expression vector pet15b  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Millipore expression vector pet15b
    Lysis assays with cells of C. difficile strain 11204. Cells were grown to mid-exponential phase, harvested by centrifugation, and then either flash-frozen in liquid nitrogen and stored at −20°C before being assayed (A) or used immediately (B to D). Cells were incubated with Ni-NTA column-purified endolysin (E1) from E. coli expressing CD27L from <t>pET15b-</t> cd27l (A to C) or with crude protein extracts (D). (A) Effect of CD27L (7 μg, black squares, or 0.7 μg, gray squares) on frozen cells compared to that of the buffer control (EB; x's). (B) Effects of different amounts of CD27L (10.5 μg, black rectangles; 3.5 μg, gray rectangles; 0.7 μg, white rectangles; 0.35 μg, black squares; and 0.07 μg, gray squares) on fresh cells compared to that of the buffer control (EB; x's). (C) Activity profile of CD27L (black symbols) compared to that of the buffer control (EB; white symbols) tested at pH 4.5 (black squares), 5.8 (gray squares), 6.5 (black diamonds), 7.0 (gray diamonds), 7.6 (black triangles), and 8.3 (gray triangles). (D) Lysis of cells incubated with 50 μg of crude protein extracts from E. coli expressing pET15b- cd27l (black triangles) or pET15b (white triangles) or from L. lactis expressing pUK200His- cd27l (black diamonds) or pUK200His (white diamonds) or with the TN buffer control (plus signs). Values are the means of results from duplicate assays ± standard deviations.
    Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 94 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pet15b/product/Millipore
    Average 99 stars, based on 94 article reviews
    Price from $9.99 to $1999.99
    expression vector pet15b - by Bioz Stars, 2020-07
    99/100 stars

    Images

    1) Product Images from "Molecular Characterization of a Clostridium difficile Bacteriophage and Its Cloned Biologically Active Endolysin ▿ Bacteriophage and Its Cloned Biologically Active Endolysin ▿ †"

    Article Title: Molecular Characterization of a Clostridium difficile Bacteriophage and Its Cloned Biologically Active Endolysin ▿ Bacteriophage and Its Cloned Biologically Active Endolysin ▿ †

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00686-08

    Lysis assays with cells of C. difficile strain 11204. Cells were grown to mid-exponential phase, harvested by centrifugation, and then either flash-frozen in liquid nitrogen and stored at −20°C before being assayed (A) or used immediately (B to D). Cells were incubated with Ni-NTA column-purified endolysin (E1) from E. coli expressing CD27L from pET15b- cd27l (A to C) or with crude protein extracts (D). (A) Effect of CD27L (7 μg, black squares, or 0.7 μg, gray squares) on frozen cells compared to that of the buffer control (EB; x's). (B) Effects of different amounts of CD27L (10.5 μg, black rectangles; 3.5 μg, gray rectangles; 0.7 μg, white rectangles; 0.35 μg, black squares; and 0.07 μg, gray squares) on fresh cells compared to that of the buffer control (EB; x's). (C) Activity profile of CD27L (black symbols) compared to that of the buffer control (EB; white symbols) tested at pH 4.5 (black squares), 5.8 (gray squares), 6.5 (black diamonds), 7.0 (gray diamonds), 7.6 (black triangles), and 8.3 (gray triangles). (D) Lysis of cells incubated with 50 μg of crude protein extracts from E. coli expressing pET15b- cd27l (black triangles) or pET15b (white triangles) or from L. lactis expressing pUK200His- cd27l (black diamonds) or pUK200His (white diamonds) or with the TN buffer control (plus signs). Values are the means of results from duplicate assays ± standard deviations.
    Figure Legend Snippet: Lysis assays with cells of C. difficile strain 11204. Cells were grown to mid-exponential phase, harvested by centrifugation, and then either flash-frozen in liquid nitrogen and stored at −20°C before being assayed (A) or used immediately (B to D). Cells were incubated with Ni-NTA column-purified endolysin (E1) from E. coli expressing CD27L from pET15b- cd27l (A to C) or with crude protein extracts (D). (A) Effect of CD27L (7 μg, black squares, or 0.7 μg, gray squares) on frozen cells compared to that of the buffer control (EB; x's). (B) Effects of different amounts of CD27L (10.5 μg, black rectangles; 3.5 μg, gray rectangles; 0.7 μg, white rectangles; 0.35 μg, black squares; and 0.07 μg, gray squares) on fresh cells compared to that of the buffer control (EB; x's). (C) Activity profile of CD27L (black symbols) compared to that of the buffer control (EB; white symbols) tested at pH 4.5 (black squares), 5.8 (gray squares), 6.5 (black diamonds), 7.0 (gray diamonds), 7.6 (black triangles), and 8.3 (gray triangles). (D) Lysis of cells incubated with 50 μg of crude protein extracts from E. coli expressing pET15b- cd27l (black triangles) or pET15b (white triangles) or from L. lactis expressing pUK200His- cd27l (black diamonds) or pUK200His (white diamonds) or with the TN buffer control (plus signs). Values are the means of results from duplicate assays ± standard deviations.

