expand high fidelity pcr system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    High Fidelity PCR Enzyme Mix
    Description:

    Catalog Number:
    K0191
    Price:
    None
    Buy from Supplier


    Structured Review

    Thermo Fisher expand high fidelity pcr system
    Nucleotide sequence of the <t>PCR-generated</t> fragment containing the wild-type <t>nfsA</t> gene from E. coli ). Mutations for the 20 mutants characterized in this study are indicated. Altered bases and amino acids are underlined in the wild-type sequence, with substituted bases indicated above the sequence. IS elements are shown as boxes above the sequence, with arrows indicating the insertion point. Deletions and frameshifts are indicated below the sequence. PCR primers used for amplification of the gene are shown as horizontal arrows, and the lowercase letters indicate synthetic restriction endonuclease sites. S.D., Shine-Dalgarno sequence.

    https://www.bioz.com/result/expand high fidelity pcr system/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2021-07
    86/100 stars

    Images

    1) Product Images from "Oxygen-Insensitive Nitroreductases: Analysis of the Roles of nfsA and nfsB in Development of Resistance to 5-Nitrofuran Derivatives in Escherichia coli"

    Article Title: Oxygen-Insensitive Nitroreductases: Analysis of the Roles of nfsA and nfsB in Development of Resistance to 5-Nitrofuran Derivatives in Escherichia coli

    Journal: Journal of Bacteriology

    doi:

    Nucleotide sequence of the PCR-generated fragment containing the wild-type nfsA gene from E. coli ). Mutations for the 20 mutants characterized in this study are indicated. Altered bases and amino acids are underlined in the wild-type sequence, with substituted bases indicated above the sequence. IS elements are shown as boxes above the sequence, with arrows indicating the insertion point. Deletions and frameshifts are indicated below the sequence. PCR primers used for amplification of the gene are shown as horizontal arrows, and the lowercase letters indicate synthetic restriction endonuclease sites. S.D., Shine-Dalgarno sequence.
    Figure Legend Snippet: Nucleotide sequence of the PCR-generated fragment containing the wild-type nfsA gene from E. coli ). Mutations for the 20 mutants characterized in this study are indicated. Altered bases and amino acids are underlined in the wild-type sequence, with substituted bases indicated above the sequence. IS elements are shown as boxes above the sequence, with arrows indicating the insertion point. Deletions and frameshifts are indicated below the sequence. PCR primers used for amplification of the gene are shown as horizontal arrows, and the lowercase letters indicate synthetic restriction endonuclease sites. S.D., Shine-Dalgarno sequence.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Generated, Amplification

    Related Articles

    Amplification:

    Article Title: The Adenovirus L4 33-Kilodalton Protein Binds to Intragenic Sequences of the Major Late Promoter Required for Late Phase-Specific Stimulation of Transcription ▿
    Article Snippet: .. The IVa2 and L4 33-kDa coding sequences were amplified by high-fidelity PCR using Accuprime Pfx (Invitrogen) with the Ad2 genome as a template and primers carrying restriction endonuclease sites. ..

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Article Title: Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿ †
    Article Snippet: The hCMV clinical strains Coz and Par were isolated from blood and urine, respectively, by Stephen Spector (University of California at San Diego). .. A 5.8-kb fragment covering the major IE transcription units of Coz or Par was amplified by high-fidelity PCR from virion DNA using primers 588 and 589 (Table ), cloned in vector pCR4-TOPO (Invitrogen), and sequenced (Princeton University Syn/Seq Facility). .. Plasmid pGEX-IE1 was constructed by excising the 72-kDa hCMV IE1 coding sequence from pcDNA-IE1 ( ) via consecutive treatment with HindIII, Klenow polymerase, and EcoRI.

    Article Title: Serine/Threonine Phosphatase Stp1 Mediates Post-transcriptional Regulation of Hemolysin, Autolysis, and Virulence of Group B Streptococcus *
    Article Snippet: .. Approximately 1 kb of DNA located upstream of stp1 was amplified using the primers PF3:5′ and PR1+:5′ and high fidelity PCR (Invitrogen). .. Likewise, 1 kb of DNA that encoded the last 10 amino acids of Stp1 and the region downstream was amplified using primers NEW PF2+:5′ and PR4:5′ as described above.

