Structured Review

Roche faststart taq dna polymerase dntpack
Faststart Taq Dna Polymerase Dntpack, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/faststart taq dna polymerase dntpack/product/Roche
Average 90 stars, based on 1 article reviews
Price from $9.99 to $1999.99
faststart taq dna polymerase dntpack - by Bioz Stars, 2020-07
90/100 stars

Related Products / Commonly Used Together

dntp mix
pcr
mir-219 seed sequence
pcr reaction buffer
cdna

Images

Related Articles

Amplification:

Article Title: Characterization of the Methylthioadenosine Phosphorylase Polymorphism rs7023954 - Incidence and Effects on Enzymatic Function in Malignant Melanoma
Article Snippet: .. Amplification and sequencing of MTAP -Exon 3 For PCR amplification of exon 3 of MTAP , 1 μL cDNA (extracted from tissue or cell lines, or 2 μL genomic DNA (extracted from tissue or cell lines) were added to 0.5 μL of forward and reverse primers (MTAP-for89: 5’-GCCCACTGCAGATTCCTTTC-3’ ; MTAP-rev416: 5’-GGTCTCATAGTGGTCCTGTC-3’ ; each 20 μM), 5 μL PCR reaction buffer (10x), 0.5 μL dNTP mix (each 10 mM), and 0.5 μL (2.5 Units) FastStart Taq DNA Polymerase dNTPack (Roche, Mannheim, Germany) in a total reaction volume of 50 μL. .. The following PCR program was used: 5 min at 95°C (initial denaturation); 60 s at 95°C (denaturation); 30 s at 61°C (annealing), 30 s at 72°C (elongation), repeated 35 times.

Mutagenesis:

Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

Sequencing:

Article Title: Characterization of the Methylthioadenosine Phosphorylase Polymorphism rs7023954 - Incidence and Effects on Enzymatic Function in Malignant Melanoma
Article Snippet: .. Amplification and sequencing of MTAP -Exon 3 For PCR amplification of exon 3 of MTAP , 1 μL cDNA (extracted from tissue or cell lines, or 2 μL genomic DNA (extracted from tissue or cell lines) were added to 0.5 μL of forward and reverse primers (MTAP-for89: 5’-GCCCACTGCAGATTCCTTTC-3’ ; MTAP-rev416: 5’-GGTCTCATAGTGGTCCTGTC-3’ ; each 20 μM), 5 μL PCR reaction buffer (10x), 0.5 μL dNTP mix (each 10 mM), and 0.5 μL (2.5 Units) FastStart Taq DNA Polymerase dNTPack (Roche, Mannheim, Germany) in a total reaction volume of 50 μL. .. The following PCR program was used: 5 min at 95°C (initial denaturation); 60 s at 95°C (denaturation); 30 s at 61°C (annealing), 30 s at 72°C (elongation), repeated 35 times.

Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

Luciferase:

Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

Polymerase Chain Reaction:

Article Title: Characterization of the Methylthioadenosine Phosphorylase Polymorphism rs7023954 - Incidence and Effects on Enzymatic Function in Malignant Melanoma
Article Snippet: .. Amplification and sequencing of MTAP -Exon 3 For PCR amplification of exon 3 of MTAP , 1 μL cDNA (extracted from tissue or cell lines, or 2 μL genomic DNA (extracted from tissue or cell lines) were added to 0.5 μL of forward and reverse primers (MTAP-for89: 5’-GCCCACTGCAGATTCCTTTC-3’ ; MTAP-rev416: 5’-GGTCTCATAGTGGTCCTGTC-3’ ; each 20 μM), 5 μL PCR reaction buffer (10x), 0.5 μL dNTP mix (each 10 mM), and 0.5 μL (2.5 Units) FastStart Taq DNA Polymerase dNTPack (Roche, Mannheim, Germany) in a total reaction volume of 50 μL. .. The following PCR program was used: 5 min at 95°C (initial denaturation); 60 s at 95°C (denaturation); 30 s at 61°C (annealing), 30 s at 72°C (elongation), repeated 35 times.

Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

Plasmid Preparation:

Article Title: A novel role for SALL4 during scar-free wound healing in axolotl
Article Snippet: .. Site-directed mutagenesis The miR-219 seed sequence was mutated by performing PCR using FastStart Taq DNA polymerase dNTPack (Roche) on the pMIR-Report luciferase-AxSall4 3′ UTR plasmid with the following primers: AxSall43′ UTR SDM For1: CTGCGCACTAGTCATCGCTGTCAGTTGAGG AxSall43′UTR SDM Rev1: AAGCATAGTCA TGGTACC CCTCTGGCCAAC AxSall43′UTR MSDM For2: GTTGGCCAGAGG GGTACCA TGACTATGCTT AxSall43′ UTR MSDM Rev2: GCTAGCGGCCGCGTGGTATCAAC The bold underlined bases are non-complementary sequence located where the miR-219 seed sequence is located. .. The two fragments were purified and combined in a PCR reaction with AxSall43′ UTR SDM For1 primer and AxSall43′ UTR MSDM Rev2 primer.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Roche hi fi pcr taq polymerase
    Hi Fi Pcr Taq Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hi fi pcr taq polymerase/product/Roche
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    hi fi pcr taq polymerase - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    Roche faststart taq dna polymerase dntpack kit
    Faststart Taq Dna Polymerase Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase dntpack kit/product/Roche
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase dntpack kit - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    94
    Roche pcr mix
    Pcr Mix, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 215 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Roche
    Average 94 stars, based on 215 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results