    Techniques Used: Lysis, Centrifugation, Incubation, Purification, Expressing, Activity Assay

    (A) Gel analysis of crude protein lysates from E. coli and L. lactis expressing ΦCD27 endolysin and empty vector controls. Lanes: 1, SeeBlue marker (Invitrogen); 2 to 5, lysates from L. lactis containing pUK200His- cd27l (2 and 3) or pUK200His (4 and 5) with (2 and 4) or without (3 and 5) nisin induction; and 6 and 7, lysates from E. coli containing pET15b- cd27l (6) or pET15b (7), both with IPTG induction. Arrows indicate the His-tagged endolysin—when it is expressed from pET15b- cd27l with the His tag MGSSHHHHHHSSGLVPRGSH, the size is ca. 32 kDa, and when it is expressed from pUK200His- cd27l with the His tag MSHHHHHHA, the size is ca. 31 kDa. (B) Western analysis of the gel in panel A with a six-His tag antibody. (C) Gel analysis of Ni-NTA column-purified His-tagged endolysin from E. coli expressing pET15b- cd27l . Lanes: 1, SeeBlue marker; 2 to 5, E. coli (pET15b- cd27l ) total protein extracts after 5 h of induction with IPTG; 2, crude lysate; 3, column flowthrough; 4, primary wash effluent; 5, secondary wash effluent; 6, primary eluate (E1); and 7, secondary eluate (E2). Crude protein lysates were loaded at 10 μg of total protein per lane, while lanes loaded with samples from Ni-NTA column fractionation contained 6.5 μl per lane.
    Figure Legend Snippet: (A) Gel analysis of crude protein lysates from E. coli and L. lactis expressing ΦCD27 endolysin and empty vector controls. Lanes: 1, SeeBlue marker (Invitrogen); 2 to 5, lysates from L. lactis containing pUK200His- cd27l (2 and 3) or pUK200His (4 and 5) with (2 and 4) or without (3 and 5) nisin induction; and 6 and 7, lysates from E. coli containing pET15b- cd27l (6) or pET15b (7), both with IPTG induction. Arrows indicate the His-tagged endolysin—when it is expressed from pET15b- cd27l with the His tag MGSSHHHHHHSSGLVPRGSH, the size is ca. 32 kDa, and when it is expressed from pUK200His- cd27l with the His tag MSHHHHHHA, the size is ca. 31 kDa. (B) Western analysis of the gel in panel A with a six-His tag antibody. (C) Gel analysis of Ni-NTA column-purified His-tagged endolysin from E. coli expressing pET15b- cd27l . Lanes: 1, SeeBlue marker; 2 to 5, E. coli (pET15b- cd27l ) total protein extracts after 5 h of induction with IPTG; 2, crude lysate; 3, column flowthrough; 4, primary wash effluent; 5, secondary wash effluent; 6, primary eluate (E1); and 7, secondary eluate (E2). Crude protein lysates were loaded at 10 μg of total protein per lane, while lanes loaded with samples from Ni-NTA column fractionation contained 6.5 μl per lane.

