first strand cdna synthesis technique  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    First Strand cDNA Synthesis Kit
    Description:
    Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase Due to this feature full length cDNA can be synthesized from RNA templates up to 9 kb The recombinant RiboLock RNase Inhibitor supplied with the kit effectively protects RNA template from degradation The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis Highlights• Efficient synthesis of first strand cDNA up to 9 kb• Reaction temperature 37°C• Supplied with the recombinant RiboLock RNase Inhibitor• Complete oligo dT 18 and random hexamer primers included with the kitApplications• First strand cDNA synthesis for RT PCR and real time RT PCR• Construction of cDNA libraries• Generation of probes for hybridization• aRNA synthesisThe kit is supplied with both oligo dT 18 and random hexamer primers The oligo dT 18 anneals selectively on the poly A tail of mRNA Random hexamer primers do not require the presence of poly A Therefore they can be used for transcription of the 5 end regions of mRNA or cDNA synthesis using RNA without poly A tail e g micro RNAs Gene specific primers may also be used with the kits
    Catalog Number:
    k1612
    Price:
    None
    Applications:
    Cloning|cDNA Libraries & Library Construction
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher first strand cdna synthesis technique
    Thermo Scientific First Strand cDNA Synthesis kit utilizes the recombinant M MuLV Reverse Transcriptase which exhibits lower RNase H activity than AMV reverse transcriptase Due to this feature full length cDNA can be synthesized from RNA templates up to 9 kb The recombinant RiboLock RNase Inhibitor supplied with the kit effectively protects RNA template from degradation The first strand of cDNA can be directly used as a template in PCR or in second strand cDNA synthesis Highlights• Efficient synthesis of first strand cDNA up to 9 kb• Reaction temperature 37°C• Supplied with the recombinant RiboLock RNase Inhibitor• Complete oligo dT 18 and random hexamer primers included with the kitApplications• First strand cDNA synthesis for RT PCR and real time RT PCR• Construction of cDNA libraries• Generation of probes for hybridization• aRNA synthesisThe kit is supplied with both oligo dT 18 and random hexamer primers The oligo dT 18 anneals selectively on the poly A tail of mRNA Random hexamer primers do not require the presence of poly A Therefore they can be used for transcription of the 5 end regions of mRNA or cDNA synthesis using RNA without poly A tail e g micro RNAs Gene specific primers may also be used with the kits
    https://www.bioz.com/result/first strand cdna synthesis technique/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    first strand cdna synthesis technique - by Bioz Stars, 2020-07
    99/100 stars

    Related Products / Commonly Used Together

    quantitative real-time pcr cdna

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Synthesized:

    Article Title: Genome-Wide Analysis Reveals Novel Genes Essential for Heme Homeostasis in Caenorhabditis elegans
    Article Snippet: .. cDNA synthesis and quantitative real-time PCR First strand cDNA was synthesized using 2 µg of total RNA using a Superscript II First Strand cDNA synthesis kit (Invitrogen). .. For quantitative real-time PCR (qRT-PCR), primers spanning at least one intron were designed using Primer Express (Applied Biosystems) and Beacon designer 4 (Premier Biosoft) programs.

    Isolation:

    Article Title: Regulation of Toll-like receptor 4-mediated immune responses through Pasteurella multocida toxin-induced G protein signalling
    Article Snippet: .. Reverse transcription-PCR RNA was extracted with the “High pure RNA Isolation Kit” (Roche). cDNA was prepared using ‘Reverse Aid First Strand cDNA Synthesis Kit’ (Fermentas life science). .. Aliquots of the cDNA were used for quantitative PCR analysis with the ‘SYBR Green Rox mix’ (Thermo Scientific) with the following primers: GAPDH, sense, 5′-acg gat ttg gct-3′,antisense, 5′-ttg acg gtg cca tgg aat ttg-3′, Cox2, sense, 5′-caa ctc tat att gct gga aca tgg a −3′,antisense, 5′-tgg aag cct gtg ata ctt tct gta ct-3′.

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Article Title: First Insights in NK—DC Cross-Talk and the Importance of Soluble Factors During Infection With Aspergillus fumigatus
    Article Snippet: .. Therefore, RNA was isolated from mock silenced and Dectin-1 silenced DCs by RNeasy Mini kit (Qiagen) before cDNA synthesis (First Strand cDNA Synthesis Kit, K1612, Thermo Fisher Scientific) was performed. .. RT-PCR was performed by using iQ™ SYBR® Green Supermix (Biorad) and either Dectin-1 specific primers (forward: CTGGTGATAGCTGTGGTCCTG; reverse primer: AAGAACCCCTGTGGTTTTGACA) or human ALAS specific primers (forward primer: GGCAGCACAGATGAATCAGA; reverse primer: CCTCCATCGGTTTTCACACT).

