fastdigest kpni  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Name:
    FastDigest KpnI
    Description:
    5 G G T A C ↓C 3 3 C ↑C A T G G 5 Thermo Scientific FastDigest KpnI restriction enzyme recognizes GGTAC C site and cuts best at 37°C in 5 15 minutes using universal FastDigest Buffer Isoschizomers Asp718I Thermo Scientific FastDigest KpnI is one of an advanced line of fast restriction enzymes that are all 100 active in the universal FastDigest and FastDigest Green reaction buffers The universal buffer allows rapid single double or multiple DNA digestion within 5 15 minutes eliminating any need for buffer change or subsequent DNA clean up steps See Reaction Conditions for FastDigest Enzymes for a table of enzyme activity heat inactivation and incubation times for this and other FastDigest restriction enzymes DNA modifying enzymes such as Klenow Fragment T4 DNA Ligase alkaline phosphatases and T4 DNA Polymerase all have 100 activity in FastDigest Buffer Therefore enzymes for downstream applications can be directly added to the FastDigest reaction mix For additional convenience FastDigest Green Buffer includes a density reagent and two tracking dyes for direct loading of digestion reaction products on gels Short incubation times and optimal composition of the universal FastDigest Buffer eliminate star activity effects Features• 100 activity of all FastDigest enzymes in the universal buffer• 100 buffer compatibility with downstream applications• Complete digestion in 5 15 minutes• Direct loading on gels• No star activity• 176 FastDigest enzymes availableApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern Blot• Restriction fragment length polymorphism RFLP • SNP analysisNote The FastDigest Green Buffer offers the same high performance in DNA digestion and downstream applications as the colorless FastDigest Buffer For applications that require product analysis by fluorescence excitation e g concentration measurements in UV light the colorless FastDigest Buffer is recommended For methylation sensitivity refer to product specifications
    Catalog Number:
    FD0524
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    Cloning|Restriction Enzyme Cloning
    Buy from Supplier


    Structured Review

    Thermo Fisher fastdigest kpni
    5 G G T A C ↓C 3 3 C ↑C A T G G 5 Thermo Scientific FastDigest KpnI restriction enzyme recognizes GGTAC C site and cuts best at 37°C in 5 15 minutes using universal FastDigest Buffer Isoschizomers Asp718I Thermo Scientific FastDigest KpnI is one of an advanced line of fast restriction enzymes that are all 100 active in the universal FastDigest and FastDigest Green reaction buffers The universal buffer allows rapid single double or multiple DNA digestion within 5 15 minutes eliminating any need for buffer change or subsequent DNA clean up steps See Reaction Conditions for FastDigest Enzymes for a table of enzyme activity heat inactivation and incubation times for this and other FastDigest restriction enzymes DNA modifying enzymes such as Klenow Fragment T4 DNA Ligase alkaline phosphatases and T4 DNA Polymerase all have 100 activity in FastDigest Buffer Therefore enzymes for downstream applications can be directly added to the FastDigest reaction mix For additional convenience FastDigest Green Buffer includes a density reagent and two tracking dyes for direct loading of digestion reaction products on gels Short incubation times and optimal composition of the universal FastDigest Buffer eliminate star activity effects Features• 100 activity of all FastDigest enzymes in the universal buffer• 100 buffer compatibility with downstream applications• Complete digestion in 5 15 minutes• Direct loading on gels• No star activity• 176 FastDigest enzymes availableApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern Blot• Restriction fragment length polymorphism RFLP • SNP analysisNote The FastDigest Green Buffer offers the same high performance in DNA digestion and downstream applications as the colorless FastDigest Buffer For applications that require product analysis by fluorescence excitation e g concentration measurements in UV light the colorless FastDigest Buffer is recommended For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/fastdigest kpni/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fastdigest kpni - by Bioz Stars, 2021-06
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy
    Article Snippet: The Myc-fused Celia seipin expression plasmid was described previously [ ]. .. The lentiviral plasmid containing aberrant seipin was generated as follows: aberrant seipin complementary DNA was amplified by PCR using specific primers (forward: 5′-TAAGCAGGTACCTCTTTTTGCAGGATCCCATCGA-3′; reverse: 5′- TAAGCATCTAGAGCCTTGAATTCGCCCTTGAC-3′), and the amplification product was digested with the fast-digest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, Thermo Fisher Scientific), purified and inserted into the pLenti-CMV-GFP-2A-Puro-Blank vector (cat. LV073, Applied Biological Materials Inc.). ..