    Techniques Used: Expressing, Plasmid Preparation, Marker, Western Blot, Purification, Fractionation

    2) Product Images from "Identification and Characterization of a Novel Phosphodiesterase from the Metagenome of an Indian Coalbed"

    Article Title: Identification and Characterization of a Novel Phosphodiesterase from the Metagenome of an Indian Coalbed

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0118075

    In vivo assay for cAMP phosphodiesterase acivity of PdeM. (A) β-Galactosidase activity of E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by IPTG. (B) SDS-PAGE of the total proteins extracted from E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by 0.5 mM IPTG. Lane M: protein molecular weight marker; lane pET: induced cells of E coli BL21 (DE3) harbouring pET15b, and lane pET-PdeM: induced cells of E . coli BL21 (DE3) harbouring pET-PdeM.
    Figure Legend Snippet: In vivo assay for cAMP phosphodiesterase acivity of PdeM. (A) β-Galactosidase activity of E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by IPTG. (B) SDS-PAGE of the total proteins extracted from E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by 0.5 mM IPTG. Lane M: protein molecular weight marker; lane pET: induced cells of E coli BL21 (DE3) harbouring pET15b, and lane pET-PdeM: induced cells of E . coli BL21 (DE3) harbouring pET-PdeM.

    Techniques Used: In Vivo, Activity Assay, Positron Emission Tomography, SDS Page, Molecular Weight, Marker

    3) Product Images from "Molecular Characterization of a Novel Glucosyltransferase from Lactobacillus reuteri Strain 121 Synthesizing a Unique, Highly Branched Glucan with ?-(1- > 4) and ?-(1- > 6) Glucosidic Bonds"

    Article Title: Molecular Characterization of a Novel Glucosyltransferase from Lactobacillus reuteri Strain 121 Synthesizing a Unique, Highly Branched Glucan with ?-(1- > 4) and ?-(1- > 6) Glucosidic Bonds

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.68.9.4283-4291.2002

    Overview of primers and restriction sites used for cloning of the gtfA gene in the expression vector pET15B (Novagen).
    Figure Legend Snippet: Overview of primers and restriction sites used for cloning of the gtfA gene in the expression vector pET15B (Novagen).

    Techniques Used: Clone Assay, Expressing, Plasmid Preparation

    4) Product Images from "Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza"

    Article Title: Sublingual Immunization with M2-Based Vaccine Induces Broad Protective Immunity against Influenza

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027953

    Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.
    Figure Legend Snippet: Construction of plasmids and purification of M2 proteins. (A) The synthetic M2eC or 3M2eC genes without hydrophobic region (amino acids 26–55) from PR8 virus were cloned into pET15b vector (B). The recombinant proteins expressed in E. coli were purified by His-tag affinity chromatography and detected by Western blot using M2e-specific monoclonal Ab, 14C2.

    Techniques Used: Purification, Clone Assay, Plasmid Preparation, Recombinant, Affinity Chromatography, Western Blot

    5) Product Images from "Identification and Characterization of a Novel Phosphodiesterase from the Metagenome of an Indian Coalbed"

    Article Title: Identification and Characterization of a Novel Phosphodiesterase from the Metagenome of an Indian Coalbed