    Quantitative RT-PCR:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Real-time Polymerase Chain Reaction:

    Article Title: A cell-autonomous requirement for neutral sphingomyelinase 2 in bone mineralization
    Article Snippet: .. The first-strand cDNA synthesis and qRT-PCR were performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) and SYBR green quantitative PCR master mix (Maxima; Fermentas), respectively. .. The following primer pairs were used: 5′-AGAAACCCGGTCCTCGTACT-3′ and 5′-CCTGACCAGTGCCATTCTTT-3′ for Smpd3 expression and 5′-AAGCAGGAGGGCAATAAGGT-3′ and 5′-CAAGCAGGGTTAAGCTCACA-3′ for Bglap1 expression.

    Article Title: Genome-Wide Analysis Reveals Novel Genes Essential for Heme Homeostasis in Caenorhabditis elegans
    Article Snippet: .. cDNA synthesis and quantitative real-time PCR First strand cDNA was synthesized using 2 µg of total RNA using a Superscript II First Strand cDNA synthesis kit (Invitrogen). .. For quantitative real-time PCR (qRT-PCR), primers spanning at least one intron were designed using Primer Express (Applied Biosystems) and Beacon designer 4 (Premier Biosoft) programs.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Muscular tissues of the squid Doryteuthis pealeii express identical myosin heavy chain isoforms: an alternative mechanism for tuning contractile speed
    Article Snippet: .. First strand cDNA synthesis was performed using 125–250 ng total RNA with the Moloney murine leukemia virus reverse transcriptase (M-MuLV RT) from the Phusion RT-PCR Kit according to the manufacturer's instructions (Finnzymes, Espoo, Finland). .. An oligo(dT)15 primer was used to synthesize cDNA for conventional PCR, an anchor primer (Q_total) was used for 3′ rapid amplification of cDNA ends (RACE) cDNA synthesis and a myosin-specific primer (MHC_RT) was used for 5′ RACE cDNA synthesis ( ).

    Article Title: AtREM1, a Member of a New Family of B3 Domain-Containing Genes, Is Preferentially Expressed in Reproductive Meristems 1
    Article Snippet: .. For RT-PCR expression studies in rem1 homozygous lines, 5 μg of total RNA from inflorescence apices was treated with DNase and was employed in first-strand cDNA synthesis using SuperScript II (Gibco-BRL, Grand Island, NY) and an oligo T17 as primer. cDNAs were 250- and 500-fold diluted in subsequent PCR reactions. .. Primers used in these experiments were ARA6 and ARA7 for REM1 expression and CTCATGGCCGCCGGATCTGA and CTTGTCTCTCCATATCTTGAGCA corresponding to TSβ1 as a control ( ).

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Cell Culture:

    Article Title: AMF1 (GPS2) Modulates p53 Transactivation
    Article Snippet: .. U2OS/AMF1 and U2OS/β-Gal cells were cultured in 60-mm-diameter dishes and treated with etoposide for 0, 4, 8, or 24 h. Total RNA was isolated using TRIZOL reagent (GIBCO/BRL), and 5 μg of total RNA was reverse transcribed with oligo(dT) by using the Thermoscript RT-PCR system for first-strand cDNA synthesis (GIBCO/BRL). .. Five percent of the cDNA product was subjected to PCR with two different pairs of primers: p21 oligonucleotides, 5′-CTCTCATGCTCCAGGTGGCTC-3′ and 5′-CCATAGCCTCTACTGCCACCATCT-3′; GAPDH oligonucleotides, 5′-ACCACAGTCCATGCCATCAC-3′ and 5′-TCCACCACCCTGTTGCTGTA-3′.

    Expressing:

    Article Title: AtREM1, a Member of a New Family of B3 Domain-Containing Genes, Is Preferentially Expressed in Reproductive Meristems 1
    Article Snippet: .. For RT-PCR expression studies in rem1 homozygous lines, 5 μg of total RNA from inflorescence apices was treated with DNase and was employed in first-strand cDNA synthesis using SuperScript II (Gibco-BRL, Grand Island, NY) and an oligo T17 as primer. cDNAs were 250- and 500-fold diluted in subsequent PCR reactions. .. Primers used in these experiments were ARA6 and ARA7 for REM1 expression and CTCATGGCCGCCGGATCTGA and CTTGTCTCTCCATATCTTGAGCA corresponding to TSβ1 as a control ( ).

    Polymerase Chain Reaction:

    Article Title: AtREM1, a Member of a New Family of B3 Domain-Containing Genes, Is Preferentially Expressed in Reproductive Meristems 1
    Article Snippet: .. For RT-PCR expression studies in rem1 homozygous lines, 5 μg of total RNA from inflorescence apices was treated with DNase and was employed in first-strand cDNA synthesis using SuperScript II (Gibco-BRL, Grand Island, NY) and an oligo T17 as primer. cDNAs were 250- and 500-fold diluted in subsequent PCR reactions. .. Primers used in these experiments were ARA6 and ARA7 for REM1 expression and CTCATGGCCGCCGGATCTGA and CTTGTCTCTCCATATCTTGAGCA corresponding to TSβ1 as a control ( ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher first strand cdna synthesis technique
    First Strand Cdna Synthesis Technique, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/first strand cdna synthesis technique/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    first strand cdna synthesis technique - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results