTACAGATGAGCCCAGCCTTCAGGGCC-3’ and 5’-CCCGCGGCCGCTC ACTCCCCACTCTCCTCACTTA-3’ [ ].

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These plasmids were integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ). .. The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This clone was then used to generate a new integrative vector in the pAG305GPD-ccdB-DsRed vector which was verified by DNA sequencing.

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The MYC-GFP coding sequence was amplified from pTRIPZ-del89-c-Myc-d4EGFP using the primers 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGCCCCTCAACGTTAGCTTC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACACATTGATCCTAGCAG-3′. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction. .. The subsequent DONR vector was used in an LR cloning reaction with the destination vector pInducer20 ( ) to generate the expression plasmid pInducer20-c-Myc-d4EGFP.

    Amplification:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: First, the region containing the hU6 promoter, Bbs I cloning sites, gRNA scaffold, PGK promoter, and selectable markers Puromycin and BFP (Blue Fluorescent protein) (hU6-gRNA-PGK-Puro-T2A-BFP) was amplified by PCR from the pKLV-U6gRNA-PGKpuro2ABFP plasmid using the Platinum Pfx Kit (Invitrogen, Cat. 11708-013) and the primers aTTB Fw and aTTB Rv (Supplementary Table ). .. The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions.

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Truncated MEF2D isoform was amplified from MSCV-MEF2D-BCL9 -IRES-GFP vector (M/B-1 vector, the one with the most common MEF2D-BCL9 fusion isoform) by the same PCR system and specially designed primers for Gateway cloning (Vector NTI, Thermo Fisher) ( ). .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher).

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly.

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Positive pDonR clones were validated by sequencing and used to transfer the gene cassette into the adenovirus backbone vector, pAd/CMV/V5-DEST (Invitrogen) by homologous recombination.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: For the pHID2 : ΔHID2 construct, a fragment containing 541 bp upstream of nc0216 and full-length nc0217 – nc0220 coding sequences was amplified from Col-0 genomic DNA. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ).

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The NUP107 open reading frame was amplified by PCR with human cDNA derived from a human lymphoblastoid cell line. .. The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The 35S:GFP-KRP6 -containing plant transformation vector pK7WGF2-KRP6 was obtained by Gateway LR reaction (Invitrogen) of pEntryL1L2-KRP6 with the destination vector pK7WGF2 ( ). .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. Using the primer pair CTACATCCCT C TGGGACTGAGGACTG and CAGTCCTCAGTCCCA G AGGGATGTAG (altered nucleotides underlined), the active-site Cys178 codon was changed to that for serine by the Quickchange method (Stratagene, La Jolla, CA).

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PCR product was digested with BsrGI and NotI (New England Laboratories, Ipswich, MA, USA) and cloned into the pIRESpuro-GLUE vector [ ]. .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. A synthetic, codon-optimized gene for human IP6K2 was assembled and subsequently amplified by PCR using primers 5’-GGGTGTACAGATGAGCCCAGCCTTCAGGGCC-3’ and 5’-CCCGCGGCCGCTC ACTCCCCACTCTCCTCACTTA-3’ [ ].

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This plasmid was integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ).

    High Throughput Screening Assay:

    Article Title: Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes
    Article Snippet: Paragraph title: High-throughput cloning, expression, and nickel pull-down ... CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA).

    Stable Transfection:

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: GLS shRNA stable cell lines were selected in media containing puromycin (1μg/mL). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. Gateway technology (Thermo Fisher Scientific) was utilized to produce the constructs in pLenti 6.3 cV5_DEST and pLCMVhyg-wpre_DEST expression vectors for KGA and GAC, respectively.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: Arabidopsis cell cultures (2 d old) were stably transformed by Agrobacterium tumefaciens cocultivation according to . .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6.

    Synthesized:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: Newly isolated monoclones were expanded and screened for SIRT3 protein expression by immunoblot with a SIRT3-specific antibody (Cell Signaling Technology #5490). .. For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Briefly, the hSIRT3 WT gBlock Gene Fragment was cloned into the pDONR221 vector according to manufacturer’s instructions to generate the pDONR221/hSIRT3 WT plasmid.

    Construct:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: Paragraph title: DNA constructs and design of guide RNAs ... The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions.

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Paragraph title: Retroviral constructs and immunoblotting ... Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher).

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: These constructs were packaged in formulation with Opti-MEM, Fugene 6 (Promega, E2691), the expression plasmid pCMVΔR 8.91 (Life Technologies), and PLD VSV-G (Life Technologies). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen).

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: To construct Pdat-1 ::CFP::CL-1 transgenic worms, pPD133.48, a CFP containing plasmid (gift from Andy Fire) was used as a template to amplify CFP::CL-1 using a CFP specific forward primer and a reverse primer that incorporated the last few nucleotides of CFP and the entire CL-1 sequence (sequences available upon request). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 .

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The vesicles markers Ypt1, Ypt31, Sec4, Ypt6, Vps21, Ypt52 and Ypt7 used on fluorescence microscopy experiments were constructed by Gitler and co-workers and were obtained from Addgene (pAG416GPD-Cerulean-YPT1 , 18848; pAG416GPD-Cerulean-YPT31 , 18849; pAG416GPD-Cerulean-SEC4 , 18844; pAG416GPD-Cerulean-YPT6 , 18845; pAG416GPD-Cerulean-VPS21 , 18842; pAG416GPD-Cerulean-YPT52 , 18843; pAG416GPD-Cerulean-YPT7 , 18847). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: Newly isolated monoclones were expanded and screened for SIRT3 protein expression by immunoblot with a SIRT3-specific antibody (Cell Signaling Technology #5490). .. For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Briefly, the hSIRT3 WT gBlock Gene Fragment was cloned into the pDONR221 vector according to manufacturer’s instructions to generate the pDONR221/hSIRT3 WT plasmid.