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0118075

    In vivo assay for cAMP phosphodiesterase acivity of PdeM. (A) β-Galactosidase activity of E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by IPTG. (B) SDS-PAGE of the total proteins extracted from E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by 0.5 mM IPTG. Lane M: protein molecular weight marker; lane pET: induced cells of E coli BL21 (DE3) harbouring pET15b, and lane pET-PdeM: induced cells of E . coli BL21 (DE3) harbouring pET-PdeM.
    Figure Legend Snippet: In vivo assay for cAMP phosphodiesterase acivity of PdeM. (A) β-Galactosidase activity of E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by IPTG. (B) SDS-PAGE of the total proteins extracted from E coli BL21 (DE3) harbouring pET15b or its derivative pET-PdeM without or with induction by 0.5 mM IPTG. Lane M: protein molecular weight marker; lane pET: induced cells of E coli BL21 (DE3) harbouring pET15b, and lane pET-PdeM: induced cells of E . coli BL21 (DE3) harbouring pET-PdeM.

    Techniques Used: In Vivo, Activity Assay, Positron Emission Tomography, SDS Page, Molecular Weight, Marker

    Related Articles

    Clone Assay:

    Article Title: Functional Contribution of the Spastic Paraplegia-Related Triglyceride Hydrolase DDHD2 to the Formation and Content of Lipid Droplets
    Article Snippet: .. DDHD2 was amplified via polymerase chain reaction from human cDNA using the primers 5′-AAGCTTGCGGCCGCGATGTCATCAGTGCAGTCACAACAGG-3′ and 5′-ATCGATGGTACCGGTTACTGTAAAGGCTGATCAAGGAA-3′ and cloned into the NotI/KpnI site of pFLAG-CMV-6a (Sigma-Aldrich). .. HSP-associated DDHD2 mutations and an active-site S351A DDHD2 were generated by site-directed mutagenesis using mismatch-containing primers ( ).

    Article Title: Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    Article Snippet: .. The cDNA of Yif1B was synthesized with reverse transcriptase from rat brain RNA, amplified with the forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59 of ) and reverse primer 5′-CAGTTCACCGTACAAGGTGGAA-3′ (nucleotides 960–981), and cloned into pCB6 vector ( ) downstream of the CMV promoter, or in frame downstream of the flag epitope of the pFlag-CMV-6a vector (Sigma). .. The 425 nt probe for Northern blot was amplified with forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59) and reverse primer 5′-TGTCCTGTTGGTACTGGACCTC-3′ (nucleotides 441–462), and cloned into TA cloning vector (Invitrogen).

    Article Title: Glomerulosclerosis Induced by Deficiency of Membrane-Associated Guanylate Kinase Inverted 2 in Kidney Podocytes
    Article Snippet: .. A full-length cDNA clone of human or rat dendrin was cloned in-frame into pEGFP-C1 (Clontech, Mountain View, CA) or pFLAG-CMV-6a (Sigma-Aldrich, St. Louis, MO) vectors. .. Rat dendrin deletion constructs lacking PPXY motifs 1 (amino acids 146–149), 2 and 3 (amino acids 170–179), or all three (amino acids 146–149, 170–179), were generated by PCR and cloned into pEGFP-C1 or pFLAG-CMV-6a.

    Amplification:

    Article Title: A New Vesicular Scaffolding Complex Mediates the G-Protein-Coupled 5-HT1A Receptor Targeting to Neuronal Dendrites
    Article Snippet: .. The N-terminal truncated Yif1B proteins tagged with a Flag epitope were generated by amplification with the following primers (the HindIII site is in italics) and inserted at the Hind III site of the pFlag-CMV-6a vector (Sigma): Yif1B fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG-3′; Flag-Yif1B(10) fw HindIII: 5′-GCG AAGCTT TTGGGACGCCCCGGCTGCGTAAG-3′; Flag-Yif1B(18) fw HindIII: 5′-GCG AAGCTT TTCCCTCAAAGCGGAGGGTCCC-3′; Flag-Yif1B(30) fw HindIII: 5′-GCG AAGCTT TTATGGCTGATCCCCACCAGTTT-3′; Flag-Yif1B(50) fw HindIII: 5′-GCG AAGCTT TTGGCCAGCCATCACCTGGTAGC-3′; and Flag-Yif1B(55) fw HindIII:5′-GCG AAGCTT TTATGGGTAGCCTGGGTTACCCCACC-3′. .. The C-terminal truncated Yif1B proteins were generated after amplification with the following oligos, the reverse primer containing a stop codon (in italics), and inserted between the HindIII and the EcoRI sites of the pCB6 vector ( ) downstream of the CMV promoter: Yif1B 1 fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG; Yif1B 311 rev EcoR1: 5′-A GAATTC TCA CCGTACAAGGTGGAAGGT-3′; Yif1B(152) rev EcoR1: 5′-A GAATTC TCA TGGAGCATTGATGTCAAAGCG-3′; Yif1B(186) rev EcoR1: 5′-A GAATTC TCA CTGTAGTCCCAGGAGGTCTGG-3′; Yif1B(220) rev EcoR1: 5′-A GAATTC TCA CACCAGGTCAATGGTGGTAA-3′; and Yif1B(272) rev EcoR1: 5′-A GAATTC TCA TGCCTGGGCCAGGATCTTGAG-3′.

    Article Title: Functional Contribution of the Spastic Paraplegia-Related Triglyceride Hydrolase DDHD2 to the Formation and Content of Lipid Droplets
    Article Snippet: .. DDHD2 was amplified via polymerase chain reaction from human cDNA using the primers 5′-AAGCTTGCGGCCGCGATGTCATCAGTGCAGTCACAACAGG-3′ and 5′-ATCGATGGTACCGGTTACTGTAAAGGCTGATCAAGGAA-3′ and cloned into the NotI/KpnI site of pFLAG-CMV-6a (Sigma-Aldrich). .. HSP-associated DDHD2 mutations and an active-site S351A DDHD2 were generated by site-directed mutagenesis using mismatch-containing primers ( ).

    Article Title: Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    Article Snippet: .. The cDNA of Yif1B was synthesized with reverse transcriptase from rat brain RNA, amplified with the forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59 of ) and reverse primer 5′-CAGTTCACCGTACAAGGTGGAA-3′ (nucleotides 960–981), and cloned into pCB6 vector ( ) downstream of the CMV promoter, or in frame downstream of the flag epitope of the pFlag-CMV-6a vector (Sigma). .. The 425 nt probe for Northern blot was amplified with forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59) and reverse primer 5′-TGTCCTGTTGGTACTGGACCTC-3′ (nucleotides 441–462), and cloned into TA cloning vector (Invitrogen).

    Synthesized:

    Article Title: Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    Article Snippet: .. The cDNA of Yif1B was synthesized with reverse transcriptase from rat brain RNA, amplified with the forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59 of ) and reverse primer 5′-CAGTTCACCGTACAAGGTGGAA-3′ (nucleotides 960–981), and cloned into pCB6 vector ( ) downstream of the CMV promoter, or in frame downstream of the flag epitope of the pFlag-CMV-6a vector (Sigma). .. The 425 nt probe for Northern blot was amplified with forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59) and reverse primer 5′-TGTCCTGTTGGTACTGGACCTC-3′ (nucleotides 441–462), and cloned into TA cloning vector (Invitrogen).

    Hydrophobic Interaction Chromatography:

    Article Title: Direct interaction of the human I-mfa domain-containing protein, HIC, with HIV-1 Tat results in cytoplasmic sequestration and control of Tat activity
    Article Snippet: .. A HIC(2-144) was subcloned into pFLAG-CMV-6a (Sigma), and HIC(144-246) was subcloned into pFLAG-CMV6c (Sigma). .. By using FuGENE 6 (Roche), 293T cells were transfected with 3 μg of pCAGGS or pCAGGS-Tat and 2 μg of pFLAG, pFLAG-HIC, pFLAG-HIC(2-144), or pFLAG-HIC(144-246).