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: The following constructs were generated using Accupol (Amplicon, catalogue number 210302) following the manufacturer's instructions: IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), as well as IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), IFNλ3_MYC (Template pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_MYC (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc). .. The following PCR programme was used 1: 95°C for 5 min 2: 30 cycles of 95°C for 1 min, 59°C for 1 min and 72°C for 1 min and 45 s 3: 72°C for 7 min. All the constructs were cloned into the pEF2 vector using Fastdigest Kpn I (Thermo Scientific, catalogue number FD0524) and Fastdigest XbaI (Thermo Scientific, catalogue number FD0684) following the manufacturer's instructions. .. The IFNλ4 mutant IFNλ4 N61D was generated by site-directed mutagenesis using IFNλ4_FLAG in the pEF2 vector as a template.

    Article Title: Clathrin mediated endocytosis is involved in the uptake of exogenous double-stranded RNA in the white mold phytopathogen Sclerotinia sclerotiorum
    Article Snippet: Target sequences were amplified using Phusion Taq (Thermo Scientific, Waltham, MA, USA) from Sclerotinia cDNA synthesized using the RNeasy Plant Extraction kit (Qiagen, Germantown, MD, USA), RNase Free DNase set (Qiagen, Germantown, MD, USA) and qScript cDNA synthesis kit (Quantabio, Beverly, MA, USA). .. PCR products were digested using FastDigest KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) and ligated into the similarly digested pL4440 vector using T4 Ligase (Invitrogen, Carlsbad, CA, USA). .. Primers (F: CAACCTGGCTTATCGAA; R: TAAAACGACGGCCAGTGA) were designed to amplify the T7 promotors flanking the insert and dsRNA was synthesized via T7 reverse transcription using the MEGAscript RNAi kit (Thermo Scientific, Waltham, MA, USA).

    Article Title: Hat1 acetylates histone H4 and modulates the transcriptional program in Drosophila embryogenesis
    Article Snippet: The gene body of His4r from the start codon to the codon before the stop codon was PCR amplified from the pJET1.2-His4r template using His4r.E3C.F and His4r.E3C.R primers (Supplementary Table ) with Q5 DNA polymerase and reinserted to pJET1.2 with CloneJET PCR cloning kit. .. After digestion with FastDigest KpnI and EcoRI (Thermo Fisher Scientific) the His4r fragment was isolated and ligated to pENTR3C Gateway entry vector cut with the same enzymes. .. K12R and K5R mutations were introduced to the His4r sequentially utilizing mutagenic PCR with modified primers.

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: IFNλ4 ( , amino acids 23–179) preceded by a 6 × His tag followed by a TEV protease cleavage site was codon optimised for E. coli and purchased from Invitrogen. .. This construct was cloned into the pET-15b vector using Fastdigest KpnI (Thermo Scientific, catalogue number FD0524) and Fastdigest XhoI (Thermo Scientific, catalogue number FD0694). .. BL21 (DE3) E. coli cells transformed with the plasmids were grown at 37°C in Luria Bertani medium containing 100 μg/ml ampicillin and 100 μl antifoam A concentrate (Sigma-Aldrich, catalogue number A5633) under continuous shaking until an OD600 of 0.8–1.

    Article Title: Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
    Article Snippet: The protein sequence of PxAgo3 was blasted in the National Center for Biotechnology Information (NCBI) (Available online: ) to verify its identity and submitted to GenBank (Available online: ) for accession number. .. To construct the PxAgo3 expression vector (PIZT/V5-His+PxAgo3), the PCR product and PIZT/V5-His were individually double-digested at 37 °C using two restriction enzymes of FastDigest KpnI and EcoRI (Invitrogen). .. Both double digested products (PCR product and PIZT/V5-His) were ligated and transfected into competent cells and checked by colony PCR and 1% gel electrophoresis (as previously described).