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. Among four NUP107 mutations observed in this cohort, c.969+1G > A was mimicked by c.969_970insTAG, which created the nonsense codon just after the mutation (p.Asp324∗ ).

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: Paragraph title: Constructs, Plant and Cell Suspension Growth, and Transformation ... The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6.

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: All DNA constructs were confirmed through DNA sequencing by Elim Biopharmaceuticals Inc. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The human PPIP5K1 construct was generated by PCR amplification from PPIP5K1 cDNA acquired from the mammalian gene collection (ATCC-10436889) with primers 5’-GGGTGTACAGATGTGGTCATTGACGGCC-3’ and 5’-CCCGCGGCCG CCTAATTTATCTCCTCAGG-3’ (Integrated DNA Technologies, Coralville, IA, USA). .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA).

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: A separate smaller doxycycline-inducible MYC-GFP expression plasmid was constructed for integration into hTERT-RPE1 cells. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction.

    cDNA Library Assay:

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: A cDNA library was made from A. chinensis bud RNA using the GeneRacer™ kit (Invitrogen) according to the manufacturer’s instructions and the primers provided. .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Immunocytochemistry:

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Validated positive pAd clones were then used to generate recombinant adenoviruses, designated AdA151R, AdB119L, AdB602L, AdEP402RΔPRR, AdB438L, and AdK205R-A104R, using the ViraPower Adenoviral Expression System (Invitrogen).

    Activity Assay:

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. To generate Tg(myl7 :lck-EGFP)md71 Tol2-mediated zebrafish transgenesis was performed by injecting 25 ng/ml transgene plasmid together with 25 ng/ml capped Tol2 transposase mRNA, followed by subsequent screening of positive F0 founders.

    Cell Culture:

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Lentivirus was produced by transfecting either pLenti6.3/V5-GW/lacZ or one of the five different pLenti6.3/hSIRT3-V5 plasmids into HEK293T cells using the ViraPower Lentiviral Packaging Mix (Thermo #K497500) according to manufacturer’s instructions.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Expressing:

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: These constructs were packaged in formulation with Opti-MEM, Fugene 6 (Promega, E2691), the expression plasmid pCMVΔR 8.91 (Life Technologies), and PLD VSV-G (Life Technologies). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms.

    Article Title: Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes
    Article Snippet: Paragraph title: High-throughput cloning, expression, and nickel pull-down ... CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA).

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: F1 hermaphrodites expressing GFP were allowed to self and F2 worms were singled onto plates. .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 .

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Paragraph title: Generation of recombinant adenoviruses expressing ASFV antigens ... Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The genes encoding modifiers of aSyn toxicity YPT1 , YKT6 , BRE5 , UBP3 , GYP8 , and PMR1 were kindly provided by Dr. Aaron Gitler, Stanford University, cloned in Gateway entry clones and used to generate expression clones on the pRS based gateway vectors pAG305GAL (YPT1 , YKT6 , UBP3 , GYP8 , and PMR1 ) or pAG303GAL (BRE5 ) . .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: Paragraph title: Expression Vectors ... The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing.

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PCR product was digested with BsrGI and NotI (New England Laboratories, Ipswich, MA, USA) and cloned into the pIRESpuro-GLUE vector [ ]. .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. A synthetic, codon-optimized gene for human IP6K2 was assembled and subsequently amplified by PCR using primers 5’-GGGTGTACAGATGAGCCCAGCCTTCAGGGCC-3’ and 5’-CCCGCGGCCGCTC ACTCCCCACTCTCCTCACTTA-3’ [ ].

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: A separate smaller doxycycline-inducible MYC-GFP expression plasmid was constructed for integration into hTERT-RPE1 cells. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction.

    Modification:

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: The coding sequences of the target antigens (A151R, B119L, B602L, EP402RΔPRR, B438L, and K205R-A104R) were then modified to add, in-frame, a FLAG- and HA- tag at the N- and C-termini, respectively, and the resultant amino acid sequences were used to generate synthetic genes which were codon-optimized for protein expression in swine. .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Transformation Assay:

    Article Title: Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes
    Article Snippet: CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA). .. CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA).

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: Paragraph title: Constructs, Plant and Cell Suspension Growth, and Transformation ... The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6.

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. The ATG10 and ATG10 C-S coding regions were transferred to the Gateway pEARLEY201 vector ( ) by an LR recombination reaction to append the cauliflower mosaic virus (CaMV) 35S promoter and codons for a HA epitope tag to the 5′-end.

    Activated Clotting Time Assay:

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: Zebrafish (Danio rerio ) were kept at 28.5°C and handled according to established protocols ( ) and in accordance with EU directive 2011/63/EU as well as the German Animal Welfare Act. .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly.

    Derivative Assay:

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The NUP107 open reading frame was amplified by PCR with human cDNA derived from a human lymphoblastoid cell line. .. The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing.

    Electroporation:

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Transfection:

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher). .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher).

