faststart taq dna polymerase dntpack  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche faststart taq dna polymerase dntpack
    Faststart Taq Dna Polymerase Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase dntpack/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase dntpack - by Bioz Stars, 2021-07
    86/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
    Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

    Article Title: Functional Analysis of the TRIB1 Associated Locus Linked to Plasma Triglycerides and Coronary Artery Disease
    Article Snippet: All PCRs were run on the ABI GenAmp PCR system 9700. .. TRIBAL amplification required 2 rounds of PCR with the Roche FastStart Taq DNA polymerase, dNTPack (Roche Diagnostics). .. For 3′ RACE, in the first round of PCR, each reaction contained a gene‐specific forward primer targeting exon 1 or 2 and 1× GC‐rich solution.

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Purification:

    Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
    Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Monosomy 3 Influences Epithelial-Mesenchymal Transition Gene Expression in Uveal Melanoma Patients; Consequences for Liquid Biopsy
    Article Snippet: .. The 20 µL PCR reaction mixture contained components from FastStart™ Taq DNA Polymerase, dNTPack (Roche Diagnostics, Basel, Switzerland): 0.4 µL of dNTPs, 2.0 µL of the buffer with MgCl2 , 0.1 µL of FastStart Taq DNA Polymerase, and 10 pmol/L of each primer (Generi Biotech, s.r.o., Hradec Kralove, Czech Republic). .. The 20 µL PCR reaction mixture contained components from FastStart™ Taq DNA Polymerase, dNTPack (Roche Diagnostics, Basel, Switzerland): 0.4 µL of dNTPs, 2.0 µL of the buffer with MgCl2 , 0.1 µL of FastStart Taq DNA Polymerase, and 10 pmol/L of each primer (Generi Biotech, s.r.o., Hradec Kralove, Czech Republic).

    Article Title: Functional Analysis of the TRIB1 Associated Locus Linked to Plasma Triglycerides and Coronary Artery Disease
    Article Snippet: All PCRs were run on the ABI GenAmp PCR system 9700. .. TRIBAL amplification required 2 rounds of PCR with the Roche FastStart Taq DNA polymerase, dNTPack (Roche Diagnostics). .. For 3′ RACE, in the first round of PCR, each reaction contained a gene‐specific forward primer targeting exon 1 or 2 and 1× GC‐rich solution.

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

    Article Title: Discoidin domain receptor 2 germline gene deletion leads to altered heart structure and function in the mouse
    Article Snippet: Genomic DNA was isolated from tail clips or ear punches ( ). .. DNA (1 μl) in Tris-EDTA buffer was subjected to PCR using the FastStart Taq DNA Polymerase dNTPack kit (Roche Diagnostics) following manufacturer's instructions. ..

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Mutagenesis:

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

    Sequencing:

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

    Luciferase:

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

    Plasmid Preparation:

    Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
    Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Clone Assay:

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Construct:

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Derivative Assay:

    Article Title: Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle
    Article Snippet: Amphioxus (B. f loridae ) Transgenic Experiment The genomic DNA of Florida amphioxus (B. floridae ) was isolated by phenol-chloroform extraction from an adult individual cultured in the laboratory. .. The amphioxus Msx -CNE region was amplified from amphioxus genomic DNA by PCR with FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science, Indianapolis, USA), and cloned between the HindIII site and AsiSI site of the reporter construct derived from the 72-1.27 vector containing the minimal promoter of B. floridae FoxD ( ; ). ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche faststart taq dntpack
    Faststart Taq Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dntpack/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    faststart taq dntpack - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Roche faststart taq dna polymerase dntpack kit
    Faststart Taq Dna Polymerase Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase dntpack kit - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    86
    Roche pcr mix
    Pcr Mix, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results