    Article Title: Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression
    Article Snippet: DNase I (Turbo DNA-free, Applied Biosystems) was used to remove DNA contamination. .. Reverse transcription PCR (RT-PCR) was performed with 1 μg of RNA in a total 20-μl reaction volume, using the SuperScript III First-Strand Synthesis System for RT-PCR (Applied Biosystems), and PCR amplification of the cDNA was performed with High-Fidelity PCR enzyme mix (Fermentas). .. The first-strand cDNA synthesis step was conducted at 55ºC for 1 h, and the cycling conditions for PCR were performed as follows: 3-min denaturation period at 94ºC; 20 cycles for 1 min at 94ºC, 45 s at 51ºC, and 1 min per kb of DNA template at 72ºC; and final 7-min extension at 72ºC.

    Article Title: Thermal Inactivation of Enteric Viruses and Bioaccumulation of Enteric Foodborne Viruses in Live Oysters ( Crassostrea virginica)
    Article Snippet: .. The capsid VP1 gene of a human NoV GII.4 strain (HS66) was amplified by high-fidelity PCR and was cloned into a pFastBac Dual expression vector (Invitrogen) at SmaI and XhoI sites under the control of the p10 promoter, resulting in the construction of the pFastBac Dual-VP1 expression vector. .. The correct insertion of the VP1 gene was confirmed by DNA sequencing.

    Polymerase Chain Reaction:

    Article Title: The Adenovirus L4 33-Kilodalton Protein Binds to Intragenic Sequences of the Major Late Promoter Required for Late Phase-Specific Stimulation of Transcription ▿
    Article Snippet: .. The IVa2 and L4 33-kDa coding sequences were amplified by high-fidelity PCR using Accuprime Pfx (Invitrogen) with the Ad2 genome as a template and primers carrying restriction endonuclease sites. ..

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Article Title: Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿ †
    Article Snippet: The hCMV clinical strains Coz and Par were isolated from blood and urine, respectively, by Stephen Spector (University of California at San Diego). .. A 5.8-kb fragment covering the major IE transcription units of Coz or Par was amplified by high-fidelity PCR from virion DNA using primers 588 and 589 (Table ), cloned in vector pCR4-TOPO (Invitrogen), and sequenced (Princeton University Syn/Seq Facility). .. Plasmid pGEX-IE1 was constructed by excising the 72-kDa hCMV IE1 coding sequence from pcDNA-IE1 ( ) via consecutive treatment with HindIII, Klenow polymerase, and EcoRI.

    Article Title: Serine/Threonine Phosphatase Stp1 Mediates Post-transcriptional Regulation of Hemolysin, Autolysis, and Virulence of Group B Streptococcus *
    Article Snippet: .. Approximately 1 kb of DNA located upstream of stp1 was amplified using the primers PF3:5′ and PR1+:5′ and high fidelity PCR (Invitrogen). .. Likewise, 1 kb of DNA that encoded the last 10 amino acids of Stp1 and the region downstream was amplified using primers NEW PF2+:5′ and PR4:5′ as described above.

    Article Title: CHIIMP: An automated high‐throughput microsatellite genotyping platform reveals greater allelic diversity in wild chimpanzees, et al. CHIIMP: An automated high‐throughput microsatellite genotyping platform reveals greater allelic diversity in wild chimpanzees
    Article Snippet: .. Briefly, 2 μl DNA extract was added to 1× High Fidelity PCR Buffer, 3.5 mM MgSO4 , 0.3 μM forward (5′‐GCCAGAGGAGGAACGAGCT‐3′) and reverse (5′‐GGGCCTTTTCATTGTTTTCCA‐3′) qPCR primers, 0.2 μM of a FAM‐labeled probe (FAM‐TGCCCTGCGTGACCAGATCC‐BHQ1), 0.2 mM dNTPs, 1× ROX Reference Dye, and 0.5 U Platinum Taq DNA Polymerase High Fidelity (Invitrogen). .. Each sample was run in triplicate on a 7900HT Fast Real‐Time PCR System, together with human genomic DNA standards of known concentration (the sequence of the particular c‐myc amplicon is identical between humans and chimpanzees).

    Article Title: Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression
    Article Snippet: DNase I (Turbo DNA-free, Applied Biosystems) was used to remove DNA contamination. .. Reverse transcription PCR (RT-PCR) was performed with 1 μg of RNA in a total 20-μl reaction volume, using the SuperScript III First-Strand Synthesis System for RT-PCR (Applied Biosystems), and PCR amplification of the cDNA was performed with High-Fidelity PCR enzyme mix (Fermentas). .. The first-strand cDNA synthesis step was conducted at 55ºC for 1 h, and the cycling conditions for PCR were performed as follows: 3-min denaturation period at 94ºC; 20 cycles for 1 min at 94ºC, 45 s at 51ºC, and 1 min per kb of DNA template at 72ºC; and final 7-min extension at 72ºC.

