Structured Review

PerkinElmer fmol
Fmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fmol/product/PerkinElmer
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
fmol - by Bioz Stars, 2020-04
93/100 stars

Images

Related Articles

Acrylamide Gel Assay:

Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
Article Snippet: The buffer was supplemented with 15 fmol [α-32 P]ATP (Perkin Elmer, Waltham, MA) and the reaction was carried out for 2 hours at 65°C. .. The samples were then passed through a G-25 column (GE Life Sciences, Piscataway, NJ) to remove unincorporated ATP, and loaded onto a denaturing 20% acrylamide gel for purification.

ATPase Assay:

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: Paragraph title: MutSβ ATPase assay ... Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction.

In Vitro:

Article Title: The Non-Bulky DNA Lesions Spiroiminodihydantoin and 5-Guanidinohydantoin Significantly Block Human RNA Polymerase II Elongation in vitro
Article Snippet: Paragraph title: In vitro Transcription ... – Reactions were carried out with 50 fmol of template in transcription buffer supplied with the HeLaScribe® system and supplemented with 400 μM each of ATP, GTP and UTP, 16 μM [α-32 P]CTP (~ 25 Ci/mmol) (PerkinElmer Inc.) and 8 units of HeLaScribe® Nuclear Extract.

Synthesized:

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: .. One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides. ..

Mutagenesis:

Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
Article Snippet: Adenylation of DNA oligos 225 pmol of a 22-mer DNA oligo with 5'-PO4 and 3'-Amino modifications (see Table ) was adenylated by 225 pmol of mutant Mth ligase (kindly provided by A. Zhelkovsky, New England Biolabs.) in a 30 μL reaction (50 mM Bis-Tris propane pH 8.0, 5 mM MgCl2 , 0.5 mM ATP). .. The buffer was supplemented with 15 fmol [α-32 P]ATP (Perkin Elmer, Waltham, MA) and the reaction was carried out for 2 hours at 65°C.

Protein Binding:

Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells
Article Snippet: Protein binding to the Adcy4 promoter was evaluated in EMSAs essentially as described ( ) using radioactive probes encompassing the Sp1A binding site (AACGGGAAGGGGCTGGG CTGTATCGC); the Sp1B and SF1 binding sites (GGGGAAGTGGGAGGGGGCCTTG GCC); and the Sp1A (AACG A GA G G TA GC GGGCTGTATCGC), Sp1B (GGGGAAGT G CT AG AC GGCCTTGGCC), and SF1 (GG GGAAGTGGGAGGGGGC TC T T GCGC) sites mutated, respectively. .. Each reaction contained 5 μg nuclear extract, 40 fmol (50,000 cpm/reaction) of double-stranded cDNA probe labeled by end-filling with [α-32 P]dGTP (3000 Ci/mmol; PerkinElmer LAS Canada, Woodbridge, Ontario, Canada) and 2 μg double-stranded poly(dI-dC) in a total of 20 μl of binding buffer [20 m m HEPES (pH 7.9), 50 m m KCl, 1 m m EDTA, 1 m m dithiothreitol, and 5% glycerol].

Methylation:

Article Title: Protein Arginine Methyltransferase 5 Functions in Opposite Ways in the Cytoplasm and Nucleus of Prostate Cancer Cells
Article Snippet: Methyltransferase Assay Methylation reactions were performed as previously described with a few modifications . .. Reactions containing 6 fmol of PRMT5 or PRMT5-containing complexes, 1 microgram of SmD3 or histones, and 1 microCi of S-[methyl-3 H]adenosymethionine (PerkinElmer) were incubated in 50 mM Tris-HCl, pH 7.5, 1 mM EGTA, and 1 mM EDTA at 30°C for 1 h. Reactions were boiled in SDS sample buffer and separated on a 15% polyacrylamide gel.

Autoradiography:

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction. .. Labeled ATP and ADP were separated by developing the TLC plate in 0.75 M KH2 PO4 and visualized by storage phosphor autoradiography in a Typhoon TRIO Imager (GE Healthcare).

Labeling:

Article Title: Mechanism of DNA Lesion Homing and Recognition by the Uvr Nucleotide Excision Repair System
Article Snippet: In order to label both strands of the duplex DNA bound to UvrB(T251C), 10 fmol of the purified UvrB(T251C)-dsDNA complexes were added to 1 μ Cu γ -[32 P]-ATP (7,000 Ci mmol−1 , Perkin Elmer) and 5 units of T4 polynucleotide kinase in 1X PNK buffer (New England Biolabs) for 1 hour at 37°C. .. The 5′ end labeled UvrB-dsDNA complexes (2 nM) were then incubated with 5-100 nM UvrC in 50 mM Tris pH 7.4, 100 mM NaCl, 0.1 mg/ml BSA, 1 mM ATP, 10 mM MgCl2 , and 5% (v/v) glycerol at 55°C for 30 minutes.