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction.

    Infection:

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. For both KGA and GAC isoforms, fifteen silent mutations were introduced in the following sequence regions: C1212A, A1215T, C1218T, T1224C, T1227A, A1230C, T1231C, C1347T, T1350A, A1353G, A1356T, T1359C, C1360A, A1362G, and T1365C.

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions.

    Hemagglutination Assay:

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Positive pDonR clones were validated by sequencing and used to transfer the gene cassette into the adenovirus backbone vector, pAd/CMV/V5-DEST (Invitrogen) by homologous recombination.

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: MEF2D -rearranged isoforms, wild-type MEF2D and BCL9 were amplified by RT–PCR using Phusion High-Fidelity DNA Polymerase (M0530L, New England Biolabs, Inc.) and primers ( ) from either leukaemic cell or MOLT4 cell line complementary DNA. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher).

    Generated:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: To sub-clone the gRNA into the RCAS-Y-DV vector we generated a pDONR-gRNA plasmid, by a multiple steps process. .. The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions.

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: GLS shRNA stable cell lines were selected in media containing puromycin (1μg/mL). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. Gateway technology (Thermo Fisher Scientific) was utilized to produce the constructs in pLenti 6.3 cV5_DEST and pLCMVhyg-wpre_DEST expression vectors for KGA and GAC, respectively.

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. See supplementary files for detailed digital plasmid maps of these vectors.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: The EP402RΔPRR sequence was generated by deleting the proline-rich repeats from the EP402R cytoplasmic domain [ ]. .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The atg10-1 T-DNA insertion mutant (SALK_084434) was obtained from the SIGnAL T-DNA collection generated in the A. thaliana Col-0 ecotype ( ). .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA).

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The human PPIP5K1 construct was generated by PCR amplification from PPIP5K1 cDNA acquired from the mammalian gene collection (ATCC-10436889) with primers 5’-GGGTGTACAGATGTGGTCATTGACGGCC-3’ and 5’-CCCGCGGCCG CCTAATTTATCTCCTCAGG-3’ (Integrated DNA Technologies, Coralville, IA, USA). .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA).

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This plasmid was integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ).

    DNA Sequencing:

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: All DNA constructs were confirmed through DNA sequencing by Elim Biopharmaceuticals Inc. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These clones were then used to generate new integrative vectors in the pAG305 GPD-Cerulean-ccdB vector which were verified by DNA sequencing. .. The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen).

    Sequencing:

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Amplification products were purified by Wizard SV Gel and PCR Clean-up system (Promega) and verified by Sanger sequencing. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher).

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: A scrambled Null shRNA sequence ( 5’ ACCGTACGTTACGCGTAATGTTTCAAGAGAACGTTACGCGTAACGTACGGT-3’ ) was inserted into the same expression vector to serve as a non-targeting control. .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms.

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: The coding sequence of NPAS3 transcript variants 1 (NM_001164849.1 encoding isoform 1 NP_001158221.1, 933 aa) and 2 (NM_022123.1 encoding isoform 2 NP_071406.1, 901 aa) were purchased from Origene and cloned using the Gateway subcloning system (Invitrogen) into a Gateway converted pcI-HA (hemagglutinin tagged) vector. pHTN-CMV-neo (Promega) was also converted to the Gateway system and NPAS3 was subcloned into it to generate a HaloTag construct. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen).

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: To construct Pdat-1 ::CFP::CL-1 transgenic worms, pPD133.48, a CFP containing plasmid (gift from Andy Fire) was used as a template to amplify CFP::CL-1 using a CFP specific forward primer and a reverse primer that incorporated the last few nucleotides of CFP and the entire CL-1 sequence (sequences available upon request). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 .

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Briefly, the hSIRT3 WT gBlock Gene Fragment was cloned into the pDONR221 vector according to manufacturer’s instructions to generate the pDONR221/hSIRT3 WT plasmid.

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The NUP107 open reading frame was amplified by PCR with human cDNA derived from a human lymphoblastoid cell line. .. The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. For mutagenesis, a QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) was used.

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The MYC-GFP coding sequence was amplified from pTRIPZ-del89-c-Myc-d4EGFP using the primers 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGCCCCTCAACGTTAGCTTC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACACATTGATCCTAGCAG-3′. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction.

    Injection:

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. To generate Tg(myl7 :lck-EGFP)md71 Tol2-mediated zebrafish transgenesis was performed by injecting 25 ng/ml transgene plasmid together with 25 ng/ml capped Tol2 transposase mRNA, followed by subsequent screening of positive F0 founders.

    Binding Assay:

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. Among four NUP107 mutations observed in this cohort, c.969+1G > A was mimicked by c.969_970insTAG, which created the nonsense codon just after the mutation (p.Asp324∗ ).

    In Vivo:

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. Among four NUP107 mutations observed in this cohort, c.969+1G > A was mimicked by c.969_970insTAG, which created the nonsense codon just after the mutation (p.Asp324∗ ).

    Gene Knockout:

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Lentivirus was produced by transfecting either pLenti6.3/V5-GW/lacZ or one of the five different pLenti6.3/hSIRT3-V5 plasmids into HEK293T cells using the ViraPower Lentiviral Packaging Mix (Thermo #K497500) according to manufacturer’s instructions.

