faststart taq dna polymerase dntpack kit  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche faststart taq dna polymerase dntpack kit
    Faststart Taq Dna Polymerase Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase dntpack kit - by Bioz Stars, 2021-06
    86/100 stars

    Images

    Related Articles

    Modification:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    MTT Assay:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    SYBR Green Assay:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    Purification:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
    Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    Article Title: Rhipicephalus appendiculatus ticks transmit Theileria parva from persistently infected cattle in the absence of detectable parasitemia: implications for East Coast fever epidemiology
    Article Snippet: All DNA extractions were performed using the DNEasy Blood and Tissue kit (QIAGEN GmbH, Hilden, Germany). .. Unless otherwise stated, PCR reactions were carried out in 32 μl volumes using 2 μl of template genomic DNA, 1.0 μM forward primer, 1.0 μM reverse primer, 200 μM of dATP, dCTP, dGTP, dTTP, 1.3 U taq, 2.0 mM MgCl2 in 10× reaction buffer (FastStart PCR Polymerase dNTPack kit, Roche, Basel, Switzerland). .. For nested PCR reactions, the second round of PCR used 0.1 μl of the first PCR reaction together with 1.0 μM forward primer, 1.0 μM reverse primer, 200 μM of dATP, dCTP, dGTP, dTTP, 1.25 U taq, 2.0 mM MgCl2 in 10× reaction buffer and 1X RediLoad (Invitrogen, Carlsbad, USA).

    Article Title: Discoidin domain receptor 2 germline gene deletion leads to altered heart structure and function in the mouse
    Article Snippet: Genomic DNA was isolated from tail clips or ear punches ( ). .. DNA (1 μl) in Tris-EDTA buffer was subjected to PCR using the FastStart Taq DNA Polymerase dNTPack kit (Roche Diagnostics) following manufacturer's instructions. ..

    Article Title: Associations between Season and Gametocyte Dynamics in Chronic Plasmodium falciparum Infections
    Article Snippet: Extracted RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher, UK). .. From the cDNA, expression of the pfs25 (female gametocyte specific) and pfs230p (male gametocyte specific) genes were quantified by PCR as described in [ ], with the exception that a TaqMan probe (6FAM-ACTGGAATCGAACAACA-MGB, 250nM) and FastStart Taq dNTPack (Roche) were used to quantify male gametocytes. .. Levels of pfs25 and pfs230p in the cDNA samples were converted to female and male gametocyte counts, respectively, using calibration curves of in vitro DNAs (PCR amplified sequence of DNA spanning the region of the qPCR amplicons) and their relationship to P . falciparum female and male gametocyte counts from in vitro culture [ ].

    Article Title: Mutations in TJP2 cause progressive cholestatic liver disease
    Article Snippet: .. PCR amplification was optimized in accordance to the standard PCR protocol using FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science). .. Sequencing reaction was performed using the BigDye® v.1.1 Terminator cycle sequencing kit and the ABI Prism® 3130xl Genetic Analyzer (Life Technologies).

    Labeling:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    Expressing:

    Article Title: In vitro cytotoxicity analysis of doxorubicin-loaded/superparamagnetic iron oxide colloidal nanoassemblies on MCF7 and NIH3T3 cell lines
    Article Snippet: .. The chemicals used were DOX (EBEWE Pharma GMBH), MagAlg SPIO NPs (RCPTM UP Palacky University), Dulbecco’s Modified Eagle Medium (DMEM), phosphate buffered saline (PBS, pH 7.4), 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate (CM-H2 DCFDA; Invitrogen), thiazolyl blue tetrazolium bromide (MTT, Sigma-Aldrich), 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethyl-imidacarbocyanine iodide (C25 H27 Cl4 IN4 , JC-1, Sigma-Aldrich), dimethyl sulfoxide (DMSO, Sigma-Aldrich), HMP agarose (Serva), LMP agarose (Qbiogene), trypsinethyl-enediaminetetraacetic acid (EDTA) (Sigma), ethanol (Sigma), fetal bovine serum (FBS, Sigma-Aldrich), NaCl (Tamda), EDTA (Lachema), tris [tris(hydroxymethyl) aminomethane, Sigma-Aldrich], Triton X-100 (Serva), NaOH (Sigma-Aldrich), SYBR® Green (Invitrogen), anti-phosphohistone H3 (Millipore), Alexa fluor 488 goat anti-rabbit IgG (Molecular Probes), propidium iodide (Sigma), ribonuclease A (Sigma), Total RNA Purification Kit (Norgen), Protector RNase Inhibitor (Roche Applied Science), Transcriptor High Fidelity cDNA Synthesis Kit (Roche Applied Science), PCR-Mix (FastStart Taq DNA Polymerase, dNTPack, Roche Applied Science), PSMB2–50 primers 5′gtgagagggcagtggaactc 3′ 5′gaaggttggcagattcagga 3′ (Metabion), fluorescently labeled locked nucleic acid probe #50 (Universal ProbeLibrary, Roche Applied Science), TaqMan® Gene Expression Assay (Human MYC or Human FOS, Life Technologies), human universal reference RNA (Stratagene). .. Measurements were carried out on multi-detection microplate reader Synergy HT (BioTek), transmission microscope Olympus IX81 with DSU unit (Olympus), centrifugal machine (Biotech), electrophoretic tank (Bio-RAD), Mastercycler pro (Eppendorf), RotorGene Q (Qiagen), flow cytometer BD FACSCanto (BD Biosciences) and Atomic Force Microscope Bioscope Catalyst (Bruker).

    Article Title: Associations between Season and Gametocyte Dynamics in Chronic Plasmodium falciparum Infections
    Article Snippet: Extracted RNA was converted to cDNA using the High Capacity cDNA Reverse Transcription Kit (ThermoFisher, UK). .. From the cDNA, expression of the pfs25 (female gametocyte specific) and pfs230p (male gametocyte specific) genes were quantified by PCR as described in [ ], with the exception that a TaqMan probe (6FAM-ACTGGAATCGAACAACA-MGB, 250nM) and FastStart Taq dNTPack (Roche) were used to quantify male gametocytes. .. Levels of pfs25 and pfs230p in the cDNA samples were converted to female and male gametocyte counts, respectively, using calibration curves of in vitro DNAs (PCR amplified sequence of DNA spanning the region of the qPCR amplicons) and their relationship to P . falciparum female and male gametocyte counts from in vitro culture [ ].

    Amplification:

    Article Title: X-linked intellectual disability type Nascimento is a clinically distinct, probably underdiagnosed entity
    Article Snippet: .. UBE2A exons were amplified using the FastStart Taq DNA Polymerase, dNTPack (Roche) and purified with AmpureXP (Beckman Coulter, Inc) following standard protocols. .. BigDye Terminator v3.1 Cycle Sequencing Kit was used for sequencing reactions prior to sequencing on a 48-capillary 3730 DNA Analyzer (Applied Biosystems).

    Article Title: Mutations in TJP2 cause progressive cholestatic liver disease
    Article Snippet: .. PCR amplification was optimized in accordance to the standard PCR protocol using FastStart Taq DNA Polymerase, dNTPack (Roche Applied Science). .. Sequencing reaction was performed using the BigDye® v.1.1 Terminator cycle sequencing kit and the ABI Prism® 3130xl Genetic Analyzer (Life Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche faststart taq dna polymerase dntpack kit
    Faststart Taq Dna Polymerase Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase dntpack kit - by Bioz Stars, 2021-06
    86/100 stars
      Buy from Supplier

    Image Search Results