    FLAG-tag:

    Article Title: A New Vesicular Scaffolding Complex Mediates the G-Protein-Coupled 5-HT1A Receptor Targeting to Neuronal Dendrites
    Article Snippet: .. The N-terminal truncated Yif1B proteins tagged with a Flag epitope were generated by amplification with the following primers (the HindIII site is in italics) and inserted at the Hind III site of the pFlag-CMV-6a vector (Sigma): Yif1B fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG-3′; Flag-Yif1B(10) fw HindIII: 5′-GCG AAGCTT TTGGGACGCCCCGGCTGCGTAAG-3′; Flag-Yif1B(18) fw HindIII: 5′-GCG AAGCTT TTCCCTCAAAGCGGAGGGTCCC-3′; Flag-Yif1B(30) fw HindIII: 5′-GCG AAGCTT TTATGGCTGATCCCCACCAGTTT-3′; Flag-Yif1B(50) fw HindIII: 5′-GCG AAGCTT TTGGCCAGCCATCACCTGGTAGC-3′; and Flag-Yif1B(55) fw HindIII:5′-GCG AAGCTT TTATGGGTAGCCTGGGTTACCCCACC-3′. .. The C-terminal truncated Yif1B proteins were generated after amplification with the following oligos, the reverse primer containing a stop codon (in italics), and inserted between the HindIII and the EcoRI sites of the pCB6 vector ( ) downstream of the CMV promoter: Yif1B 1 fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG; Yif1B 311 rev EcoR1: 5′-A GAATTC TCA CCGTACAAGGTGGAAGGT-3′; Yif1B(152) rev EcoR1: 5′-A GAATTC TCA TGGAGCATTGATGTCAAAGCG-3′; Yif1B(186) rev EcoR1: 5′-A GAATTC TCA CTGTAGTCCCAGGAGGTCTGG-3′; Yif1B(220) rev EcoR1: 5′-A GAATTC TCA CACCAGGTCAATGGTGGTAA-3′; and Yif1B(272) rev EcoR1: 5′-A GAATTC TCA TGCCTGGGCCAGGATCTTGAG-3′.

    Article Title: Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    Article Snippet: .. The cDNA of Yif1B was synthesized with reverse transcriptase from rat brain RNA, amplified with the forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59 of ) and reverse primer 5′-CAGTTCACCGTACAAGGTGGAA-3′ (nucleotides 960–981), and cloned into pCB6 vector ( ) downstream of the CMV promoter, or in frame downstream of the flag epitope of the pFlag-CMV-6a vector (Sigma). .. The 425 nt probe for Northern blot was amplified with forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59) and reverse primer 5′-TGTCCTGTTGGTACTGGACCTC-3′ (nucleotides 441–462), and cloned into TA cloning vector (Invitrogen).

    Generated:

    Article Title: A New Vesicular Scaffolding Complex Mediates the G-Protein-Coupled 5-HT1A Receptor Targeting to Neuronal Dendrites
    Article Snippet: .. The N-terminal truncated Yif1B proteins tagged with a Flag epitope were generated by amplification with the following primers (the HindIII site is in italics) and inserted at the Hind III site of the pFlag-CMV-6a vector (Sigma): Yif1B fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG-3′; Flag-Yif1B(10) fw HindIII: 5′-GCG AAGCTT TTGGGACGCCCCGGCTGCGTAAG-3′; Flag-Yif1B(18) fw HindIII: 5′-GCG AAGCTT TTCCCTCAAAGCGGAGGGTCCC-3′; Flag-Yif1B(30) fw HindIII: 5′-GCG AAGCTT TTATGGCTGATCCCCACCAGTTT-3′; Flag-Yif1B(50) fw HindIII: 5′-GCG AAGCTT TTGGCCAGCCATCACCTGGTAGC-3′; and Flag-Yif1B(55) fw HindIII:5′-GCG AAGCTT TTATGGGTAGCCTGGGTTACCCCACC-3′. .. The C-terminal truncated Yif1B proteins were generated after amplification with the following oligos, the reverse primer containing a stop codon (in italics), and inserted between the HindIII and the EcoRI sites of the pCB6 vector ( ) downstream of the CMV promoter: Yif1B 1 fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG; Yif1B 311 rev EcoR1: 5′-A GAATTC TCA CCGTACAAGGTGGAAGGT-3′; Yif1B(152) rev EcoR1: 5′-A GAATTC TCA TGGAGCATTGATGTCAAAGCG-3′; Yif1B(186) rev EcoR1: 5′-A GAATTC TCA CTGTAGTCCCAGGAGGTCTGG-3′; Yif1B(220) rev EcoR1: 5′-A GAATTC TCA CACCAGGTCAATGGTGGTAA-3′; and Yif1B(272) rev EcoR1: 5′-A GAATTC TCA TGCCTGGGCCAGGATCTTGAG-3′.