    Fluorescence:

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The vesicles markers Ypt1, Ypt31, Sec4, Ypt6, Vps21, Ypt52 and Ypt7 used on fluorescence microscopy experiments were constructed by Gitler and co-workers and were obtained from Addgene (pAG416GPD-Cerulean-YPT1 , 18848; pAG416GPD-Cerulean-YPT31 , 18849; pAG416GPD-Cerulean-SEC4 , 18844; pAG416GPD-Cerulean-YPT6 , 18845; pAG416GPD-Cerulean-VPS21 , 18842; pAG416GPD-Cerulean-YPT52 , 18843; pAG416GPD-Cerulean-YPT7 , 18847). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Mutagenesis:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Briefly, the hSIRT3 WT gBlock Gene Fragment was cloned into the pDONR221 vector according to manufacturer’s instructions to generate the pDONR221/hSIRT3 WT plasmid.

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. For mutagenesis, a QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) was used.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: Single T-DNA insertion mutant lines of KRP6 (SAIL_54B_B03 and SALK_142997) were obtained from the ABRC. .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6.

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA).

    Isolation:

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Paragraph title: Gene isolation and vector construction ... Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones.

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: Paragraph title: Isolation and complementation of atg10-1 : ... For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA).

    Subcloning:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: The coding sequence of NPAS3 transcript variants 1 (NM_001164849.1 encoding isoform 1 NP_001158221.1, 933 aa) and 2 (NM_022123.1 encoding isoform 2 NP_071406.1, 901 aa) were purchased from Origene and cloned using the Gateway subcloning system (Invitrogen) into a Gateway converted pcI-HA (hemagglutinin tagged) vector. pHTN-CMV-neo (Promega) was also converted to the Gateway system and NPAS3 was subcloned into it to generate a HaloTag construct. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen).

    shRNA:

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: GLS shRNA stable cell lines were selected in media containing puromycin (1μg/mL). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. Gateway technology (Thermo Fisher Scientific) was utilized to produce the constructs in pLenti 6.3 cV5_DEST and pLCMVhyg-wpre_DEST expression vectors for KGA and GAC, respectively.

    Microscopy:

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The vesicles markers Ypt1, Ypt31, Sec4, Ypt6, Vps21, Ypt52 and Ypt7 used on fluorescence microscopy experiments were constructed by Gitler and co-workers and were obtained from Addgene (pAG416GPD-Cerulean-YPT1 , 18848; pAG416GPD-Cerulean-YPT31 , 18849; pAG416GPD-Cerulean-SEC4 , 18844; pAG416GPD-Cerulean-YPT6 , 18845; pAG416GPD-Cerulean-VPS21 , 18842; pAG416GPD-Cerulean-YPT52 , 18843; pAG416GPD-Cerulean-YPT7 , 18847). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Purification:

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Primers for truncated MEF2D were designed to amplify from the N terminus of MEF2D to the last amino acid fused to BCL9 with a stop codon inserted at the fusion point. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher). .. Truncated MEF2D -pDONR221 vector was shuttled into a Gateway-compatible MSCV-IRES-GFP vector using the LR Clonase enzyme (Thermo Fisher).

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Entry clones were verified using sequence analysis and then recombined into pHYGREX5, which placed each cDNA between the Cauliflower mosiac virus (CaMV) 35S promoter and the ocs 3ʹ transcriptional terminator. pHYGREX5, a Gateway-adapted version of the binary vector pCAMBIA1300 was constructed by isolating the 3.9kb 35S-att R1-Cm-ccd B-att R2-OCS cassette from pHEX2 ( ) by Sac I/Sac II digestion, gel purification, and ligation into Sma I-digested pCAMBIA1300.

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: PCR products were purified by Zymoclean Gel DNA Recovery Kit (Zymo Research). .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Polymerase Chain Reaction:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: First, the region containing the hU6 promoter, Bbs I cloning sites, gRNA scaffold, PGK promoter, and selectable markers Puromycin and BFP (Blue Fluorescent protein) (hU6-gRNA-PGK-Puro-T2A-BFP) was amplified by PCR from the pKLV-U6gRNA-PGKpuro2ABFP plasmid using the Platinum Pfx Kit (Invitrogen, Cat. 11708-013) and the primers aTTB Fw and aTTB Rv (Supplementary Table ). .. The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions. .. Lastly, the Bbs I restriction site at position 437 was removed by site-directed mutagenesis (QuikChange Lightning Site-Directed Mutagenesis kit, Agilent, Cat. 210518) using the primers pDONR_BbsI_mut-Fw and Rv (Supplementary Table ).

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Primers for truncated MEF2D were designed to amplify from the N terminus of MEF2D to the last amino acid fused to BCL9 with a stop codon inserted at the fusion point. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher). .. Truncated MEF2D -pDONR221 vector was shuttled into a Gateway-compatible MSCV-IRES-GFP vector using the LR Clonase enzyme (Thermo Fisher).

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. See supplementary files for detailed digital plasmid maps of these vectors.

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Entry clones were verified using sequence analysis and then recombined into pHYGREX5, which placed each cDNA between the Cauliflower mosiac virus (CaMV) 35S promoter and the ocs 3ʹ transcriptional terminator. pHYGREX5, a Gateway-adapted version of the binary vector pCAMBIA1300 was constructed by isolating the 3.9kb 35S-att R1-Cm-ccd B-att R2-OCS cassette from pHEX2 ( ) by Sac I/Sac II digestion, gel purification, and ligation into Sma I-digested pCAMBIA1300.