    Article Title: A dual role of miR-22 modulated by RelA/p65 in resensitizing fulvestrant-resistant breast cancer cells to fulvestrant by targeting FOXP1 and HDAC4 and constitutive acetylation of p53 at Lys382
    Article Snippet: Generation of a wild-type hsa-miR-22 promoter reporter plasmid The Homo sapiens miR-22 stem loop (accession: MI0000078), which contains hsa-miR-22-3p and hsa-miR-22-5p, is located in a non-protein-coding gene MGC14376 (MIR22HG-001 ENST00000334146, Ensembl) exon 3, chromosome 17. .. A 1547 bp DNA fragment, containing a 1404 bp promoter, a 81 bp exon 1 and a 62 bp intron 1 of the miR-22 host gene MGC14376, was amplified by genomic PCR, cloned to the pGEM-T easy vector (Promega), released by restriction digestion with FastDigest Kpn I and Hin dIII (Fermentas), and subcloned into the pGL3-Basic vector (Promega) to generate the WT-miR-22 Prom reporter. .. Sequence identity of the insert fragment was confirmed by automatic DNA sequencing.

    Generated:

    Article Title: Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy
    Article Snippet: The Myc-fused Celia seipin expression plasmid was described previously [ ]. .. The lentiviral plasmid containing aberrant seipin was generated as follows: aberrant seipin complementary DNA was amplified by PCR using specific primers (forward: 5′-TAAGCAGGTACCTCTTTTTGCAGGATCCCATCGA-3′; reverse: 5′- TAAGCATCTAGAGCCTTGAATTCGCCCTTGAC-3′), and the amplification product was digested with the fast-digest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, Thermo Fisher Scientific), purified and inserted into the pLenti-CMV-GFP-2A-Puro-Blank vector (cat. LV073, Applied Biological Materials Inc.). ..

    Amplification:

    Article Title: Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy
    Article Snippet: The Myc-fused Celia seipin expression plasmid was described previously [ ]. .. The lentiviral plasmid containing aberrant seipin was generated as follows: aberrant seipin complementary DNA was amplified by PCR using specific primers (forward: 5′-TAAGCAGGTACCTCTTTTTGCAGGATCCCATCGA-3′; reverse: 5′- TAAGCATCTAGAGCCTTGAATTCGCCCTTGAC-3′), and the amplification product was digested with the fast-digest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, Thermo Fisher Scientific), purified and inserted into the pLenti-CMV-GFP-2A-Puro-Blank vector (cat. LV073, Applied Biological Materials Inc.). ..

    Article Title: A dual role of miR-22 modulated by RelA/p65 in resensitizing fulvestrant-resistant breast cancer cells to fulvestrant by targeting FOXP1 and HDAC4 and constitutive acetylation of p53 at Lys382
    Article Snippet: Generation of a wild-type hsa-miR-22 promoter reporter plasmid The Homo sapiens miR-22 stem loop (accession: MI0000078), which contains hsa-miR-22-3p and hsa-miR-22-5p, is located in a non-protein-coding gene MGC14376 (MIR22HG-001 ENST00000334146, Ensembl) exon 3, chromosome 17. .. A 1547 bp DNA fragment, containing a 1404 bp promoter, a 81 bp exon 1 and a 62 bp intron 1 of the miR-22 host gene MGC14376, was amplified by genomic PCR, cloned to the pGEM-T easy vector (Promega), released by restriction digestion with FastDigest Kpn I and Hin dIII (Fermentas), and subcloned into the pGL3-Basic vector (Promega) to generate the WT-miR-22 Prom reporter. .. Sequence identity of the insert fragment was confirmed by automatic DNA sequencing.

    Polymerase Chain Reaction:

    Article Title: Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy
    Article Snippet: The Myc-fused Celia seipin expression plasmid was described previously [ ]. .. The lentiviral plasmid containing aberrant seipin was generated as follows: aberrant seipin complementary DNA was amplified by PCR using specific primers (forward: 5′-TAAGCAGGTACCTCTTTTTGCAGGATCCCATCGA-3′; reverse: 5′- TAAGCATCTAGAGCCTTGAATTCGCCCTTGAC-3′), and the amplification product was digested with the fast-digest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, Thermo Fisher Scientific), purified and inserted into the pLenti-CMV-GFP-2A-Puro-Blank vector (cat. LV073, Applied Biological Materials Inc.). ..