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction. .. Labeled ATP and ADP were separated by developing the TLC plate in 0.75 M KH2 PO4 and visualized by storage phosphor autoradiography in a Typhoon TRIO Imager (GE Healthcare).

Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells
Article Snippet: .. Each reaction contained 5 μg nuclear extract, 40 fmol (50,000 cpm/reaction) of double-stranded cDNA probe labeled by end-filling with [α-32 P]dGTP (3000 Ci/mmol; PerkinElmer LAS Canada, Woodbridge, Ontario, Canada) and 2 μg double-stranded poly(dI-dC) in a total of 20 μl of binding buffer [20 m m HEPES (pH 7.9), 50 m m KCl, 1 m m EDTA, 1 m m dithiothreitol, and 5% glycerol]. .. Where indicated, competitor oligonucleotides (100-fold molar excess) or rabbit antibodies against Sp1, Sp3 (1 μg purified IgG/reaction; Upstate Cell Signaling Solutions, Lake Placid, NY) and SF1 (1 μl antiserum) were added.

Purification:

Article Title: Mechanism of DNA Lesion Homing and Recognition by the Uvr Nucleotide Excision Repair System
Article Snippet: .. In order to label both strands of the duplex DNA bound to UvrB(T251C), 10 fmol of the purified UvrB(T251C)-dsDNA complexes were added to 1 μ Cu γ -[32 P]-ATP (7,000 Ci mmol−1 , Perkin Elmer) and 5 units of T4 polynucleotide kinase in 1X PNK buffer (New England Biolabs) for 1 hour at 37°C. .. The 5′ end labeled UvrB-dsDNA complexes (2 nM) were then incubated with 5-100 nM UvrC in 50 mM Tris pH 7.4, 100 mM NaCl, 0.1 mg/ml BSA, 1 mM ATP, 10 mM MgCl2 , and 5% (v/v) glycerol at 55°C for 30 minutes.

Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
Article Snippet: The buffer was supplemented with 15 fmol [α-32 P]ATP (Perkin Elmer, Waltham, MA) and the reaction was carried out for 2 hours at 65°C. .. The samples were then passed through a G-25 column (GE Life Sciences, Piscataway, NJ) to remove unincorporated ATP, and loaded onto a denaturing 20% acrylamide gel for purification.

Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells
Article Snippet: Each reaction contained 5 μg nuclear extract, 40 fmol (50,000 cpm/reaction) of double-stranded cDNA probe labeled by end-filling with [α-32 P]dGTP (3000 Ci/mmol; PerkinElmer LAS Canada, Woodbridge, Ontario, Canada) and 2 μg double-stranded poly(dI-dC) in a total of 20 μl of binding buffer [20 m m HEPES (pH 7.9), 50 m m KCl, 1 m m EDTA, 1 m m dithiothreitol, and 5% glycerol]. .. Where indicated, competitor oligonucleotides (100-fold molar excess) or rabbit antibodies against Sp1, Sp3 (1 μg purified IgG/reaction; Upstate Cell Signaling Solutions, Lake Placid, NY) and SF1 (1 μl antiserum) were added.

Microarray:

Article Title: Atomic resolution insight into host cell recognition by Toxoplasma gondii
Article Snippet: Paragraph title: Microarray analysis of the binding of TgMIC1-NT fusion protein to diverse oligosaccharide probes ... The probes were printed at 2 and 7 fmol per spot, in duplicate, using a non-contact arrayer (Piezorray, Perkin-Elmer LAS, UK), with Cy3 dye included to enable post-array monitoring of the slides.

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: Paragraph title: Microarray analyses. ... One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides.

Article Title: Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM
Article Snippet: Paragraph title: 2.2. Glycan microarray analyses ... These were robotically printed on nitrocellulose-coated glass slides, at 2 and 7 fmol per spot, using a non-contact arrayer (Piezorray; PerkinElmer LAS, Beaconsfield, UK).