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Positive pDonR clones were validated by sequencing and used to transfer the gene cassette into the adenovirus backbone vector, pAd/CMV/V5-DEST (Invitrogen) by homologous recombination.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The NUP107 open reading frame was amplified by PCR with human cDNA derived from a human lymphoblastoid cell line. .. The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. For mutagenesis, a QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) was used.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The 35S:GFP-KRP6 -containing plant transformation vector pK7WGF2-KRP6 was obtained by Gateway LR reaction (Invitrogen) of pEntryL1L2-KRP6 with the destination vector pK7WGF2 ( ). .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. Using the primer pair CTACATCCCT C TGGGACTGAGGACTG and CAGTCCTCAGTCCCA G AGGGATGTAG (altered nucleotides underlined), the active-site Cys178 codon was changed to that for serine by the Quickchange method (Stratagene, La Jolla, CA).

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: PCR products were purified by Zymoclean Gel DNA Recovery Kit (Zymo Research). .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning.

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PCR product was digested with BsrGI and NotI (New England Laboratories, Ipswich, MA, USA) and cloned into the pIRESpuro-GLUE vector [ ]. .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. A synthetic, codon-optimized gene for human IP6K2 was assembled and subsequently amplified by PCR using primers 5’-GGGTGTACAGATGAGCCCAGCCTTCAGGGCC-3’ and 5’-CCCGCGGCCGCTC ACTCCCCACTCTCCTCACTTA-3’ [ ].

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This plasmid was integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ).

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The MYC-GFP coding sequence was amplified from pTRIPZ-del89-c-Myc-d4EGFP using the primers 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGCCCCTCAACGTTAGCTTC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACACATTGATCCTAGCAG-3′. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction. .. The subsequent DONR vector was used in an LR cloning reaction with the destination vector pInducer20 ( ) to generate the expression plasmid pInducer20-c-Myc-d4EGFP.

    Positron Emission Tomography:

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. For bacterial expression, IP6K2 was amplified by PCR with 5’- GGGAATTCGATGAGCCCAGCCTTCAGG-3’ and 5’- CCCTCGAGGTCACTCCCC ACTCTCCTC-3’.

    Blocking Assay:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    IA:

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The human PPIP5K1 construct was generated by PCR amplification from PPIP5K1 cDNA acquired from the mammalian gene collection (ATCC-10436889) with primers 5’-GGGTGTACAGATGTGGTCATTGACGGCC-3’ and 5’-CCCGCGGCCG CCTAATTTATCTCCTCAGG-3’ (Integrated DNA Technologies, Coralville, IA, USA). .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: The genomic region encompassing the cat-2 genetic lesion (stop codon) was sequenced from worm lines where 100% of the F3 generation expressed GFP (sequencing repeated three additional times). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 .

    Plasmid Preparation:

    Article Title: Somatic genome editing with the RCAS-TVA-CRISPR-Cas9 system for precision tumor modeling
    Article Snippet: First, the region containing the hU6 promoter, Bbs I cloning sites, gRNA scaffold, PGK promoter, and selectable markers Puromycin and BFP (Blue Fluorescent protein) (hU6-gRNA-PGK-Puro-T2A-BFP) was amplified by PCR from the pKLV-U6gRNA-PGKpuro2ABFP plasmid using the Platinum Pfx Kit (Invitrogen, Cat. 11708-013) and the primers aTTB Fw and aTTB Rv (Supplementary Table ). .. The PCR-amplified product was transferred by site-specific recombination (Gateway BP Clonase, Invitrogen, Cat. 11789-020) into the pDONR221 Vector (Invitrogen, Cat. 12536017) following the manufacturer’s instructions. .. Lastly, the Bbs I restriction site at position 437 was removed by site-directed mutagenesis (QuikChange Lightning Site-Directed Mutagenesis kit, Agilent, Cat. 210518) using the primers pDONR_BbsI_mut-Fw and Rv (Supplementary Table ).

    Article Title: Genomic analyses identify recurrent MEF2D fusions in acute lymphoblastic leukaemia
    Article Snippet: Primers for truncated MEF2D were designed to amplify from the N terminus of MEF2D to the last amino acid fused to BCL9 with a stop codon inserted at the fusion point. .. Purified PCR products were cloned into the Gateway pDONR221 vector (Thermo Fisher) by BP Clonase Enzyme (Thermo Fisher). .. Truncated MEF2D -pDONR221 vector was shuttled into a Gateway-compatible MSCV-IRES-GFP vector using the LR Clonase enzyme (Thermo Fisher).

    Article Title: Glutaminase is essential for the growth of triple-negative breast cancer cells with a deregulated glutamine metabolism pathway and its suppression synergizes with mTOR inhibition
    Article Snippet: GLS shRNA stable cell lines were selected in media containing puromycin (1μg/mL). .. To rescue the knockdown phenotype, shRNA-resistant lines of both KGA and GAC isoforms were generated from the GLS shRNA stable cell lines. pDONR221 (Thermo Fisher Scientific, 12536017) vector was used to produce entry clones for both isoforms. .. Gateway technology (Thermo Fisher Scientific) was utilized to produce the constructs in pLenti 6.3 cV5_DEST and pLCMVhyg-wpre_DEST expression vectors for KGA and GAC, respectively.