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: The following constructs were generated using Accupol (Amplicon, catalogue number 210302) following the manufacturer's instructions: IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), as well as IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), IFNλ3_MYC (Template pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_MYC (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc). .. The following PCR programme was used 1: 95°C for 5 min 2: 30 cycles of 95°C for 1 min, 59°C for 1 min and 72°C for 1 min and 45 s 3: 72°C for 7 min. All the constructs were cloned into the pEF2 vector using Fastdigest Kpn I (Thermo Scientific, catalogue number FD0524) and Fastdigest XbaI (Thermo Scientific, catalogue number FD0684) following the manufacturer's instructions. .. The IFNλ4 mutant IFNλ4 N61D was generated by site-directed mutagenesis using IFNλ4_FLAG in the pEF2 vector as a template.

    Article Title: Clathrin mediated endocytosis is involved in the uptake of exogenous double-stranded RNA in the white mold phytopathogen Sclerotinia sclerotiorum
    Article Snippet: Target sequences were amplified using Phusion Taq (Thermo Scientific, Waltham, MA, USA) from Sclerotinia cDNA synthesized using the RNeasy Plant Extraction kit (Qiagen, Germantown, MD, USA), RNase Free DNase set (Qiagen, Germantown, MD, USA) and qScript cDNA synthesis kit (Quantabio, Beverly, MA, USA). .. PCR products were digested using FastDigest KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) and ligated into the similarly digested pL4440 vector using T4 Ligase (Invitrogen, Carlsbad, CA, USA). .. Primers (F: CAACCTGGCTTATCGAA; R: TAAAACGACGGCCAGTGA) were designed to amplify the T7 promotors flanking the insert and dsRNA was synthesized via T7 reverse transcription using the MEGAscript RNAi kit (Thermo Scientific, Waltham, MA, USA).

    Article Title: Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
    Article Snippet: The protein sequence of PxAgo3 was blasted in the National Center for Biotechnology Information (NCBI) (Available online: ) to verify its identity and submitted to GenBank (Available online: ) for accession number. .. To construct the PxAgo3 expression vector (PIZT/V5-His+PxAgo3), the PCR product and PIZT/V5-His were individually double-digested at 37 °C using two restriction enzymes of FastDigest KpnI and EcoRI (Invitrogen). .. Both double digested products (PCR product and PIZT/V5-His) were ligated and transfected into competent cells and checked by colony PCR and 1% gel electrophoresis (as previously described).

    Article Title: A dual role of miR-22 modulated by RelA/p65 in resensitizing fulvestrant-resistant breast cancer cells to fulvestrant by targeting FOXP1 and HDAC4 and constitutive acetylation of p53 at Lys382
    Article Snippet: Generation of a wild-type hsa-miR-22 promoter reporter plasmid The Homo sapiens miR-22 stem loop (accession: MI0000078), which contains hsa-miR-22-3p and hsa-miR-22-5p, is located in a non-protein-coding gene MGC14376 (MIR22HG-001 ENST00000334146, Ensembl) exon 3, chromosome 17. .. A 1547 bp DNA fragment, containing a 1404 bp promoter, a 81 bp exon 1 and a 62 bp intron 1 of the miR-22 host gene MGC14376, was amplified by genomic PCR, cloned to the pGEM-T easy vector (Promega), released by restriction digestion with FastDigest Kpn I and Hin dIII (Fermentas), and subcloned into the pGL3-Basic vector (Promega) to generate the WT-miR-22 Prom reporter. .. Sequence identity of the insert fragment was confirmed by automatic DNA sequencing.

    Purification:

    Article Title: Association of metreleptin treatment and dietary intervention with neurological outcomes in Celia’s encephalopathy
    Article Snippet: The Myc-fused Celia seipin expression plasmid was described previously [ ]. .. The lentiviral plasmid containing aberrant seipin was generated as follows: aberrant seipin complementary DNA was amplified by PCR using specific primers (forward: 5′-TAAGCAGGTACCTCTTTTTGCAGGATCCCATCGA-3′; reverse: 5′- TAAGCATCTAGAGCCTTGAATTCGCCCTTGAC-3′), and the amplification product was digested with the fast-digest restriction enzymes KpnI and XbaI (cat. FD0524 and FD0684, Thermo Fisher Scientific), purified and inserted into the pLenti-CMV-GFP-2A-Puro-Blank vector (cat. LV073, Applied Biological Materials Inc.). ..

