fastdigest bglii  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Name:
    FastDigest BglII
    Description:
    5 A ↓G A T C T 3 3 T C T A G ↑A 5 Thermo Scientific FastDigest BglII restriction enzyme recognizes A GATCT site and cuts best at 37°C in 5 15 minutes using universal FastDigest Buffer Thermo Scientific FastDigest BglII is one of an advanced line of fast restriction enzymes that are all 100 active in the universal FastDigest and FastDigest Green reaction buffers The universal buffer allows rapid single double or multiple DNA digestion within 5 15 minutes eliminating any need for buffer change or subsequent DNA clean up steps See Reaction Conditions for FastDigest Enzymes for a table of enzyme activity heat inactivation and incubation times for this and other FastDigest restriction enzymes DNA modifying enzymes such as Klenow Fragment T4 DNA Ligase alkaline phosphatases and T4 DNA Polymerase all have 100 activity in FastDigest Buffer Therefore enzymes for downstream applications can be directly added to the FastDigest reaction mix For additional convenience FastDigest Green Buffer includes a density reagent and two tracking dyes for direct loading of digestion reaction products on gels Short incubation times and optimal composition of the universal FastDigest Buffer eliminate star activity effects Features• 100 activity of all FastDigest enzymes in the universal buffer• 100 buffer compatibility with downstream applications• Complete digestion in 5 15 minutes• Direct loading on gels• No star activity• 176 FastDigest enzymes availableApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern Blot• Restriction fragment length polymorphism RFLP • SNP analysisNote The FastDigest Green Buffer offers the same high performance in DNA digestion and downstream applications as the colorless FastDigest Buffer For applications that require product analysis by fluorescence excitation e g concentration measurements in UV light the colorless FastDigest Buffer is recommended For methylation sensitivity refer to product specifications
    Catalog Number:
    fd0083
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher fastdigest bglii
    5 A ↓G A T C T 3 3 T C T A G ↑A 5 Thermo Scientific FastDigest BglII restriction enzyme recognizes A GATCT site and cuts best at 37°C in 5 15 minutes using universal FastDigest Buffer Thermo Scientific FastDigest BglII is one of an advanced line of fast restriction enzymes that are all 100 active in the universal FastDigest and FastDigest Green reaction buffers The universal buffer allows rapid single double or multiple DNA digestion within 5 15 minutes eliminating any need for buffer change or subsequent DNA clean up steps See Reaction Conditions for FastDigest Enzymes for a table of enzyme activity heat inactivation and incubation times for this and other FastDigest restriction enzymes DNA modifying enzymes such as Klenow Fragment T4 DNA Ligase alkaline phosphatases and T4 DNA Polymerase all have 100 activity in FastDigest Buffer Therefore enzymes for downstream applications can be directly added to the FastDigest reaction mix For additional convenience FastDigest Green Buffer includes a density reagent and two tracking dyes for direct loading of digestion reaction products on gels Short incubation times and optimal composition of the universal FastDigest Buffer eliminate star activity effects Features• 100 activity of all FastDigest enzymes in the universal buffer• 100 buffer compatibility with downstream applications• Complete digestion in 5 15 minutes• Direct loading on gels• No star activity• 176 FastDigest enzymes availableApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern Blot• Restriction fragment length polymorphism RFLP • SNP analysisNote The FastDigest Green Buffer offers the same high performance in DNA digestion and downstream applications as the colorless FastDigest Buffer For applications that require product analysis by fluorescence excitation e g concentration measurements in UV light the colorless FastDigest Buffer is recommended For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/fastdigest bglii/product/Thermo Fisher
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    fastdigest bglii - by Bioz Stars, 2020-09
    94/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐ GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐ GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Article Title: Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner
    Article Snippet: .. Plasmid or PCR fragment were cleaved by BglII (Fast Digest, ThermoScientific) to assure formation of the exact 5S rRNA 3’ end. .. Rec.5S rRNA in vitro hybridization and in vivo import test To test specific rec.5S rRNA annealing with target mtDNA, wild-type or mutant mtDNA fragments (nucleotides 15,251–15,680 of wild-type mtDNA or 8,099–8,365/15,438–15,680 of mutant mtDNA) were amplified as described previously [ ] using primers n°7 and 8 or n°8 and 9 respectively, separated on 1% agarose gel, blotted to Amersham Hybond-N membrane (GE Healthcare) and hybridized with 32 P-labeled recombinant RNA in 1X PBS at 37 °C.

    Article Title: Notch regulates BMP responsiveness and lateral branching in vessel networks via SMAD6
    Article Snippet: .. PCR product was purified using NucleoSpin kit (Clontech 740609) and double-digested for 10 min at 37° with BglII and KpnI (Life Technologies FD0084 and FD0524, respectively). ptdTomato-N1 empty vector (Clontech 632532) was double-digested in parallel using the same enzymes and de-phosphorylated for 5 min at 37° using FastAP Thermosensitive Alkaline Phosphatase (Life Technologies EF0654). .. Products were ligated at a 3:1 (Insert:Vector) molar ratio for 10 min at RT using T4 Rapid Ligation Kit (Life Technologies K1422), followed by transformation, selection, plasmid purification and sequencing, to verify the fidelity of the insert.