    Expressing:

    Article Title: Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome
    Article Snippet: .. In brief, the human SLC52A2 wildtype (wt ) cDNA was subcloned into pFLAG-CMV-6a expression vector (Sigma-Aldrich, St. Louis, MO). .. Both mutations, c.368T > C and c.1016T > C, were introduced by site-directed mutagenesis with KOD-Plus-Mutagenesis Kit (TOYOBO, Osaka, Japan) using following primer sets, forward primer 5′- CGGCATGCTGTGCCTCGAATGTCACT-3′, reverse primer 5′-GTGCCAGCACAAAGGCCAGTGCTAA-3′ for 368T > C, and forward primer 5′-CGGGCAGCCTCTCTCTGCTGGGCGTG-3′, reverse primer 5′-GCCCTGCCAAGGACCTGCACAGCAC-3′ for 1016T > C. The mutations were confirmed by direct sequencing.

    Article Title: Fez1/Lzts1 absence impairs Cdk1/Cdc25C interaction during mitosis and predisposes to cancer development
    Article Snippet: .. The CDC25C cDNA was sub-cloned in the pFlag-CMV 6a expression vector (Sigma). .. For retroviral expression LZTS1 , CDC25C and CDK1 AF cDNAs were cloned in pMSCV-Puro vector (Clontech) without any tag.

    Polymerase Chain Reaction:

    Article Title: Functional Contribution of the Spastic Paraplegia-Related Triglyceride Hydrolase DDHD2 to the Formation and Content of Lipid Droplets
    Article Snippet: .. DDHD2 was amplified via polymerase chain reaction from human cDNA using the primers 5′-AAGCTTGCGGCCGCGATGTCATCAGTGCAGTCACAACAGG-3′ and 5′-ATCGATGGTACCGGTTACTGTAAAGGCTGATCAAGGAA-3′ and cloned into the NotI/KpnI site of pFLAG-CMV-6a (Sigma-Aldrich). .. HSP-associated DDHD2 mutations and an active-site S351A DDHD2 were generated by site-directed mutagenesis using mismatch-containing primers ( ).

    Plasmid Preparation:

    Article Title: Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome
    Article Snippet: .. In brief, the human SLC52A2 wildtype (wt ) cDNA was subcloned into pFLAG-CMV-6a expression vector (Sigma-Aldrich, St. Louis, MO). .. Both mutations, c.368T > C and c.1016T > C, were introduced by site-directed mutagenesis with KOD-Plus-Mutagenesis Kit (TOYOBO, Osaka, Japan) using following primer sets, forward primer 5′- CGGCATGCTGTGCCTCGAATGTCACT-3′, reverse primer 5′-GTGCCAGCACAAAGGCCAGTGCTAA-3′ for 368T > C, and forward primer 5′-CGGGCAGCCTCTCTCTGCTGGGCGTG-3′, reverse primer 5′-GCCCTGCCAAGGACCTGCACAGCAC-3′ for 1016T > C. The mutations were confirmed by direct sequencing.