    Article Title: Single Amino Acid Arginine Deprivation Triggers Prosurvival Autophagic Response in Ovarian Carcinoma SKOV3
    Article Snippet: First-strand cDNA synthesis was performed using First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania) and an oligo-dT primer according to the manufacturer's instructions. .. PCR was performed using a High Fidelity PCR Enzyme Mix (Fermentas) with the following primer pairs: ASS-S, 5′-GGGGTCCCTGTGAAGGTGACC-3′; ASS-AS, 5′-CGTTCATGCTCACCAGCTC-3′; ASL-S, 5′-GAAGCGGATCAATGTCCTGC-3′; ASL-AS, 5′-CTCTTGGTGAATCTGCAGCG-3′; OTC-S, 5′-AATCTGAGGATCCTGTTAAACAATG-3′; OTC-AS, 5′-CTTTTCCCCATAAACCAACTCA-3′; GAPDH-S, 5′-CAAGGTCATCCATGACAACTTTG-3′; GAPDH-AS, 5′-GTCCACCACCCTGTTGCTGTAG-3′. .. PCR fragments were separated by electrophoresis on 1.5% agarose gel and visualized by ethidium bromide staining.

    Article Title: Thermal Inactivation of Enteric Viruses and Bioaccumulation of Enteric Foodborne Viruses in Live Oysters ( Crassostrea virginica)
    Article Snippet: .. The capsid VP1 gene of a human NoV GII.4 strain (HS66) was amplified by high-fidelity PCR and was cloned into a pFastBac Dual expression vector (Invitrogen) at SmaI and XhoI sites under the control of the p10 promoter, resulting in the construction of the pFastBac Dual-VP1 expression vector. .. The correct insertion of the VP1 gene was confirmed by DNA sequencing.

    Construct:

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Clone Assay:

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Article Title: Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿ †
    Article Snippet: The hCMV clinical strains Coz and Par were isolated from blood and urine, respectively, by Stephen Spector (University of California at San Diego). .. A 5.8-kb fragment covering the major IE transcription units of Coz or Par was amplified by high-fidelity PCR from virion DNA using primers 588 and 589 (Table ), cloned in vector pCR4-TOPO (Invitrogen), and sequenced (Princeton University Syn/Seq Facility). .. Plasmid pGEX-IE1 was constructed by excising the 72-kDa hCMV IE1 coding sequence from pcDNA-IE1 ( ) via consecutive treatment with HindIII, Klenow polymerase, and EcoRI.

    Article Title: Thermal Inactivation of Enteric Viruses and Bioaccumulation of Enteric Foodborne Viruses in Live Oysters ( Crassostrea virginica)
    Article Snippet: .. The capsid VP1 gene of a human NoV GII.4 strain (HS66) was amplified by high-fidelity PCR and was cloned into a pFastBac Dual expression vector (Invitrogen) at SmaI and XhoI sites under the control of the p10 promoter, resulting in the construction of the pFastBac Dual-VP1 expression vector. .. The correct insertion of the VP1 gene was confirmed by DNA sequencing.

    Expressing:

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Article Title: Thermal Inactivation of Enteric Viruses and Bioaccumulation of Enteric Foodborne Viruses in Live Oysters ( Crassostrea virginica)
    Article Snippet: .. The capsid VP1 gene of a human NoV GII.4 strain (HS66) was amplified by high-fidelity PCR and was cloned into a pFastBac Dual expression vector (Invitrogen) at SmaI and XhoI sites under the control of the p10 promoter, resulting in the construction of the pFastBac Dual-VP1 expression vector. .. The correct insertion of the VP1 gene was confirmed by DNA sequencing.

    Plasmid Preparation:

    Article Title: Epstein-Barr Virus SM Protein Functions as an Alternative Splicing Factor
    Article Snippet: .. To generate the STAT1 minigene construct, DV1, 1.088 kb of the STAT1 gene (accession number , nucleotides 40293 to 41381), which contains exon 23, exon 24, and the intron between exons 23 and 24, was amplified by high-fidelity PCR and cloned in mammalian expression vector pCDNA3 (Invitrogen) at the EcoRV site. .. To generate DV4 plasmid, 2.598 kb of DNA including the STAT1 3′ untranslated region (UTR) and polyadenylation signal (nucleotides 45381 to 47980) was amplified and cloned into DV1, replacing the plasmid bovine growth hormone polyadenylation signal.