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. 2.7 Real‐time PCR Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Concentration Assay:

    Article Title: MSH1 is required for maintenance of the low mutation rates in plant mitochondrial and plastid genomes
    Article Snippet: .. Each ddPCR reaction was set up in an initial 20 μl volume composed of 1x Bio-Rad ddPCR Supermix for Probes (no dUTP), 250 nM final concentration of each probe, 900 nM final concentration of each primer, 1 μl of the restriction enzyme BglII (Thermo Scientific FD0083), and 5 µl of diluted template DNA (5-500 pg depending on the SNV target and type of DNA, i.e., total cellular or organellar). .. The restriction enzyme was included for fragmentation of genomic DNA to improve ddPCR efficiency and was selected because it does not cut within any of the target amplicons.

    Amplification:

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐ GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐ GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. 2.7 Real‐time PCR Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Plasmid Preparation:

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐ GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐ GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Article Title: Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner
    Article Snippet: .. Plasmid or PCR fragment were cleaved by BglII (Fast Digest, ThermoScientific) to assure formation of the exact 5S rRNA 3’ end. .. Rec.5S rRNA in vitro hybridization and in vivo import test To test specific rec.5S rRNA annealing with target mtDNA, wild-type or mutant mtDNA fragments (nucleotides 15,251–15,680 of wild-type mtDNA or 8,099–8,365/15,438–15,680 of mutant mtDNA) were amplified as described previously [ ] using primers n°7 and 8 or n°8 and 9 respectively, separated on 1% agarose gel, blotted to Amersham Hybond-N membrane (GE Healthcare) and hybridized with 32 P-labeled recombinant RNA in 1X PBS at 37 °C.

    Article Title: Notch regulates BMP responsiveness and lateral branching in vessel networks via SMAD6
    Article Snippet: .. PCR product was purified using NucleoSpin kit (Clontech 740609) and double-digested for 10 min at 37° with BglII and KpnI (Life Technologies FD0084 and FD0524, respectively). ptdTomato-N1 empty vector (Clontech 632532) was double-digested in parallel using the same enzymes and de-phosphorylated for 5 min at 37° using FastAP Thermosensitive Alkaline Phosphatase (Life Technologies EF0654). .. Products were ligated at a 3:1 (Insert:Vector) molar ratio for 10 min at RT using T4 Rapid Ligation Kit (Life Technologies K1422), followed by transformation, selection, plasmid purification and sequencing, to verify the fidelity of the insert.

    Article Title: Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4. Forkhead box C1 boosts triple‐negative breast cancer metastasis through activating the transcription of chemokine receptor‐4
    Article Snippet: .. The promoter of CXCR4 was PCR amplified from genomic DNA using the primers 5′‐GGGGTACC TTCCAGCCACCACCCTCCA‐3′ (forward), 5′‐GAAGATCT CGGCGTCACTTTGCTACCTG‐3′ (reverse), digested with Kpn I (FD0524; Fermentas) and Bgl II (fd0083; Fermentas), and ligated to the corresponding sites in pGL3 Basic vector (Promega). .. 2.7 Real‐time PCR Total RNA was extract using TRIzol (Invitrogen), and reverse transcription was carried out using an RT‐PCR kit (RR047A and RR820A; Takara, Beijing, China) according to the manufacturer's instructions; GAPDH was used as a loading control.

    Article Title: Estrogen-related receptor alpha is involved in Alzheimer's disease-like pathology.
    Article Snippet: .. Estrogen-related receptor alpha (ERRα) is a transcriptional factor associated with mitochondrial biogenesis and energy metabolism. .. Estrogen-related receptor alpha (ERRα) is a transcriptional factor associated with mitochondrial biogenesis and energy metabolism.

    Purification:

    Article Title: Notch regulates BMP responsiveness and lateral branching in vessel networks via SMAD6
    Article Snippet: .. PCR product was purified using NucleoSpin kit (Clontech 740609) and double-digested for 10 min at 37° with BglII and KpnI (Life Technologies FD0084 and FD0524, respectively). ptdTomato-N1 empty vector (Clontech 632532) was double-digested in parallel using the same enzymes and de-phosphorylated for 5 min at 37° using FastAP Thermosensitive Alkaline Phosphatase (Life Technologies EF0654). .. Products were ligated at a 3:1 (Insert:Vector) molar ratio for 10 min at RT using T4 Rapid Ligation Kit (Life Technologies K1422), followed by transformation, selection, plasmid purification and sequencing, to verify the fidelity of the insert.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher bglii
    Bglii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 169 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bglii/product/Thermo Fisher
    Average 94 stars, based on 169 article reviews
    Price from $9.99 to $1999.99
    bglii - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results