    Article Title: A New Vesicular Scaffolding Complex Mediates the G-Protein-Coupled 5-HT1A Receptor Targeting to Neuronal Dendrites
    Article Snippet: .. The N-terminal truncated Yif1B proteins tagged with a Flag epitope were generated by amplification with the following primers (the HindIII site is in italics) and inserted at the Hind III site of the pFlag-CMV-6a vector (Sigma): Yif1B fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG-3′; Flag-Yif1B(10) fw HindIII: 5′-GCG AAGCTT TTGGGACGCCCCGGCTGCGTAAG-3′; Flag-Yif1B(18) fw HindIII: 5′-GCG AAGCTT TTCCCTCAAAGCGGAGGGTCCC-3′; Flag-Yif1B(30) fw HindIII: 5′-GCG AAGCTT TTATGGCTGATCCCCACCAGTTT-3′; Flag-Yif1B(50) fw HindIII: 5′-GCG AAGCTT TTGGCCAGCCATCACCTGGTAGC-3′; and Flag-Yif1B(55) fw HindIII:5′-GCG AAGCTT TTATGGGTAGCCTGGGTTACCCCACC-3′. .. The C-terminal truncated Yif1B proteins were generated after amplification with the following oligos, the reverse primer containing a stop codon (in italics), and inserted between the HindIII and the EcoRI sites of the pCB6 vector ( ) downstream of the CMV promoter: Yif1B 1 fw HindIII: 5′-GCG AAGCTT TTATGCACGCGACAGGTTTG; Yif1B 311 rev EcoR1: 5′-A GAATTC TCA CCGTACAAGGTGGAAGGT-3′; Yif1B(152) rev EcoR1: 5′-A GAATTC TCA TGGAGCATTGATGTCAAAGCG-3′; Yif1B(186) rev EcoR1: 5′-A GAATTC TCA CTGTAGTCCCAGGAGGTCTGG-3′; Yif1B(220) rev EcoR1: 5′-A GAATTC TCA CACCAGGTCAATGGTGGTAA-3′; and Yif1B(272) rev EcoR1: 5′-A GAATTC TCA TGCCTGGGCCAGGATCTTGAG-3′.

    Article Title: Fez1/Lzts1 absence impairs Cdk1/Cdc25C interaction during mitosis and predisposes to cancer development
    Article Snippet: .. The CDC25C cDNA was sub-cloned in the pFlag-CMV 6a expression vector (Sigma). .. For retroviral expression LZTS1 , CDC25C and CDK1 AF cDNAs were cloned in pMSCV-Puro vector (Clontech) without any tag.

    Article Title: Targeting of the 5-HT1A Serotonin Receptor to Neuronal Dendrites Is Mediated by Yif1B
    Article Snippet: .. The cDNA of Yif1B was synthesized with reverse transcriptase from rat brain RNA, amplified with the forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59 of ) and reverse primer 5′-CAGTTCACCGTACAAGGTGGAA-3′ (nucleotides 960–981), and cloned into pCB6 vector ( ) downstream of the CMV promoter, or in frame downstream of the flag epitope of the pFlag-CMV-6a vector (Sigma). .. The 425 nt probe for Northern blot was amplified with forward primer 5′-AAGCATGCACGCGACAGGTTTG-3′ (nucleotides 38–59) and reverse primer 5′-TGTCCTGTTGGTACTGGACCTC-3′ (nucleotides 441–462), and cloned into TA cloning vector (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Millipore expression vector pet15b
    Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pet15b/product/Millipore
    Average 92 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    expression vector pet15b - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    Millipore t7 expression plasmids pet15b
    T7 Expression Plasmids Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 expression plasmids pet15b/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t7 expression plasmids pet15b - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    85
    Millipore pet15b protein expression vector
    Pet15b Protein Expression Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pet15b protein expression vector/product/Millipore
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pet15b protein expression vector - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results