    Article Title: Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes
    Article Snippet: RGP proteins seem to be more amenable to this than other CWGTs tested here, and we have successfully produced ~1 mg of > 90% pure Arabidopsis thaliana RGP1 that has the expected mutase and autoglycosylation activities. .. CWGT sequences were obtained from the TAIR9 genome release ( http://www.arabidopsis.org , [ ]) and cloned into the spectinomycin-resistant Gateway™ donor vector pDONR223 (Thermo Fisher Scientific, cat# 12536017) or purchased in this vector from SGI-DNA (San Diego, USA). .. In a round-bottomed 96-well plate, 1 μl of each donor vector was mixed with 1 μl of expression vector and 0.25 μl LR Clonase II (Thermo Fisher Scientific, cat# 11791100) and incubated 2 h at room temperature.

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: The lck sequence was PCR amplified from pN1-Lck-GCaMP3 (Addgene, #26974) with In-Fusion primers 5’-GCAAAAGATCTGCCACCATGGGCTGTGGCTGC-3’ (forward) and 5’-GCAAAGGGCCCCGAGATCCTTATCGTCATCGT-3’ (reverse) designed with http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do and cloned into pEGFP-N1 (Clontech, #6085–1). .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly. .. See supplementary files for detailed digital plasmid maps of these vectors.

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    Article Title: Functional and expression analyses of kiwifruit SOC1-like genes suggest that they may not have a role in the transition to flowering but may affect the duration of dormancy
    Article Snippet: Full-length coding sequences of all kiwifruit SOC1 -like genes were then amplified using a two-step adaptor PCR strategy which incorporated the complete att B1 and att B2 sequence at the 5ʹ and 3ʹ end, respectively ( Supplementary Table S1 ). .. Purified PCR fragments were each recombined in the Gateway™ pDONR221 vector (Invitrogen), resulting in entry clones. .. Entry clones were verified using sequence analysis and then recombined into pHYGREX5, which placed each cDNA between the Cauliflower mosiac virus (CaMV) 35S promoter and the ocs 3ʹ transcriptional terminator. pHYGREX5, a Gateway-adapted version of the binary vector pCAMBIA1300 was constructed by isolating the 3.9kb 35S-att R1-Cm-ccd B-att R2-OCS cassette from pHEX2 ( ) by Sac I/Sac II digestion, gel purification, and ligation into Sma I-digested pCAMBIA1300.

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: To construct Pdat-1 ::CFP::CL-1 transgenic worms, pPD133.48, a CFP containing plasmid (gift from Andy Fire) was used as a template to amplify CFP::CL-1 using a CFP specific forward primer and a reverse primer that incorporated the last few nucleotides of CFP and the entire CL-1 sequence (sequences available upon request). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 . .. 10 µg each of Pdat-1 ::CFP::CL-1 plasmid DNA and an unc-119 rescuing vector (pDP#MM016B) were co-introduced into unc-119 worms by biolistic bombardment using a Bio-Rad Biolistic PDS-1000/He particle delivery system .

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Synthesis, codon-optimization, cloning in pUC57 vector, and sequence-verification of these genes was outsourced (GenScript, NJ, USA). .. Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols. .. Positive pDonR clones were validated by sequencing and used to transfer the gene cassette into the adenovirus backbone vector, pAd/CMV/V5-DEST (Invitrogen) by homologous recombination.

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: The vesicles markers Ypt1, Ypt31, Sec4, Ypt6, Vps21, Ypt52 and Ypt7 used on fluorescence microscopy experiments were constructed by Gitler and co-workers and were obtained from Addgene (pAG416GPD-Cerulean-YPT1 , 18848; pAG416GPD-Cerulean-YPT31 , 18849; pAG416GPD-Cerulean-SEC4 , 18844; pAG416GPD-Cerulean-YPT6 , 18845; pAG416GPD-Cerulean-VPS21 , 18842; pAG416GPD-Cerulean-YPT52 , 18843; pAG416GPD-Cerulean-YPT7 , 18847). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen). .. These clones were then used to generate new integrative vectors in the pAG305 GPD-Cerulean-ccdB vector which were verified by DNA sequencing.

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: The chimeric fragment then was generated by overlapping PCR and cloned into KpnI/PstI sites of pCAMBIA1300. .. To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ). .. The inserts then were transferred into the Gateway binary vector pBGWFS7 by a recombination reaction between the attL and attR sites (LR reaction) (Invitrogen).

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: Newly isolated monoclones were expanded and screened for SIRT3 protein expression by immunoblot with a SIRT3-specific antibody (Cell Signaling Technology #5490). .. For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Briefly, the hSIRT3 WT gBlock Gene Fragment was cloned into the pDONR221 vector according to manufacturer’s instructions to generate the pDONR221/hSIRT3 WT plasmid.

    Article Title: A Guide to Transient Expression of Membrane Proteins in HEK-293 Cells for Functional Characterization
    Article Snippet: - One Shot® Mach1™ T1 phage-resistant chemically competent E. coli cells (Cat. no. C862003, Life Technologies, Carlsbad, CA). .. - Gateway® pDONR™221 Vector (Cat. no. 12536017, Life Technologies, Carlsbad, CA). .. - pcDNA™6.2/cLumio™-DEST (Cat. no. 12589016, Invitrogen Corporation, Carlsbad, CA).