    Construct:

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: The following constructs were generated using Accupol (Amplicon, catalogue number 210302) following the manufacturer's instructions: IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), as well as IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), IFNλ3_MYC (Template pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_MYC (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc). .. The following PCR programme was used 1: 95°C for 5 min 2: 30 cycles of 95°C for 1 min, 59°C for 1 min and 72°C for 1 min and 45 s 3: 72°C for 7 min. All the constructs were cloned into the pEF2 vector using Fastdigest Kpn I (Thermo Scientific, catalogue number FD0524) and Fastdigest XbaI (Thermo Scientific, catalogue number FD0684) following the manufacturer's instructions. .. The IFNλ4 mutant IFNλ4 N61D was generated by site-directed mutagenesis using IFNλ4_FLAG in the pEF2 vector as a template.

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: IFNλ4 ( , amino acids 23–179) preceded by a 6 × His tag followed by a TEV protease cleavage site was codon optimised for E. coli and purchased from Invitrogen. .. This construct was cloned into the pET-15b vector using Fastdigest KpnI (Thermo Scientific, catalogue number FD0524) and Fastdigest XhoI (Thermo Scientific, catalogue number FD0694). .. BL21 (DE3) E. coli cells transformed with the plasmids were grown at 37°C in Luria Bertani medium containing 100 μg/ml ampicillin and 100 μl antifoam A concentrate (Sigma-Aldrich, catalogue number A5633) under continuous shaking until an OD600 of 0.8–1.

    Article Title: Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
    Article Snippet: The protein sequence of PxAgo3 was blasted in the National Center for Biotechnology Information (NCBI) (Available online: ) to verify its identity and submitted to GenBank (Available online: ) for accession number. .. To construct the PxAgo3 expression vector (PIZT/V5-His+PxAgo3), the PCR product and PIZT/V5-His were individually double-digested at 37 °C using two restriction enzymes of FastDigest KpnI and EcoRI (Invitrogen). .. Both double digested products (PCR product and PIZT/V5-His) were ligated and transfected into competent cells and checked by colony PCR and 1% gel electrophoresis (as previously described).

    Clone Assay:

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: The following constructs were generated using Accupol (Amplicon, catalogue number 210302) following the manufacturer's instructions: IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_FLAG (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_FLAG (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacttgtcatcgtcatccttgtaatcacttccgacacacaggtccccactggc), as well as IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgcggccgagtgtctgg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), IFNλ3_MYC (Template pEF2-IFNλ3, forward primer: gcttggtaccatgaccggggactgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc), IFNλ3SP_IFNλ4_MYC (Template: IFNλ4, forward primer: gcttggtaccatgaccggggactgcatgccagtgctggtgctgatggccgcagtgctgaccgtgactggagcagccccccggcgctgcctgctctcgc, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctccgatccgaggcaaggccc), and IFNλ4SP_IFNλ3_MYC (Template: pEF2-IFNλ3, forward primer: gcttggtaccatgcggccgagtgtctgggccgcagtggccgcggggctgtgggtcctgtgcacggtgatcgcagaggttcctgtcgccaggctccgcgggg, reverse primer: agttctagatcacagatcctcctcactaatcagtttctgctcacttccgacacacaggtccccactggc). .. The following PCR programme was used 1: 95°C for 5 min 2: 30 cycles of 95°C for 1 min, 59°C for 1 min and 72°C for 1 min and 45 s 3: 72°C for 7 min. All the constructs were cloned into the pEF2 vector using Fastdigest Kpn I (Thermo Scientific, catalogue number FD0524) and Fastdigest XbaI (Thermo Scientific, catalogue number FD0684) following the manufacturer's instructions. .. The IFNλ4 mutant IFNλ4 N61D was generated by site-directed mutagenesis using IFNλ4_FLAG in the pEF2 vector as a template.