Incubation:

Article Title: Mechanism of DNA Lesion Homing and Recognition by the Uvr Nucleotide Excision Repair System
Article Snippet: In order to label both strands of the duplex DNA bound to UvrB(T251C), 10 fmol of the purified UvrB(T251C)-dsDNA complexes were added to 1 μ Cu γ -[32 P]-ATP (7,000 Ci mmol−1 , Perkin Elmer) and 5 units of T4 polynucleotide kinase in 1X PNK buffer (New England Biolabs) for 1 hour at 37°C. .. The 5′ end labeled UvrB-dsDNA complexes (2 nM) were then incubated with 5-100 nM UvrC in 50 mM Tris pH 7.4, 100 mM NaCl, 0.1 mg/ml BSA, 1 mM ATP, 10 mM MgCl2 , and 5% (v/v) glycerol at 55°C for 30 minutes.

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction. .. The reaction was incubated at 37°C for 15–30 min and terminated by addition of an equal volume of 50 m m EDTA.

Article Title: The Non-Bulky DNA Lesions Spiroiminodihydantoin and 5-Guanidinohydantoin Significantly Block Human RNA Polymerase II Elongation in vitro
Article Snippet: – Reactions were carried out with 50 fmol of template in transcription buffer supplied with the HeLaScribe® system and supplemented with 400 μM each of ATP, GTP and UTP, 16 μM [α-32 P]CTP (~ 25 Ci/mmol) (PerkinElmer Inc.) and 8 units of HeLaScribe® Nuclear Extract. .. The mixture was incubated at 30 °C for 60 min and quenched with HeLa Extract Stop Solution.

Article Title: Protein Arginine Methyltransferase 5 Functions in Opposite Ways in the Cytoplasm and Nucleus of Prostate Cancer Cells
Article Snippet: .. Reactions containing 6 fmol of PRMT5 or PRMT5-containing complexes, 1 microgram of SmD3 or histones, and 1 microCi of S-[methyl-3 H]adenosymethionine (PerkinElmer) were incubated in 50 mM Tris-HCl, pH 7.5, 1 mM EGTA, and 1 mM EDTA at 30°C for 1 h. Reactions were boiled in SDS sample buffer and separated on a 15% polyacrylamide gel. .. Gels were fixed for 30 min in 40% methanol-10% acetic acid, incubated in 20 ml of Amplify (Amersham Life Science) for 10 min, dried, and exposed to x-ray film at −80°C.

Thin Layer Chromatography:

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction. .. One microliter of each reaction mix was spotted on a PEI-cellulose TLC plate (Grace Davison Discovery Sciences, Albany, OR).

Activity Assay:

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: The MutSβ ATPase activity was assayed in 15 µl of a buffer containing 25 m m HEPES (pH 8.0), 100 m m KCl, 2 m m TCEP, 5% glycerol, 5 m m MgCl2 , and 100 n m or 200 n m human MutSβ and 400 n m or 300 n m of the indicated oligonucleotide substrates. .. Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction.

Blocking Assay:

Article Title: Atomic resolution insight into host cell recognition by Toxoplasma gondii
Article Snippet: The probes were printed at 2 and 7 fmol per spot, in duplicate, using a non-contact arrayer (Piezorray, Perkin-Elmer LAS, UK), with Cy3 dye included to enable post-array monitoring of the slides. .. For binding analysis with TgMIC1-NT fusion protein, the arrayed pads were overlaid initially for 1 h with blocking solution containing casein (Pierce) with 1% w/v BSA(Sigma) and 10 mM calcium (casein/BSA).

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides. .. In brief, the arrayed slides were overlaid initially for 1 h with blocking solution (5 mM HEPES [pH 7], 150 mM NaCl [HBS] with 3% [wt/vol] bovine serum albumin [Sigma]).

Polyacrylamide Gel Electrophoresis:

Article Title: The Non-Bulky DNA Lesions Spiroiminodihydantoin and 5-Guanidinohydantoin Significantly Block Human RNA Polymerase II Elongation in vitro
Article Snippet: – Reactions were carried out with 50 fmol of template in transcription buffer supplied with the HeLaScribe® system and supplemented with 400 μM each of ATP, GTP and UTP, 16 μM [α-32 P]CTP (~ 25 Ci/mmol) (PerkinElmer Inc.) and 8 units of HeLaScribe® Nuclear Extract. .. The nucleic acid pellet was re-suspended in nuclease-free water, and the products were resolved by 7% denaturing PAGE in 8 M urea dissolved in TBE (8.9 mM Tris-borate, 0.2 mM EDTA (pH 8.0)).