    Article Title: Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿Physical Requirements and Functional Consequences of Complex Formation between the Cytomegalovirus IE1 Protein and Human STAT2 ▿ †
    Article Snippet: The hCMV clinical strains Coz and Par were isolated from blood and urine, respectively, by Stephen Spector (University of California at San Diego). .. A 5.8-kb fragment covering the major IE transcription units of Coz or Par was amplified by high-fidelity PCR from virion DNA using primers 588 and 589 (Table ), cloned in vector pCR4-TOPO (Invitrogen), and sequenced (Princeton University Syn/Seq Facility). .. Plasmid pGEX-IE1 was constructed by excising the 72-kDa hCMV IE1 coding sequence from pcDNA-IE1 ( ) via consecutive treatment with HindIII, Klenow polymerase, and EcoRI.

    Article Title: Thermal Inactivation of Enteric Viruses and Bioaccumulation of Enteric Foodborne Viruses in Live Oysters ( Crassostrea virginica)
    Article Snippet: .. The capsid VP1 gene of a human NoV GII.4 strain (HS66) was amplified by high-fidelity PCR and was cloned into a pFastBac Dual expression vector (Invitrogen) at SmaI and XhoI sites under the control of the p10 promoter, resulting in the construction of the pFastBac Dual-VP1 expression vector. .. The correct insertion of the VP1 gene was confirmed by DNA sequencing.

    Real-time Polymerase Chain Reaction:

    Article Title: CHIIMP: An automated high‐throughput microsatellite genotyping platform reveals greater allelic diversity in wild chimpanzees, et al. CHIIMP: An automated high‐throughput microsatellite genotyping platform reveals greater allelic diversity in wild chimpanzees
    Article Snippet: .. Briefly, 2 μl DNA extract was added to 1× High Fidelity PCR Buffer, 3.5 mM MgSO4 , 0.3 μM forward (5′‐GCCAGAGGAGGAACGAGCT‐3′) and reverse (5′‐GGGCCTTTTCATTGTTTTCCA‐3′) qPCR primers, 0.2 μM of a FAM‐labeled probe (FAM‐TGCCCTGCGTGACCAGATCC‐BHQ1), 0.2 mM dNTPs, 1× ROX Reference Dye, and 0.5 U Platinum Taq DNA Polymerase High Fidelity (Invitrogen). .. Each sample was run in triplicate on a 7900HT Fast Real‐Time PCR System, together with human genomic DNA standards of known concentration (the sequence of the particular c‐myc amplicon is identical between humans and chimpanzees).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Function of the Pseudomonas aeruginosa NrdR Transcription Factor: Global Transcriptomic Analysis and Its Role on Ribonucleotide Reductase Gene Expression
    Article Snippet: DNase I (Turbo DNA-free, Applied Biosystems) was used to remove DNA contamination. .. Reverse transcription PCR (RT-PCR) was performed with 1 μg of RNA in a total 20-μl reaction volume, using the SuperScript III First-Strand Synthesis System for RT-PCR (Applied Biosystems), and PCR amplification of the cDNA was performed with High-Fidelity PCR enzyme mix (Fermentas). .. The first-strand cDNA synthesis step was conducted at 55ºC for 1 h, and the cycling conditions for PCR were performed as follows: 3-min denaturation period at 94ºC; 20 cycles for 1 min at 94ºC, 45 s at 51ºC, and 1 min per kb of DNA template at 72ºC; and final 7-min extension at 72ºC.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher extension pcr
    Extension Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/extension pcr/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    extension pcr - by Bioz Stars, 2021-07
    93/100 stars
      Buy from Supplier

    97
    Thermo Fisher expand high fidelity polymerase
    Expand High Fidelity Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity polymerase/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity polymerase - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    98
    Thermo Fisher expand high fidelity pcr system
    Expand High Fidelity Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Thermo Fisher
    Average 98 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2021-07
    98/100 stars
      Buy from Supplier

    97
    Thermo Fisher enzyme mix expand high fidelity enzyme mix and avian myeloblastosis virus amv reverse transcriptase
    Enzyme Mix Expand High Fidelity Enzyme Mix And Avian Myeloblastosis Virus Amv Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/enzyme mix expand high fidelity enzyme mix and avian myeloblastosis virus amv reverse transcriptase/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    enzyme mix expand high fidelity enzyme mix and avian myeloblastosis virus amv reverse transcriptase - by Bioz Stars, 2021-07
    97/100 stars
      Buy from Supplier

    Image Search Results