    Article Title: Biallelic Mutations in Nuclear Pore Complex Subunit NUP107 Cause Early-Childhood-Onset Steroid-Resistant Nephrotic Syndrome
    Article Snippet: The NUP107 open reading frame was amplified by PCR with human cDNA derived from a human lymphoblastoid cell line. .. The PCR product was introduced into the Gateway pDONR221 vector (Life Technologies), and its sequence was confirmed by Sanger sequencing. .. For mutagenesis, a QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) was used.

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The 35S:GFP-KRP6 -containing plant transformation vector pK7WGF2-KRP6 was obtained by Gateway LR reaction (Invitrogen) of pEntryL1L2-KRP6 with the destination vector pK7WGF2 ( ). .. The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. Using the primer pair CTACATCCCT C TGGGACTGAGGACTG and CAGTCCTCAGTCCCA G AGGGATGTAG (altered nucleotides underlined), the active-site Cys178 codon was changed to that for serine by the Quickchange method (Stratagene, La Jolla, CA).

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: Restriction enzymes (NEB) and T4 ligase (NEB) were used to digest and ligate the DNA fragments, respectively. .. BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Gibson one-pot, isothermal DNA assembly was conducted at 10 μl scale by incubating T5 exonuclease (NEB), Phusion polymerase (NEB), Taq ligase (NEB) and 50 ng of each DNA fragment at 50 °C for 1 h to assemble multiple DNA fragments into one circular plasmid.

    Article Title: PPIP5K1 Suppresses Etoposide-triggered Apoptosis
    Article Snippet: The PCR product was digested with BsrGI and NotI (New England Laboratories, Ipswich, MA, USA) and cloned into the pIRESpuro-GLUE vector [ ]. .. The PPIP5K1 kinase domain (residues 1–387) was PCR amplified using primers 5’-GGGGACAAG TTTGTACAAAAAAGCAGGCATGTGGTCATTGACGG-3’ and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTAATTTATCTCCTCAGGGACCTC-3’ and subsequently cloned into the Gateway pDONR221 vector and the pDEST-58 expression vector (Life Technologies, Carlsbad, CA, USA). .. A synthetic, codon-optimized gene for human IP6K2 was assembled and subsequently amplified by PCR using primers 5’-GGGTGTACAGATGAGCCCAGCCTTCAGGGCC-3’ and 5’-CCCGCGGCCGCTC ACTCCCCACTCTCCTCACTTA-3’ [ ].

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These plasmids were integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ). .. The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This clone was then used to generate a new integrative vector in the pAG305GPD-ccdB-DsRed vector which was verified by DNA sequencing.

    Article Title: Global inhibition with specific activation: how p53 and MYC redistribute the transcriptome in the DNA double-strand break response
    Article Snippet: The MYC-GFP coding sequence was amplified from pTRIPZ-del89-c-Myc-d4EGFP using the primers 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGCCCCTCAACGTTAGCTTC-3′ and 5′-GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACACATTGATCCTAGCAG-3′. .. Gateway cloning (ThermoFisher, 12537023) was used to generate a donor vector by integrating the PCR product into pDONR221 (ThermoFisher, 12536017) via a BP cloning reaction. .. The subsequent DONR vector was used in an LR cloning reaction with the destination vector pInducer20 ( ) to generate the expression plasmid pInducer20-c-Myc-d4EGFP.

    Introduce:

    Article Title: The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana
    Article Snippet: The mutant was backcrossed three times to wild-type Col-0 to help remove extraneous mutations. .. For complementation, the full-length coding region of the ATG10 cDNA was amplified by PCR using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATTCAGCTCGAGAGGTCA and GGGGACCACTTTGTACAAGAAAGCTGGGTTC TAATTCAGCATCTCAAGAGGG designed to introduce BP recombination sites at the 5′- and 3′-ends (underlined), respectively, for subsequent cloning into the Gateway pDONR221 vector (Invitrogen, Carlsbad, CA). .. Using the primer pair CTACATCCCT C TGGGACTGAGGACTG and CAGTCCTCAGTCCCA G AGGGATGTAG (altered nucleotides underlined), the active-site Cys178 codon was changed to that for serine by the Quickchange method (Stratagene, La Jolla, CA).

    Recombinant:

    Article Title: Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
    Article Snippet: Paragraph title: Generation of recombinant adenoviruses expressing ASFV antigens ... Each target gene was then amplified by PCR using attB1 -FLAG specific forward and attB2 -HA specific reverse primers and subcloned into Gateway pDonR221 vector (Invitrogen) as per manufacturer’s protocols.

    Transgenic Assay:

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: Transgenic zebrafish lines Tg(myl7 :GCaMP5G-Arch(D95N)), Tg(myl7 :H2A-mCherry) and Tg(myl7 :lck-EGFP)md71 were used. .. PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly.

    Article Title: Investigating Bacterial Sources of Toxicity as an Environmental Contributor to Dopaminergic Neurodegeneration
    Article Snippet: To construct Pdat-1 ::CFP::CL-1 transgenic worms, pPD133.48, a CFP containing plasmid (gift from Andy Fire) was used as a template to amplify CFP::CL-1 using a CFP specific forward primer and a reverse primer that incorporated the last few nucleotides of CFP and the entire CL-1 sequence (sequences available upon request). .. The CFP::CL-1 fusion was cloned into a Gateway pDONR221 vector (Invitrogen) and then recombined into pDEST-DAT1 .