Sequencing:

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: Sequence-defined, lipid-linked oligosaccharide probes were printed on nitrocellulose-coated glass slides (FAST slides; Whatman Ltd.) with Cy3 dye included in the array fluid to enable postarray monitoring of the spots ( ). .. One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides.

Binding Assay:

Article Title: Atomic resolution insight into host cell recognition by Toxoplasma gondii
Article Snippet: Paragraph title: Microarray analysis of the binding of TgMIC1-NT fusion protein to diverse oligosaccharide probes ... The probes were printed at 2 and 7 fmol per spot, in duplicate, using a non-contact arrayer (Piezorray, Perkin-Elmer LAS, UK), with Cy3 dye included to enable post-array monitoring of the slides.

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides. .. Binding analysis using biotinylated SV40 VLPs (5 μg/ml) was performed essentially as described previously ( ).

Article Title: Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM
Article Snippet: These were robotically printed on nitrocellulose-coated glass slides, at 2 and 7 fmol per spot, using a non-contact arrayer (Piezorray; PerkinElmer LAS, Beaconsfield, UK). .. The microarray binding assays were performed as described .

Article Title: Contributions of Specificity Protein-1 and Steroidogenic Factor 1 to Adcy4 Expression in Y1 Mouse Adrenal Cells
Article Snippet: .. Each reaction contained 5 μg nuclear extract, 40 fmol (50,000 cpm/reaction) of double-stranded cDNA probe labeled by end-filling with [α-32 P]dGTP (3000 Ci/mmol; PerkinElmer LAS Canada, Woodbridge, Ontario, Canada) and 2 μg double-stranded poly(dI-dC) in a total of 20 μl of binding buffer [20 m m HEPES (pH 7.9), 50 m m KCl, 1 m m EDTA, 1 m m dithiothreitol, and 5% glycerol]. .. Where indicated, competitor oligonucleotides (100-fold molar excess) or rabbit antibodies against Sp1, Sp3 (1 μg purified IgG/reaction; Upstate Cell Signaling Solutions, Lake Placid, NY) and SF1 (1 μl antiserum) were added.

Derivative Assay:

Article Title: N-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿-Glycolyl GM1 Ganglioside as a Receptor for Simian Virus 40 ▿ †
Article Snippet: .. One hundred ninety lipid-linked oligosaccharide probes (see Table S1 in the supplemental material) were arrayed on FAST slides at 2 and 7 fmol per spot, in duplicate, using a noncontact arrayer (Piezorray; Perkin-Elmer LAS, United Kingdom); these were in the forms of natural and synthetic glycolipids and NGLs derived from natural and chemically synthesized oligosaccharides. ..

Concentration Assay:

Article Title: Mutsβ generates both expansions and contractions in a mouse model of the Fragile X-associated disorders
Article Snippet: .. Kinetic data were obtained by varying the ATP concentration from 10 to 80 μM containing 50 fmol of α-32 P-ATP (PerkinElmer, Waltham, MA) in each reaction. .. The reaction was incubated at 37°C for 15–30 min and terminated by addition of an equal volume of 50 m m EDTA.

Software:

Article Title: Mechanism of DNA Lesion Homing and Recognition by the Uvr Nucleotide Excision Repair System
Article Snippet: In order to label both strands of the duplex DNA bound to UvrB(T251C), 10 fmol of the purified UvrB(T251C)-dsDNA complexes were added to 1 μ Cu γ -[32 P]-ATP (7,000 Ci mmol−1 , Perkin Elmer) and 5 units of T4 polynucleotide kinase in 1X PNK buffer (New England Biolabs) for 1 hour at 37°C. .. The reaction mixtures were analyzed on 15% or 23.5% denaturing polyacrylamide gels and visualized via phosphor-imaging using a Typhoon phosphor imager and ImageQuant software (GE Healthcare).

Article Title: Glycan microarray analysis of the carbohydrate-recognition specificity of native and recombinant forms of the lectin ArtinM
Article Snippet: These were robotically printed on nitrocellulose-coated glass slides, at 2 and 7 fmol per spot, using a non-contact arrayer (Piezorray; PerkinElmer LAS, Beaconsfield, UK). .. Glycoarray data analysis was performed with dedicated software .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    PerkinElmer fmol
    Fmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fmol/product/PerkinElmer
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fmol - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    85
    PerkinElmer 1000 fmol
    1000 Fmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1000 fmol/product/PerkinElmer
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1000 fmol - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    Image Search Results