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: IFNλ4 ( , amino acids 23–179) preceded by a 6 × His tag followed by a TEV protease cleavage site was codon optimised for E. coli and purchased from Invitrogen. .. This construct was cloned into the pET-15b vector using Fastdigest KpnI (Thermo Scientific, catalogue number FD0524) and Fastdigest XhoI (Thermo Scientific, catalogue number FD0694). .. BL21 (DE3) E. coli cells transformed with the plasmids were grown at 37°C in Luria Bertani medium containing 100 μg/ml ampicillin and 100 μl antifoam A concentrate (Sigma-Aldrich, catalogue number A5633) under continuous shaking until an OD600 of 0.8–1.

    Article Title: A dual role of miR-22 modulated by RelA/p65 in resensitizing fulvestrant-resistant breast cancer cells to fulvestrant by targeting FOXP1 and HDAC4 and constitutive acetylation of p53 at Lys382
    Article Snippet: Generation of a wild-type hsa-miR-22 promoter reporter plasmid The Homo sapiens miR-22 stem loop (accession: MI0000078), which contains hsa-miR-22-3p and hsa-miR-22-5p, is located in a non-protein-coding gene MGC14376 (MIR22HG-001 ENST00000334146, Ensembl) exon 3, chromosome 17. .. A 1547 bp DNA fragment, containing a 1404 bp promoter, a 81 bp exon 1 and a 62 bp intron 1 of the miR-22 host gene MGC14376, was amplified by genomic PCR, cloned to the pGEM-T easy vector (Promega), released by restriction digestion with FastDigest Kpn I and Hin dIII (Fermentas), and subcloned into the pGL3-Basic vector (Promega) to generate the WT-miR-22 Prom reporter. .. Sequence identity of the insert fragment was confirmed by automatic DNA sequencing.

    Isolation:

    Article Title: Hat1 acetylates histone H4 and modulates the transcriptional program in Drosophila embryogenesis
    Article Snippet: The gene body of His4r from the start codon to the codon before the stop codon was PCR amplified from the pJET1.2-His4r template using His4r.E3C.F and His4r.E3C.R primers (Supplementary Table ) with Q5 DNA polymerase and reinserted to pJET1.2 with CloneJET PCR cloning kit. .. After digestion with FastDigest KpnI and EcoRI (Thermo Fisher Scientific) the His4r fragment was isolated and ligated to pENTR3C Gateway entry vector cut with the same enzymes. .. K12R and K5R mutations were introduced to the His4r sequentially utilizing mutagenic PCR with modified primers.

    Positron Emission Tomography:

    Article Title: Interferon lambda 4 signals via the IFNλ receptor to regulate antiviral activity against HCV and coronaviruses
    Article Snippet: IFNλ4 ( , amino acids 23–179) preceded by a 6 × His tag followed by a TEV protease cleavage site was codon optimised for E. coli and purchased from Invitrogen. .. This construct was cloned into the pET-15b vector using Fastdigest KpnI (Thermo Scientific, catalogue number FD0524) and Fastdigest XhoI (Thermo Scientific, catalogue number FD0694). .. BL21 (DE3) E. coli cells transformed with the plasmids were grown at 37°C in Luria Bertani medium containing 100 μg/ml ampicillin and 100 μl antifoam A concentrate (Sigma-Aldrich, catalogue number A5633) under continuous shaking until an OD600 of 0.8–1.

    Expressing:

    Article Title: Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
    Article Snippet: The protein sequence of PxAgo3 was blasted in the National Center for Biotechnology Information (NCBI) (Available online: ) to verify its identity and submitted to GenBank (Available online: ) for accession number. .. To construct the PxAgo3 expression vector (PIZT/V5-His+PxAgo3), the PCR product and PIZT/V5-His were individually double-digested at 37 °C using two restriction enzymes of FastDigest KpnI and EcoRI (Invitrogen). .. Both double digested products (PCR product and PIZT/V5-His) were ligated and transfected into competent cells and checked by colony PCR and 1% gel electrophoresis (as previously described).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher fastdigest kpni
    Fastdigest Kpni, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fastdigest kpni/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fastdigest kpni - by Bioz Stars, 2021-06
    93/100 stars
      Buy from Supplier

    Image Search Results