    Article Title: Arabidopsis small nucleolar RNA monitors the efficient pre-rRNA processing during ribosome biogenesis
    Article Snippet: Paragraph title: Plasmid Construction and Generation of Transgenic Plants. ... To generate the pHID2 WT :GUS and pHID2mut:GUS (m3, m12 and m123) reporter constructs, a fragment containing 1,241 bp upstream of the HID2 coding sequence or its mutated forms generated by PCR-based mutagenesis with attB sites was cloned into the Gateway pDONR221 vector (Invitrogen), as previously described ( ).

    Article Title: The Cyclin-Dependent Kinase Inhibitor KRP6 Induces Mitosis and Impairs Cytokinesis in Giant Cells Induced by Plant-Parasitic Nematodes in Arabidopsis
    Article Snippet: The KRP6-coding region was amplified by PCR and cloned into the Gateway pDONR221 vector (Invitrogen), resulting in pEntryL1L2-KRP6. .. The 35S:RFP-TUA2 -containing plant transformation vector was constructed as described ( ).

    Produced:

    Article Title: Remodeling of the Acetylproteome by SIRT3 Manipulation Fails to Affect Insulin Secretion or β Cell Metabolism in the Absence of Overnutrition
    Article Snippet: For the generation of lentiviral constructs: 1) The wild-type human SIRT3 (hSIRT3 WT) fusion protein open reading frame flanked by attR1 and attR2 sites was synthesized as a gBlock Gene Fragment from IDT; 2) The Gateway pDONR221 Vector (Thermo #12536017) was used according to manufacturer’s instructions; 3) The pLenti6.3/V5-DEST Gateway Vector Kit (Thermo #V53306) was used according to manufacturer’s instructions. .. Using the pDONR221/hSIRT3 WT plasmid as a template, the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent #210513) was used according to manufacturer’s instructions to generate pDON221/hSIRT3 N229A, pDON221/hSIRT3 H248Y, and double mutant pDON221/hSIRT3 NA/HY sequence-verified plasmids. pDONR221/hSIRT3 plasmids were recombined with pLenti6.3/V5-DEST vector to generate sequence-verified pLenti6.3/hSIRT3-V5 plasmids according to manufacturer’s instructions.

    Marker:

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen). .. These clones were used to generate entry clones by recombination cloning into a Gateway pDONR221 vector (Invitrogen).

    Article Title: Phosphorylation Modulates Clearance of Alpha-Synuclein Inclusions in a Yeast Model of Parkinson's Disease
    Article Snippet: These plasmids were integrated in the VSY71, VSY72 and VSY73 genome to generate new strains ( ). .. The P-bodies marker encoding the gene DCP1 cloned in pBG1805-DCP1 was obtained from the Open Biosystems Yeast ORF Collection and used to generate an entry clone into Gateway pDONR221 vector (Invitrogen). .. This clone was then used to generate a new integrative vector in the pAG305GPD-ccdB-DsRed vector which was verified by DNA sequencing.

    Variant Assay:

    Article Title: Molecular analysis of NPAS3 functional domains and variants
    Article Snippet: Domains were cloned into a Gateway converted pcI-HA to generate N-terminally HA-tagged constructs. .. Variants tested were generated through site directed mutagenesis of the clone of NPAS3 transcript variant 1 in the Gateway pDONR221 vector (Invitrogen). .. The c.1654G > C (p.Ala552Pro) and c.2089G > A (p.Gly697Ser) variants were generated using the KapaHiFi Hot Start kit (Kapa Biosystems) and the following primers: (NPAS3 -G1654C-F 5′-CGGTGCTCTGGGC C CGATGCAGATCAA-3′, NPAS3 -G1654C-R 5′-TTGATCTGCATCG G GCCCAGAGCACCG-3′, G2089A-F 5′-CCCGCAGGGC A GCGGCGGTGG-3′, NPAS3 -G2089A-R 5′-CCACCGCCGC T GCCCTGCGGG-3′, variant nucleotides underlined).

    Fluorescence In Situ Hybridization:

    Article Title: Cell-accurate optical mapping across the entire developing heart
    Article Snippet: Paragraph title: Fish husbandry and lines ... PCR product generated from attB-flanked BP primers 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGCTGTGGCTGCAGCTCAAACC-3’ (forward) and 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTTGTACAGCTCGTCCATGCCGAG-3’ (reverse) was BP Clonase II cloned into Gateway pDONR221 (ThermoFisher Scientific, #12536017) to generate the middle entry clone that was further assembled with p5E_myl7, p3E_SV40polyA (Tol2kit #302), and pDEST.Cryst.YFP76 ( ) into Tol2 transgene plasmid using MultiSite Gateway assembly.

    Homologous Recombination:

    Article Title: Engineering biosynthesis of the anticancer alkaloid noscapine in yeast
    Article Snippet: BP Clonase II Enzyme Mix, Gateway pDONR221 Vector and LR Clonase II Enzyme Mix (Life Technologies) and the S. cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning. .. Gibson one-pot, isothermal DNA assembly was conducted at 10 μl scale by incubating T5 exonuclease (NEB), Phusion polymerase (NEB), Taq ligase (NEB) and 50 ng of each DNA fragment at 50 °C for 1 h to assemble multiple DNA fragments into one circular plasmid.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Thermo Fisher gateway pdonr221 vector
    Gateway Pdonr221 Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gateway pdonr221 vector/product/Thermo Fisher
    Average 96 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    gateway pdonr221 vector - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    Image Search Results